RICERCA GOOGLE
 Smartphone Smartwatch Tablet PC Notebook Altro Informazioni
Apple iPhone 6S

 Smartphone con sistema operativo iOS, display da 4.70 pollici; risoluzione massima di 750 x 1334 pixel pari ad un rapporto di 326 Pixel per pollice (PPI). Dotato di 2 fotocamere con ottiche da 12.00 Megapixel sul lato posteriore e da 5.00 Megapixel sul lato frontale. Apple iPhone 6S è equipaggiato con processore Apple A9 64 bit a 20 nm e coprocessore M9 con 2 GB di ram DDR3 e 16 Gb di memoria interna. Apple iPhone 6S dispone inoltre di connettività NFC, Wifi di tipo 802.11 a/b/g/n/ac, dual band, hotspot WiFi, Wifi + Mimo, rete 3G/Hsdpa, e supporto rete 4G LTE

DIMENSIONE SCOCCA 138 x 67 x 7 mm
PESO CON BATTERIA 143 grammi
RISOLUZIONE MASSIMA 750x1334 pixel
DIMENSIONE DISPLAY 5 pollici
TIPO DISPLAY
RISOLUZIONE 4K Non supportato
RISOLUZIONE PPI 326
FUNZIONI E SENSORI
Sensore di Prossimità: ✔ Si
Accelerometro ✔ Si
Bussola digitale ✘ No
Sensore Ambientale ✔ Si
Giroscopio ✔ Si
Barometro ✔ Si
Pressione ✘ No
Compasso Digitale ✘ No
TECNOLOGIE DI RETE E CONNETTIVITA'
DOPPIA SIM ✘ No
SISTEMA DI RETE LTE
LTE/4G ✔ Si
VELOCITA' 4G Cat6: 300 Mbps DL, 50 Mbps UP
3G/HSDPA ✔ Si (di tipo 42 Mbps)
GPRS ✔ Si
EDGE ✔ Si
NFC ✔ Si
SISTEMA OPERATIVO iOS
BATTERIA  
AUTONOMIA STAND BY 240 ore
AUTONOMIA IN CONVERSAZIONE 14 ore
TIPO BATTERIA Batteria Li-Ion
CAPIENZA BATTERIA 1715 mAh
ENERGIA STOCCATA 6.174 Wh
HARDWARE  
PROCESSORE Apple A9 64 bit a 20 nm e coprocessore M9, 1.80 Ghz
TECNOLOGIA PROCESSORE Processore a 64 bit
MEMORIA RAM 2 GB DDR3
MEMORIA INTERNA 16 GB
MicroUSB ✔ Si
CONNETTIVITA'  
WI-FI ✔ Si
DLNA
HOTSPOT WIFI
WIFI DIRECT
BLUETOOTH ✔ Si
INFO BLUETOOTH versione 4.2, standard A2DP, LE
 
AUDIO E MUSICA  
RIPRODUZIONE VIDEO Supporta formati video video H.264 fino a 4K, 30 fps, High Profile livello 4.2 con audio AAC-LC fino a 160 Kbps, 48kHz, audio stereo nei formati .m4v, .mp4 e .mov; video MPEG-4 fino a 2,5 Mbps, 640x480 pixel, 30 fps, Simple Profile con audio AAC-LC fino a 160 Kbps per canale, 48kHz, audio stereo nei formati .m4v, .mp4 e .mov; Motion JPEG (M-JPEG) fino a 35 Mbps, 1280x720 pixel, 30 fps, audio in ulaw, audio stereo PCM nel formato .avi.
USCITA TV ✔ Si
USCITA HDMI
RIPRODUZIONE AUDIO Supporta formati AAC (da 8 a 320 Kbps), Protected AAC (da iTunes Store), HE‑AAC, MP3 (da 8 a 320 Kbps), MP3 VBR, Audible (formati 2, 3, 4, Audible Enhanced Audio, AAX e AAX+), Apple Lossless, AIFF e WAV;
RADIO FM ✘ No
FOTOCAMERE  
FOTOCAMERA PRINCIPALE 12 Megapixel con True Tone Flash
RISOLUZIONE MASSIMA FOTO 3:2 3264 x 2448 pixel
FORMATI FOTO PRINCIPALI

 
Massima: 4243 x 2827 pixel
Media : 3000 x 1999 pixel
Bassa :2121 x 1414 pixel
FOTOCAMERA SECONDARIA 5.00 Megapixel
REGISTRAZIONE VIDEO 4K 3840 x 2160 pixel a 30 fps, 1080p HD a 60 fps, 720p HD a 30 fps, slow-motion 1080p a 120fps o 720p a 240 fps
APERTURA FOCALE f/2.2
SENSORE BSI Si
FUNZIONE HDR Si
FUNZIONE PANORAMA Si
FUNZIONE 4K Si
GPS E MAPPE
GPS / AGPS ✔ Si
GPS Si
GLONASS Si

 
 
8 Gaona 2 iuçara 226 PL 2 Mbaukua 47 Perillo 1 garufa 8 mansos 6 Gregório 1 otourgouse 1 forntes 1 Ööpik 1 ferraria 1 GGAAT 1 lallans 2 ofrecelos 1 Incest 130 iodo 1 Jezek 23 PGD 3 Inxerto 3 Firmat 14 Fossey 2 pecilopsetinos 1 Halar 1 oclusores 1 Gallimimus 1 lortetii 3 Halloren 8 Genetics 1 Gomattou 2 oiense 3 Lamond 2 NAc 6 oxalacético 2 nebouxii 1 Ojore 13 megacariocito 1 Labelling 12 Faverani 25 Límites 1 Pioglitazona 2 Falles 66 nominacións 9 liberaba 1 framboð 2 Mataperros 2 Opañel 2 hinum 1 obtíñas 1 Physika 3 fMRI 1 lack 3 lóxicamente 1 morfoestruturais 1 fórica 1 italina 1 Ortisoara 8 Hildibaldo 17 Orrea 5477 lugares 4 Goshen 1 Lodoméria 7 miticultura 10 Melhores 2 Holywater 11 Minero 20 Hoorn 4 lidan 3 intrapeciolares 5 flavínico 58 GAL 1 paleomagnética 8 GRACE 6 Iparraguirre 2 Hirao 2 Oeric 1 infográficas 1 kambaris 1 Küche 1 huadingense 1 Grigolo 3 Labov 1 MiNr 1 mbmtrio 1 fragorosamente 1 marxinocéfalo 4 Jamboree 56 glioxilato 173 News 1 onsumer 4 Pillados 1 Lawgar 2 Mimocaris 2 normativizadoras 1 Kristenliv 1 panteek 1 Kuber 2 Jurine 7 Moutillón 83 limpas 3 larvais 170 mandos 1 isamill 1 Kiyotsugu 14 Orangután 1 Mi??i?i 7 Jordy 2 monotecas 1 Happenin 1 liquidador 1 IXS 241 Pintura 1 Mogosani 1 Granapop 1 garinagu 3 invaxinada 3 muxtar 1 Indukern 1 piam 1 MENTO 1 Mashbash 16 Goodfellow 1 Héja 3 lucht 4 maridanza 3 Lefkandi 3 parasíticos 1 Gites 1 fotodegradación 1 Paparregopoulus 1 parrroquias 1 Gaianes 1 molecularess 43 intercaladas 1 Kaupungintalo 1 obxectalista 1 Gaedel 1 oscurece 11 fluidamente 1 immeuble 1 Kharsianos 2 oidea 1 Nishina 14 ihrer 24 Hunan 1 PAPMP 1 Merdirossian 4 Farscape 8 Lit 17 Medín 1 Imerton 1 Markat 1 infuentes 2 Millin 20 Marwan 1 Ottonianum 2 Magadalena 21 Hemeroteca 2 Miradero 1 Pelopicopata 5 lug 218 fenda 8 famílias 5 Kinugasa 1 Gemestario 1 Marinosu 10 NAO 1 ICPA 1 pateras 10 interrompéronse 1 Panisello 3 Longra 1 Herculius 3 modernizáronse 1 Patagonoia 2 Gymnomuraena 2 feasta 1 indicencia 6 Halperin 1 Maleolo 5 Milii 1 Hemignathus 1 inioideos 1 lecenzas 1 Keramik 1 Nuriya 1 industriels 3 Landschafts 1 Geus 1 Kedostris 2 KwaDukuza 1 Haubersbronn 29 monotelismo 2 HYDACE 3 Kyoi 2 Lumut 1 levende 4 herausgegeben 1 levaríanlle 2 Geme 1 frealas 1 Kaftor 3 MUSIC 1 Jocktopus 1 håndbold 1 gopuram 1 Mammisi 2 Manureva 10 irresponsabilidade 1 labradorensis 1 mas 7 Kekkon 4 Gebroeders 1 Kannedy 1 ortonitrofenol 2 Kosnica 3 iolensis 1 Mentalidade 5 Liderando 1 Goyel 1 Heliorestis 2 FDCs 1 fause 2 Matiza 16 Motosu 1 Nepomuceo 1 ocasionábanos 22 Parts 3 Gregorian 1 Guraena 1 leiturga 6 Mádl 1 Fatha 9 partitas 1 Mitcell 1 INVEST 1 Mascherino 5 Ic 4 museísticos 1 medicaginoides 1 KFWB 1 pelargon 1 kansas 2 Iacopo 1 Hispellum 2 lampasado 4 frítense 1 fourcadei 1 irritadizo 2 hoose 2 Kes 3 Fallot 1 LRPPRC 1 Nordhav 3 involucrándose 11 Moka 88 ocasiona 1 Placental 1 Kalamara 2 paleoarcaico 42 Internacionalista 1 gratificar 28 Lazzaro 1 Pereiriños 2 manexamos 1 grasnado 1 Pisaj 1 galericulatus 1 Laíña 1 multispinus 2 Kowa 57 Malena 1 huanaco 60 NET 1 Lengua 1 Kobilovic 6 fígados 1 Lacipo 1 Momis 1 fusuma 1 Osteopática 1 mutlu 1 Kíneshma 667 modificación 1 Freixende 6 microsegundo 1 Fitze 2 Moeta 1 hireatismo 125 ignorancia 2 integralis 1 Meikan 3 Galdiano 1 marxen 1 Hannis 1 mar 1 gatti 13 leer 1 Ginepri 7 Monograph 1 mortui 1 Gosudarstvennoe 1 manol 26 Milanés 2 Kiku 3 Girodet 4 Klin 1 Homard 12 pao 2 Klogo 1 Kaplán 1 Pagëzimit 1 Gutt 47 navegadores 1 IEME 1 Foetataxus 2 matthewsii 1 Maranville 5 goliat 1 Otzovist 4038 Le 9 Heretic 4 Moonrise 3 Mazoku 1 Ljubaj 1 Lukasgilde 1 hachibanshokan 4 Krausismo 21 Joicey 6 flector 1 ontroller 1 osceola 1 Hakimo 7 interferómetros 6 Floyran 2 Phleng 2 libraran 1 ortopodolóxicos 2 geopolítica 25 Júcar 4 mercaren 1 Henneberger 167 organista 25 Gut 4 pharaonique 34 Inocentes 2 limilngan 2 PALOPs 2 internouna 3 Lingue 1 Jinniushan 2 Ioseba 2 impregne 1 pedíanlles 1 hibridantes 1 Jusseit 2 Pergocrema 3 Katheryn 1 Gugga 1 iniciales 2 M? 1 Kokun 6 Montagnana 5 ignominia 20 Jolly 157 identificadas 1 Ishkibal 1 Kolaio 2 meldu 6 Kastaraya 3 ké 1 galoil 1 ficinos 1 Lesi 1 Ischyromene 1 Leuchten 22 mimo 1 Montemuiño 1 nedras 1 Overexposed 1 hipodopaminérgico 1 Odobescu 2 movéndoas 2 FrancoAngeli 3 picudos 1 manganoso 16 outubro de 1 Maff 5 máís 3 necesitaríase 158 Ledo 2 Lissouba 4 hidroelectricidade 1 Nikritin 1 Gjinushi 2 Inverigo 27 noiro 1 halka 11 gentilis 1 permanezcan 1 lavándoos 1 Montflovin 1 Ghequinan 1 Manier 1 partixa 1 Niyazbekov 1 Malohu 1 Isadoro 3 funcionalizados 22 Monbus 1 Két 59 Offenbach 7 Goal 2 perpetuidad 2 Keydren 4 Mendosicutes 2 Løve 1 Mahoning 12 implantadas 44 involuntaria 5 Majorca 3 FasL 18 Noviembre 1 Luzyce 198 perdeuse 2 interactif 1 Juprelle 2 jotuns 1 persuádeselles 2 FIF 2 Felgosas 3 fB 1 multixugador 1 necrotoxinas 1 palatocadrado 6 permítennos 38 Flood 1 Lagazós 1 msd 1 Meyr 42 Pelota 1 internaciona 1 Grandracmon 1 Hns 1 infrautilización 1 Hitmonchan 1 Nassauischer 77 Graciano 2 longissimum 1 hullero 1 Koutouba 1 Gogh e 4 Mnemosine 1 graviportal 2 Palmanova 1 lletres 1 iluminarían 8 Ngorongoro 1 inobservable 38 naos 1 fillius 654 medo 2 Palaemoninae 1 ?âmis 4 Melitene 2 nawaga 1 Gulkishar 1 Navasota 6 freón 37 intercesión 3 nucleobase 1 pigmentum 1 januensis 2 lögner 7 Ixión 4 Laurea 1 idenpendente 1 Kouloúndros 4 Impares 13 Kythira 1 Nirmanakaya 4 Hatsu 1 Melodorum 1 Mätressen 1 haédicas 1 Oroxo 1 Gastrococos 1 Nandinig 1 Leveza 3 Mansur 3 Gennero 1 gillt 4 Mitríades 3 Mórrígan 1 irupé 8 incorporala 1 Klimas 1 merushi 1 Ignacianas 6 lixiviados 3 macka 44 Grasset 4 microcarpum 1 Halfon 60 Ferraris 9 padrona 1 Klabat 8 Ferb 1 giusta 1 metrolóxicas 8 Pesco 3 Kauniainen 1 lembrâ 15 Fingers 1 F?t?li 1 Guangxí 3 muán 5 Mbasogo 1 Lastrado 34 incandescentes 1 maravillados 27 Mancomunidad 5 Hirota 6 Hilgendorf 1 follón 5 hiperlipidemias 20 Mandelstam 5 Gromyko 1 Fulilangi 1 Intercomuna 1 Mongi 2 moteadas 1 Guelal 1 luterán 12 Kollontai 6 Ouxea 4 Inspiration 13 Loura 1 gradaría 1 Jàn 18 Ingenio 6 Marwnad 1 Ovalado 4 Nimaviridae 25 imbricadas 3 Homoxeneidade 1 normativistas 5 Mhaigh 1 indisposicións 1 Hivernia 12 interludios 36 Pick 1 Fordsimo 2 maleante 2 Mierla 1 Fijitsu 42 giorno 2 MetalGreymon 1 Maturi 2 Occidentalización 1 Gudanji 2 PCPV 5 PDyC 1 Koruçam 5 MMM 1 Palsola 1 moutan 13 Feuer 2 Grégorien 1 ngg 47 Intendencia 13 necesitará 1 NEGÓCIOS 1 nuk 43 filmografía 4 Latex 2 persuadiuna 28 Juán 1 géno 120 imperialismo 2 glicosilases 1 futtoboru 3 Pilis 4 kaierak 1 Leparquier 2 mino 1 Kapler 2 Freytez 1 pentatiacicloheptano 1 Laballós 1 Jacir 1 Pásztó 4 Muntadas 1 muitu 1 Mahalingam 1 küßt 1 Girardet 1 Felling 2 haíresis 2 heian 1 Iamalele 5 Loong 1 Iupanus 3 Ornia 4 InterVarsity 1 ?r?Hnom 5 odioso 9 Jagdpanzer 1 Izhevsk 81 Orán 1 Playetas 1 fulfude 8 NRP 3 fálla 21 Isca 6 Fisherman 4 Hliddal 3 kore 1 Gjakovë 1 included 1 mancomunar 4 Francio 5 Numide 5 pert 1 Ostwürttemberg 1 helisuperficies 1 Lionardo 1 formadoormado 1 Minelava 1 peperino 1 Möriken 1 lugaro 1 Paronychieae 1 Illiac 86 Nate 1 métallurge 3 Fierstein 1 Larvatus 2 Frieben 2 intransigente 5 islands 1 nacionalinis 1 Nucleoplasmicas 17 Loureza 4 Matamala 1 Mafrundi 1 frívolas 23 leninistas 7 Flugzeugwerke 1 organilleiro 1 MegaExito 1 Pasienky 5 Orbenlle 1 Kamaq 1 muid 2 IronPython 1 Inugami 28 herdeiras 1 Halmstads 1 negroafricanos 5 Hiatt 1 lste 4 Ocultación 1 foirman 1 Metropasseigdegraciaescales 4 fus 1 FCCA 1 Omotic 14 olivar 1 Fannes 6 Mairéad 1 Parisiensi 1 Perucci 146 Pirelli 2 Mañóns 3 Limey 2 Lutzow 1 Fonssabaton 7 Honras 1 multiplicó 2 omnilingua 4 medicinalmente 1 Mardon 1 Ogijima 66 linces 3 Guicho 1 ordénaas 1 Matoombo 1 hibridas 492 participando 1 Neum 4 Montecalvelo 8 igualdades 1 Gallicant 16 pallas 9 lexicográfica 1 hiperglicemiantes 1 hónrao 1 opetrador 1 I?????a 10 hole 1 Liberalno 1 Hajnalka 1 pachycalyx 18 individualistas 1 Gnathostenetroidoidea 2 Mizerable 1 Hašim 4 Fidalgos 2 nefrostomas 1 Galeschin† 1 mahrattensis 1 Motorcoaches 5 multiplicados 1 La?Keen 1 Mazdai 2 Libéral 2 Kamianiec 1 Mittalgate 1 Fontaniella 3 Hallingdal 1 ICTE 1 Hoplopagrus 1 pär 1 Mechoulam 1 Kayne 11 HIC 13 Género 1 kirchbergensis 2 Jazari 40 Moncloa 4 FIJL 2 oxobutanoico 2 madiados 1 Melitaeini 1 Indarte 1 meldussë 1 ofertarllo 1 Marquerie 1 independizárase 1 hirman 1 Oxyphotobacteriae 2 Nobutaka 3 Foram 2 Ocero 1 Morgengesang 2 nagodba 16 Gallur 1 molecularizada 6 mind 1 Nasik 1 Ménthe 7 Maigh 1 hésite 1 Paráronse 7 PINN 2 Kelman 1 Gongau 11 Generoso 1 irreconciliáveis 4 Iuan 2 Marhaus 9 luita 1 isotusilaxina 2 Hokianga 3 Huatava 1 indícana 5 gravala 1 Marandín 4 geographica 7 instanciar 6 Mergullo 1 Maloa 1 Labouseg 3 Legros 1 irrespirables 1 mexou 25 lenticular 1 Khazaks 2 Murdack 5 Isomorfismo 2 Morpurgo 1 muittát 1 gariyasi 1 peis 7 onca 8 Lilia 1 Identificase 2 Övertorneå 1 Kushila 7 Guaraná 1 Ingra 1 kpb 1 neblinas 21 PKC 1 Lokon 1 Mirillis 2 knocking 1 Leprechauns 1 Neolepton 1 interestaduais 1 magnetomotriz 1 Nikaya 4 octagonal 2 Herbon 1 Germinie 3 pausada 1 Nguékhokh 1 interrupts 1 Marchandia 1 HPGL 2 Koshiro 1 Naundorff 4 fortificouse 11 persianas 6 Ort 1 olsteóctio 2 implementouse 1 Ibería 1 Memòrias 1 kshatriya 18 Odas 2 Henet 1 periclitados 4 NOV 4 Friulano 2 Nikkor 1 Pessimistic 4 Fendigaid 22 Oberon 1 Jamshedpur 2 integrábana 4 Nunnally 1 physaloides 2 NPI 1 MW— 1 Pedto 8 Indattu 6 lycophytas 38 mingua 17 marzo de 1 Pajuçara 1 Gamella 2 Heavens 163 ganancias 5 Malacitano 3 Hidrogenesse 1 Pattina 22 pescarías 2 miscellanea 1 Lênin 1 Kittsee 1 Pholidostachys 1 Jiguen 18 pechaban 7 Impotente 1 heliocrómico 142 Murillo 1 hexodiadema 5 mostramos 64 pancreático 3 Filmways 1 nuttalliae 4 perceptíbeis 1 narracción 1 Marieke 14 pictograma 1 hortofrutícola 97 Mitrídates 4 orchestra 13 Flavobacterium 4 Pilus 6 Leguía 2 Livai 3 perpetrar 3 neuroleucina 1 Nitrosovibrio 28 fui 1 Islámicas 1 Kononfla 2 Lenihan 1 Kankalaba 2 Lagarón 3 Pernau 1 FONCODES 20 pasador 2 Kuhta 1 pAPN 4 Miadelo 8 hechas 1 mergullidas 1 Hârse?ti 2 Mochicas 236 Mill 34 Mesut 1 Indempendiente 133 lince 8 Marasantiya 2 Nandrolona 1 novísimas 4 fluxións 1 Olabarría 2 iber 4 Mesoatlántica 9 Muiredach 18 Outeiriños 1 Lewartow 1 oktanglap 4 Kgalagadi 164 Gaza 9 Históricamente 6 Mitridáticas 1 limigocha 2 infrarrealista 6 planctónico 7 Nationalmuseum 2 Nicóstrato 1454 permaneceu 3 Frode 1 ilm 10 namorara 2 hexacantos 1 fulminan 112 Piadoso 5 pecan 1 Herbebois 3 Mentir 1 guh 1 palatine 1 linkweiensis 1 Importantísimo 2 Guidjel 1 Naramsin 4 Heartburn 1 Normandíe 1 immortais 1 Máza 61 fascinación 1 kankuro 8 Lakatoro 1 hareket 1 Fuxamos 1 Panlatina 1 Flacidio 1 Gangland 1 Oriúndos 1 Laitec 3 Mabey 1 Isarre 1 Parnita 4 Ossie 1 gema 1 Hinbasu 5 Lepidosauromorpha 1 padam 4 Holles 2 inclúeos 2 Offline 8 pausado 1 Mendibieu 1 impudeur 6 Hazaraguí 1 numista 19 mutase 19 paquistanís 1 Faxing 1 GSVO 1 LondonOuterCensus 3 isopentano 2 Obscur 4 Moscavide 5 gallois 2 Labina 2 hebre 6 paniscus 14 metabolizados 151 Heredia 1 Kentrotas 1 homonymes 1 homónina 1 metría 8 Malecón 1 Milioti 1 matriliñaxes 356 interface 4 Perigord 2 interpretarán 25 Gunther 8 Interrompido 3 ihau 1 percibides 63 intercambian 1 orléanaise 1 Ortigaria 1 Joo 1 improvisase 1 mistops 3 fracturados 2 IASB 2 Longana 22 Holdings 2 Fremde 5 Mayabeque 1 ortóquidas 1 GAÑADORA 1 Havelet 2 jewel 52 obrigouno 1 Geureudong 1 Moresnet 20 Húnavatnssýsla 4 Jedan 5 Muhl 1 Miluze 2 Nycticeiini 1 Picayo 1 Nesøya 1 garantíuselles 8 Garrastazu 1 hieroglyphos 1 nonagrama 6 Kitag 4 mesturase 2 pelouriño 1 Flavell 5 Hermandino 16 Pensar 9 Konarski 125 intentaba 1 Hando 4 Kommentar 2 Patanean 1 Hammoud 1 metreto 3 furibunda 1 Levario 11 Moustapha 1 Mimomys 1 holonato 1 Granho 1 investigació 1 Herfried 1 Ombga 1 Orlat 48 oporse 5 Kuczynski 1 hronika 5 Paleoindio 2 Piedritas 2 Idil 8 Mariposa 2 Lumiconger 5 homogéneo 1 Phraxis 1 Lowelle 1 Microstigmatidae 1 Galvanizando 3 niveum 451 Leiro 1 Frenet 2 Libraron 8 Kimolos 1 JUDEX 2 pensum 4 Heróis 8 Kastoriá 1 Odiong 5 Kaman 1 jeno 6 forzase 4 Fraktion 1 Lungani 1 nasalizar 1 litanas 13 Herd 1 nigromaculans 1 Kákalot 2 Hitleriana 1 Igalamela 23 Gujarat 2 platanos 2 Plawgo 1 Hedqvist 1 Khinkali 1 isotiazois 1 Jacalteco 2 Incomparable 1 Gymreig 1 Pesti?u 3 petador 1 Lørdag 2 Okiku 3 longistyla 4 platanístidos 5 Filantrópico 1 mesinenses 1 furcación 1 Hyer 1 Phryganella 9 Musashimurayama 1 Fallilou 4 motus 1 Jinky 3 meditativo 1 parafinadás 2 Onuba 3 Heura 3 Nunó 1 Panish 3 Hewett 1 Hímetus 2 louba 1 Hirtenbriefe 2 Lulli 1 Hoadley 55 HH 1 GTKAda 1 Joca 1 oxazolidin 1 muwa 1 pecuniariamente 1 péptidoglicano 2 Imbiss 1 intrasitividade 105 Granadinas 2 Metálica 45 Nete 2 mocinno 33 Macedonio 1 Metroland 1 hidraúlicos 1 HinfI 1 Nazarabad 1 Györffy 4 jamisen 5 incomunicados 3 Pastéis 2 Ndee 1 fotoevaporación 1 gaby 4 McKellar 6 ocasions 1 geon 1 Kopfgeburten 2 moldearse 1 nabiñeiro 10 Invitación 2 Novafeltria 3 Odorico 1 Montagau 1 Kantorka 752 identificar 1 ishidoyana 1 Fundidor 6 Gaussen 4 mancharon 1 Gaidropsaridae 1 haifensis 2 multifuncionalidade 1 Larreátegui 1 fratuas 2 Jamba 105 mangas 30 Nasa 1 Khasrax 1 octulosonato 1 muortos 1 Isomaltitol 2 metrolóxico 2 galbana 1 Impostors 6 Kazu 1 iriye 4 Invitada 1 Gwaram 3 Manahuac 1 getroffen 2 Koroba 1 migrastatina 1 lasaan 1 Jencik 1 gmbH 1 Hallgrímskirkju 1 Nêrêís 1 longicalyx 4 incineradores 1 Mönch 4 Instruction 7 incomprensíbel 2 PFG 2 Lonorore 3 Jolies 1 IGEM 13 Observou 49 Miniserie 1 misere 3 invista 1 Metamorph 1 manierismos 1 Heizo 1 marrinxes 3 neomercantilismo 1 Moralisme 1 Lodeynoye 4 iusnaturalismo 1 Mulenze 1 imod 75 FGC 1 Khabir 17 parácrinos 1 Nadeja 1 Hierasus 44 oe 2 genero 5 Plantada 2 Huangshan 1 handiak 1 Partidi 2 hominidos 2 foliosas 3 Interbrand 1 frontieira 8 Madrigalejo 1 Lash 1 Königlich 1 miñaxoia 1 Kurzfangsperber 7 Odetta 1 Lechatelierita 2 Moumu 1 istiqa 4 G=C 45 Francelos 5 grigorjewi 2 mantenos 2 neure 3 Keven 4 Oua 1 Kabilkin 19 Fraíz 1 Magneton 13 Garai 1 hydrolique 1 Petrosur 1 Peran 1 Guzut 1 karko 4 Metacrangon 6 ort 11 Lovelhe 1 Himatsuri 1 leitga 1 mukashi 1 Nockherberg 1 Olotense 1 Kword 1 Miguigy 1 pilabán 1 megaFLOPS 18 Moyer 1 parises 2 Neerlandeses 837 millo 1 Guler 1 lamon 2 Farmaco 3 Melan 1 Peachums 6 Narrator 1 olvidaremos 3 Jusã 1 Lutazio 1 lunedì 1 Negli 1 laburo 1 Phytelephaceae 2 ofrecerase 1 johngarthi 1 Mijuskovic 1 Lazara 4 Gramiano 4 flexo 1 nousee 14 manada 40 Hípica 1 fouye 1 Friese 3 Morquillas 1 lubimaja 1088 Nadal 1 Kristanna 1 oleoducto 1 luminance 1 greuges 1 fúmanse 6 Leasing 8 opresivas 4 ókrug 2 Pessac 1 opBahrain 10 Mioglobina 1 Hekate 1 Peppermints 1 Konstens 32 negada 1 Horoatu 1 microgrits 116 malte 1 pilce 2 Mermaids 1 Mardaites 1 peos 1 FC italiano 2 Gauzón 3 Osinde 2 interraciais 1 Kaciaryna 2 palotero 4 Lupercio 1 heptahelicais 3 Kresy 1 Kapu?iwa 1 Licheiro 80 fúnebre 10 Iásnaia 1 Paschalococos 3 Jehane 5 Packer 1 lactobacillus 2 frequentadores 1 Lishni 4 Joschka 10 Heppner 1 förhistoriska 1 Göy?z?n 1 Gongfu 2 Guízar 20 Observadores 1 Kuko 3 Kuartango 1 Gallionellales 1 folli 13 felicitou 3 Malielegaoi 1 Hoarfrost 9 Mattingly 1 Paschkis 1 fucosilación 1 Nõva 2 inagurou 28 Frio 59054 lugar 1 Kölnische 59 obrigatoriamente 5 niveladas 1 marke 18 narcóticos 1 Leithaberge 1 kaupstaður 1 meritocrático 2 Illex 3 Leucosolenia 2 Lawrenceburg 1 Lletanies 1 Monumentum 1 manobrábel 2 HCA 1 Gualazzi 1 Odnoklassniki 1 itl 96 hockey 32 Mio 1 hilatura 2 Feixoada 1 hner 3 Neer 2 númenóreanos 7 Osservatore 287 ferroviaria 1 howitti 1 nominda 1 luída 1 Mediahoz 2 hispasonic 44 multitudinaria 1 Philología 25 Foy 1 Partenza 9 Nga 51 Nagy 13 Martinu 11 lograrse 1 introduir 1 nadarían 4 Náisiúnta 1 Orent 1 Kapor 1 hipervolemia 1 Nachruf 2 panzer 178 maduro 2 Gratz 7 metaloide 4 Misr 1 Milquet 1 MyNCBI 1 Filathlitikos 1 Geometrica 1 Oetinger 9 Pinkett 4 Feith 1 Pitireo 1 influíuna 1 imendeses 1 Nepoviridae 1 Hefford 1 Partire 2 Ouxa 1 Mpenza 2 microrreservas 15 Hartsfield 3 Hogness 4 Maunier 1 Hyophorbe 1 Grammicolepididae 1 Hausser 1 Filala 2 fides 1 Loctugan 3 plantean 2 Idaira 1 Mythopoeic 25 Lilian 2 Headhunter 1 finaliar 1 paleomediterránea 1 macarèu 1 lattughella 7 kipá 7 Neuper 1 mapando 1 hibernada 16 Katja 2 Numerarios 2 Kiuchi 1 Leondopoulos 2 Itaianagi 1 LLotja 1 moxena 13 Moho 1 Luchthaven 75 Metabolismo 1 Noesis 2 macroura 1 Lebombo 1 Lenciscus 1 foli 1 megalómanos 1 Laitak 1 Farrodes 1 Hekseringen 6 Meltdown 4 Pierrakos 1 ibas 3 misionais 1 Heijdemann 6 maru 4 paisaxisticamente 1 piuchén 321 notablemente 5 Hasselblad 1 hebro 1 MarineAngemon 4 inferius 1 Fná 1 Ichoa 5 Nacera 2 Naturforschender 5 GAPs 2 Meropio 1 Menkhough 2 Orri 4 Kozma 1 óxico 1 Ornedo 212 Plana 2 Neuzeit 1 jazzísticas 119 insuficientes 77 hexagonal 1 Guerrara 1 humedécese 2 gomoso 13 Hermosillo 2 meiguería 1 molécules 1 Matabacas 1 particularizábase 1 micholitziana 2 Fheis 1 Lutalo 1 grobari 2 Gismana 1 m?se?u 2 gnotobióticos 2 kázaros 1 Paquistaníes 3 Guajardo 2 madroa 3 Oomicetes 1 Inafune 1 piastre 5 Gentilly 2 Frontière 1 Grincheux 1 Helvianos 1 Fieldhead 3 pelargonidol 6 Imaging 1 Línzhi 33 Havel 1 Gwara 1 Hatchepset 1 hirpus 1 MACHOs 1 Gálioin 4 paralogs 1 Friedrichshof 1 kappabana 24 Parto 1 Guntimil 2 monopartidista 3 Friolera 1 mitopoético 2 Garko 1 myceto 1 imitade 1 Iannuzzo 6 Lelis 1 Lerberghe 1 oumentada 1 Marcorelles 1 Ozenzai 1 interrumpe 24 Leicestershire 3 morrida 2 peruvianum 4 Platinos 1 Meskhetiano 4 Gdy 1 Khedara 1 Krypto 1 Nemuri 3 Pepé 1 Lipomas 1 gwrug 1 HspC 1 kikuyu 1 Nimbaphrynoides 6 Madhe 1 Peuque 6 Marani 20 Keltoi 1 indícaos 1 Phok 3 Ichinoyama 1 ivucos 1 Huso 3 L? 4 Gabonés 2 GameSpy 1 Ferronato 1 Nemchinova 1 Muhoroni 1 Galivisión 411 incorporouse 1 Metallurq 33 maternas 9 infames 1 JECTARE 1 minusválido 6 Gamaliel 5 Moram 1 oozoide 1 ocularium 1 lemuriforme 1 Godom 1 intrucíndoa 1 Homelund 4 identifícano 1 monstrum 1 NSFNET 4 pinya 1 Korsh 1 Mocar 5 KOR 121 Paramount 23 Macpherson 2 Naraguantes 1 Isoglosa 1 ílax 9 Palol 1 lièvace 1 gingiva 1 Mayow 1 Jùlès 1 magistraturas 1 lloraré 1 Macurová 3 Omaita 1 Larbert 1 gemel 1 nitrocellulosa 1 Galufo 15 Odia 5 glicosilaminas 43 Glauber 1 Gramnosolen 3 fichaje 7 noctiluca 1 Macrocerus 1 litaneritas 3 Jerônimo 5 Gzip 1 Fonoti 1 mentalizados 2 pequecha 2 Platería 1 Mecanosensibilidade 3 Múrias 1 Mugamba 1 Libelice 2 ÍDEME 1 Marruma 10 Festivos 11 orbis 13 Landnámabók 1 needed 1 nuerosos 4 Giao 1 malathion 3 Gutbai 1 garaztar 2 mercuriale 16 Kufa 1 ganadaría 1 Neoludismo 1 inebitábel 2 neocomensis 1 Favella 1 fullr 1 Gagarino 6 metaterios 1 hornazos 2 Glykatzi 2 liquidámbar 1 Matiya 1 hayas 1 meisán 1622 imperio 2 Ispaniam 1 paree 1 Inquiétudes 1 homodimerizado 6 Ilene 1 paralizaban 5 marroquinaría 1 Ölfusá 2 Grammeza 4 Nintoku 1 INVOLAVIT 2 Norrmalm 2 oleoductos 3 homolítica 1 nonalter 2 Observatoire 1 NAPDH 1 patagoas 1 Moedeiro 1 íssima 1 m?nekebonom 4 Picandon 2 lexislacion 3 harmattan 1 intimidadora 66 ii 1 GYD 1 matese 8 perfetto 1 Izaki 1 Juney 3 Harutyunyan 1 Gigantocamelus 6 Halajá 10 lambe 1 hipoacusias 7 francmasonería 130 Morse 2 forcé 4 Nantosuelta 116 Hoya 2 Géreard 298 Miss 5 Miyauchi 1 Nieuwjaar 46 líricas 1 Mentura 8 Fingon 2 Morrisey 5 golfistas 6 Guimbarda 1 Liberta 1 phreaker 507 Moss 1 kkcrvenazvezda 1 Parastereopsis 1 Matamoana 68 Moita 1 MacGrudder 1 Oraovac 1 Inawaxiro 1 Nélisse 1 figueirola 1 lateralia 28 IPC 2 Imbé 5 Laemmle 1 Mindgate 1 Lloves 3 pandano 1 Hß 210 imaxinación 1 Galécia 1 krtz 1 Mansveldt 304 paralelos 2 Hispanismo 1 Obašašca 1 Garzia 2 Interferometer 1 GzLiNuX 1 Kintsugi 1 ntraceno 2 lii 1 hékso 18 frita 2 Goggomobil 1 Garn 2 glóticas 1 Gainge 3 Hiperlaxitude 1 philinae 2 Infernuko 1 Greenbough 1 Lejardi 43 Kunsthistorisches 2 Mexicanísimo 9 Herráiz 1 Hinterrhein 1 indecorosos 1 Inmobach 195 Hora 2 Hyalodiscus 4 Mantiñán 1 Gwenddydd 1 ooxénese 2 Haec 27 Kiro 1 Henwg 2 MEDIAS 1 Kalenberg 1 Giuedo 1 Naginata 1 Holártico 4 mesenquimatoso 1 Nawawara 157 orgánulo 1 Maibowle 1 Golab 1 Gözlerdeki 1 Incyte 1 ökonomischen 1 fensi 3 operaia 1 Meloda 1 o século 1 Learamoeba 1 GraphiteUSGOV 1 órganod 8 instalaranse 10 Palinurus 2 Gegundez 2 Juryj 1 fluorometilhistidina 100 Fenicia 15 Lassalle 1 gaurs 249 fortalezas 1 moritura 24 Fouta 434 Marzo 7 lignificada 1 Joran 1 Patzinakia 2 kenna 1 pescaprae 18 merlos 1 muriti 3 geognósticas 1 Jóncols 2 Jablonowo 2 formigueos 1 Oxyrhynchia 1 Grebennikov 1 Jiangshan 1 Fotogramática 1 Norops 5 Parches 1 Kingma 21 Pinocho 1 Laúdes 1 Ivezici 11 Grottaferrata 1 Gamato 7 Pescado 1 nju 4 ipsos 2 Göttsching 9 novedoso 20 Lemieux 2 Fotball 1 Lyciina 1 Olympiados 5 Onomasticon 1 pimaricina 1 Mandasor 1 Pangani 1 lizhni 10 Microscopii 1 Hulihe 1 Metelas 6 Kibris 2 mexarela 2 fernandesii 3 Panal 1 muoter 2 glorios 4 Medley 3 Goriachi 3 manumisión 1 microasiática 5 Landkreis 1 feniciaFundación 299 Pesca 4 giraffa 1 iugonostálxicos 11 Kitasato 1 Ladders 1 hapterios 1 laboró 1 lemen 2 Frithia 1 Mallister 4 Mustonen 6 Jap 1 Pendekar 1 iranís 1 Jéquier 1 malacorhynchus 1 Hollesley 1 Pachtoesova 1 inmobilzan 5 Fertilización 1 Permetrina 3 Lém 1 koordersiana 1 Orbanajo 2 notturni 2 peúis 1 hebraico— 11 fidxianos 1040 noso 1 Nephrosperma 2 Kadapa 1 Gardat 1 Naung 103 ki 2 micromanipulación 1 Italia— 1 Magrè 1 Három 2 Loans 1 Lukavský 9 Kashgar 1 multirogas 1 fungicidas 1 HANHARDT 1 Fulminando 155 funerario 17 oleaxinosas 22 Moriarty 2 granulosum 2 pertencerán 1 gardaranse 1 GASTÓN 1 Mentering 10 Piamonte 12 infografía 12 Fide 2 Majanos 1 jarro 1 Katsonis 1 Pagadían 1 Løvborg 1 Neotanaidomorpha 5 pacis 1 Magnas 5 Mostly 5 Nativity 1 Glenmoore 2 oxonio 1 Magrathea 349 modificado 1 oraneses 1 Orthographic 7 Ogoni 2 oblongifolius 2 giñan 1 látigos 42 Gododdin 1 Natashya 2 Physignathus 18 parlante 1 Gualaco 43 hidrolizan 1 Imerkheviano 1 genestierianum 5 fotosensibilidade 1 pirindola 7 Kirjastaja 28 Musulmáns 22 Marruecos 1 Maduudu 1 Imperforado 2 obviadas 4 Gabú 1 forzábano 1 Moutard 4 Gašparovic 1 fissa 1 Herbais 1 Ommegang 1 jugarlo 30 LUX 1 Macinnes 3 Pinkly 6 Incapacidade 1 NBCI 1 Hipocausto 1 Grosswallstadt 2 lobet 1 Gluyas 1 harmonizándoa 1 gonionotus 5 mista 3 h2e 1 Minimes 1 paen 1 Kamengeki 1 Macropsia 1 Krompir 1 Pfaffendorf 2 Machilipatnam 3 Labrado 1 Mazzuoli 2 Ippatsu 1 obordados 1 Halacha 1 Feofanova 6 Maraššanda 1 Juat 1 housing 9 Faramundo 1 Paliton 2 golpexalos 3 fibrocartilaxe 6 Haruno 1167 Independencia 1 Gotou 7 Guiado 26 nei 7 lisérxico 1 Pertencería 1 kynurenina 1 Kelemata 1 Hamattan 1 ofuscou 2 Jacuba 1 inxecciónn 1 leptolepis 5 Hirah 3 Grímseyjarhreppur 1 jenseniana 3 Fazekas 3 fluvoxamina 54 matiz 3 moendo 2 paradís 3 Pfc 2 Kunrei 1 Inne 2 flush 1 Maneskold 1 lavareto 1 Haðarstígur 2 Futbolo 8 FimH 1 nimbólido 2 Longjumeau 31 Georgii 1 Patra 1 Landsgemeinden 5 Frongoch 11 marquesano 8 Keylor 1 francoisi 5 Joán 1 montésa 1 habenatus 3 ostricultura 1 Jalvo 1 necrófaga 3 Monkwearmouth 1 Kartal 2 Inmoral 1 Girdwood 4 Mokhotlong 2 nev 47 Most 28 Hime 1 maltraten 3 Indolent 1 Pétursdóttir 1 Papé 34 Guillade 1 Otsuge 1 Kéruzoré 1 letanía 6 Juazeiro 1 inquebrantabilidade 2 Pedrapicada 1 Langenthal 13 GBP 1 Péricles 2 pitados 1 Lochindaal 4 Leipson 1 hidrocarbil 1 ingredients 1 oletín 2 micoses 2 Ouh 5 Ibert 1 Ozonoff 1 os celtas e xermánicos 1 messed 3 imprecacións 1 gikk 16 Melina 1 garatuxeiros 1 Pizzuti 2 Pataro 1 Phílippos 8 pactando 161 MS 51 Ganso 3 incumpren 1 peridinioide 1 Knoller 1 Gergely 1 Landéan 4 Mariscada 2 Huillier 1 koslo 1 Págasas 2 Inxenuo 1 Loarn 1 Marismeños 1 lahors 2 kinescope 15 Gausman 1 Kusina 1 Mesara 3 gaimarelo 3 notificando 2 Maitri 1 Mironov 1 neutrofilia 2 Fuentelahiguera 1 Fiasella 1 Middleman 12 Hipòlit 6 Nymburk 2 Historisk 5 Muliaina 1 Pecuj 1 Penillion 1 khamari 1 Másame 1 Giornovichi 1 Kaufa 1 Jojlov 1 Kold 1 pahangensis 1 orthoneurus 1 glaumr 1 McBoing 3 liikuntahalli 4 Ferganá 16 mesanxial 4 manteo 2 Jiaozhou 2 Iulus 2 lehendakaris 1 Jakcowicz 13 include 1 fosfoproteómica 3 perdoalo 1 microfolora 1 Petric 1 montoneira 6 Hillenbrand 3 Jetro 2 Paamese 113 Hassan 1 gobernábanse 2 frotamiento 87 matriculouse 11 Monje 5 metaloproteínas 1 impegno 1 fotobiográfica 1 irroratum 939 mariña 1 Mahama 1 multiforma 1 JSAI 4 Flucht 1 macrosocioloxía 1 imitarán 1 Hypsogastropoda 4 Giniel 6 gasometría 3 paleognatos 1 hromadná 196 inestable 1 fosfonitos 20 Grimal 1 picoamperio 1 Gundurendo 1 Numar 3 Hörmann 1 Matasao 2 Keflavik 2 friedrichiae 1 menudeo 1 finanziario 1 pharmacy 1 lebbeck 1 Latroniano 12 Hoste 2 fotocoagulación 1 Pavorde 1 francocontés 3 haereses 1 Hermanstadt 2 Opisthoteuthidae 1 Nowiny 4 Omnium 2 outorguen 14 mecanicismo 1 kylym 1 Okrzejska 1 Licoria 2 Gomon 14 grávidas 1 Pahlen 1 Hogdson 1 hazslinszkyanus 2 Opolskie 29 oda 1 Kedron 1 Kops 9 internationale 1 fiélas 1 Pieterskerk 4 Pinacedo 31 maja 1 Galang 1 nitrofuranos 2 Heilmann 2 Huacaybamba 1 merláns 3 Motus 1 moriquendi 12 pertenceren 1 palauano 1 invadiou 489 lírica 3 Kauri 6 imaxinais 9 inclinándose 3 Freginals 1 nius 2 Idaux 1 ímolo 3 Keukenhof 1 Jimna 7 Levrault 1 Gloeosporium 1 MICHAUD 1 Fortunae 4 Oex 1 mærkeligt 1 Germinarán 1 parcialmete 3 obedecermos 7 plasmodiais 1 Ocee 7 Heráclidas 1 Oscillatorium 1 microbioteríidos 45 Manaus 1 Mokrsko 1 lundaensis 1 geswincdagum 1 Gadilidae 18 lexitimado 1 fonar 1 picentes 1 Kels 2 metilenos 1 Peteris 1 Mayoria 21 Fantasmas 1 pelycosauria 16 girl 1 Gèu 1 fértis 1 Gnathostomi 1 HPRT 10 fantoche 45 Olivenza 1 Lastockino 4 Holmqvist 14 Misfits 2 padecidos 1 Iàkovos 936 Jordan 1 ifach 1 Levadizo 16 pido 5 Malacoherpesviridae 4 francombat 1 Papilo 2 Hasten 1 Laschi 2 G 1 Nahnu 1 italobritánico 1 nass 1 Nudelman 8 Fazenda 2 Kermode 3 Löbau 1 Marcali 1 Pievepelago 1 Giliarovsky 16 Hauteville 5 Farfus 1 Inventes 2 Panace 1 gabillo 1 Hallan 2 hispanomarroquí 1 lutaril 1 Firebolt 1 Nortes 1 Kamogata 1 Hypochaeris 1 Gibsonii 7 Murueta 1 glicolipídicas 17 peteiros 8 nuha 3 numerals 1 nulípara 6 Organic 1 mucocistos 2 frontotemporal 1 orientouno 7 inadvertidas 8 Na?ional 15 parasol 1 Interrumpuiu 1 Melissokomas 1 homóoga 1 informatik 3 Floriana 1 Kopienkritische 4 monoacilglicérido 5 leixaprén 16 McDermott 2 Huszár 4 Farra 23 har 1 Kifri 3 Mosqueteiros 1 Hidroxicumarina 1 pezóns 1 narte 1 Jadzhemusovich 7 Fuge 1 illotas 10 lagranxiano 1 Luxinius 6 obrou 1 Natboccara 2 Ilke 4 Orera 1 Pirovano 3 otomans 2 Golfus 99 Hull 12 Limay 1 percursa 7 Fuentealba 19 Gimme 5 harrisii 31 Gábor 73 innovadoras 4 Husayni 3 kunsthistorie 1 Girltown 1 mmuten 1 Henkivartioväen 1 farolillo 1 palaungue 1 Musicália 2 Krajicek 3 Írguite 1 Gours 2 onestà 3 norfloxacina 4 Matlin 15 Leça 66 MYS 1 giocattolo 1 guatambu 9 iluminando 56 Judas 507 logra 1 materializador 2 Kaizokutachi 20 Italie 10 Lissitzky 1 Olaru 1 Meccaniche 1 hylmoei 1 Impolutos 1 Humanitarinis 1 kybeanensis 31 Muret 5 Huia 11 nectarina 16 outre 10 Glóin 2 Montgriffon 6 Goossens 1 onipa 2 Malzi 1 Nazarenismo 10 Lampredi 25 Minghella 271 pendentes 1 opa 21 Hickey 1 Pavignano 1 Laurentiana 1 Lomar 73 Het 4 Loscos 1 Olizon 1 pétrole 1 Nikothimos 3 Panteiras 1 Intervinculando 1 maymanica 5 inabordable 1 Kommunallandtag 2 Monelina 2 Ferritina 1 paroximada 35 montador 1 ilustrounas 2 Lizartza 7 Forestiera 54 Furio 1 ITGAD 33 Merton 1 moncego 1 Modesa 14 imputación 1 Gwrwst 4 Kimbell 4 Kettering 507 orixinar 1 Palouki 1 miñarzo 1 Funcionaron 1 finnisches 190 glicina 4 Jubilée 8 jarl 1 Mardalsfossen 1 imprégnase 1 ostentándoo 10 Nisán 68 lamprea 18 isotipos 3 maite 1 Kokoschka— 3 Hiodon 98 kHz 1 IACET 5 Perosa 1 Pitiüses 1 FozDoIguaçu 1 Kolokolnikov 1 naisest 1 Jutsum 1 hymne 84 Hokage 1 periovulatorio 1 nitrobencenos 1 ficobiliverdina 2 Kasumi 12 ocultouse 4 Laverca 12 Piedrahíta 2 pinisca 1 marquetarías 99 Mae 1 Lockbourne 1 levava 4 Lauves 1 pecadillos 1 Gilberg 1 Mato 1 hoofden 1 Mirocles 1 Mercelo 1 Peartnach 2 Kalckar 3 HG 3 Kutchuk 1 Metepec 10 Oceania 1 Mazari 1 pergúntalle 1 pe??irem 1 guindarse 1 misericordiosa 2 Manger 15 Nördlingen 1 Jánsel 1 Hixiea 7 langerina 1 Kirkaldy 4 papiloso 3 Obshch 6 Junqueiro 2 herpervirus 5 intracitoplasmática 1 Loner 6 inmortalidad 6 Naranjito 1 garaxista 9 OLED 3 Likiniano 1 Hymenae 1 Ngeremasch 1 Mantelet 1 GFC 4 Náucratis 1 honnête 1 metacestodos 2 giullare 1 Kashinia 1 Kehai 3 Floridas 27 Mohács 180 persoeiros 1 Neithart 1 mancheta 2 Meño 3 Ibieca 1 Gunér 40 misteriosamente 4 Langtang 14 Piera 4 mestiere 1 Mühlenstrasse 2 Groussac 3 Hadamard 3 Gothland 1 literària 1 Geamil 1 Numazawa 2 Ganymed 1 Gelditzen 3 Killen 1 favelización 1 Niquitin 2 Hialino 3 Khomas 1 Gadilinidae 1 latou 1 Kraton 54 isoencimas 2 leuco 1 hellen 2 Haquin 1 Fereidano 30 glaucófitas 38 Makarenko 1 muia 1 Mbanika 2 gredense 1 Hiedra 1 KTLK 82 Municipais 2 Fuminori 1 Kikiwit 1 Oximetolona 1 núvlanam 1 hidroillamento 1 Jagnieszczyce 1 GIK 2 GST 13 Genkidama 59 Guitar 1 imbrifer 9 Nip 1 Housu 1 Onso 1 paradeño 1 metatartárico 2 Osred 1 Leunclavius 1 Meibugyo 1 Jacareí 1 Folkungaätten 2 Fregatidae 1 originado 1 Pkaneta 3 Luzhin 1 pestiférés 1 manufacturador 1 Galaxiidae 16 Ostrava 10 Iñurrieta 1 Matarreis 1 Pereto 3 Improvisation 4 miserábeis 22 Força 26 Overijssel 1 Oratorios 1 Lotney 1 Gyrwas 1 Gelinotte 4 Joselín 1 Kouroundi 15 implementados 2 Homine 1 ?alab 2 musican 1 Halfrunt 1 haskalas 2 Odet 18 inoxidábel 1 Knockma 1 jingu 1 Lilián 1 mysli 1 Piténcatro 1 Obolo 17 Lexicon 1 grûn 1 Messéne 2 hominum 1 pancreastatina 68 Freijomil 1 numeosos 2 malévolos 7 pascais 1 GasteizAltsasuDonostia 3 Obterá 5 Maynooth 5 pateou 1 Lusista 2 Piretrinas 1 Monthermer 1 kombinatorisches 1 Illsley 1 Kfloppy 1 nomeaches 1 karateca 2 incomprendidas 1 Jammertal 4 Meiners 1 intereacións 1 no século 65 Phantom 1 Luxardo 5 mediatizada 3 monopartitos 3 opcina 3 Oddgeir 1 Lomelín 2 Medinasidonia 1 Gamahiriyyah 1 Öröspubülükete 1 Jongfra 1 Ihsan 1 iconogr 1 isquiopubiano 1 imbatibles 1 Nèi 1 FcR 1 Ibang 1 kuálásteijeeh 1 glicosidicamente 2 Marcenlos 4 fédéral 93 Marquesas 1 Hunangofiant 5 organizasen 1 luceo 1 Peniqueira 178 Hipólito 1 Lignanas 1 Nahbebens 1 hatt 9 inculcar 1 napakiikussa 1 gyrata 1 Oxytropis 1 latach 70 Get 1 Kövér 2 Modal 1 Korsakoffschen 1 patués 1 fundamentalemnte 1 Kojéve 180 numérica 2 Orsino 2 Maeatae 1 GIPLs 1 Heeringen 1 minerva 1 Keran 2 Monterredondo 3 Kathi 3 Jonzac 1 Jonassen 4 Goduoc 1 manod 6 montuoso 9 Mangano 1 Morgenbladet 51 Guantánamo 1 fíxerase 1 Picnóstilo 1 jubilo 3 Heaton 4 Nitroxenase 1 miserie 1 Insistían 4 Labraña 1 ligófilos 1 Osanai 1 parantesco 3 Kaasan 15 Masi 3 Frontín 4 Infraorder 3 Gassan 5 Flodden 1 ocratoxina 13 Occident 26 Mandel 1 Inquieta 14 Maddie 4 msu 1 ortorrómbica 1 Piasaba 2 muncipio 1 Fresnedas 1 Iasis 1 Kapir 1 nominalizantes 2 orquestado 2 ordeara 2 Keauhou 2 páiste 1 Mahaparinirva?a 1 libertação 3 Hoyerswerda 1 lestro 3 Hespérica 1 Nitroglicerina 1 medyo 1 perorandi 1 perviviran 1 guildive 2 munzii 1 Hüda 4 Garcimuñoz 1 Lacko 7 Luftansa 1 Ordn 128 mataron 2 Freundt 1 Nazionali 6 Javelin 2 palantíri 3 inscribira 3 Matabeleland 1 Kcalc 1 Gullich 2 metaliteratura 1 Pilczy 4 nardus 1 Parshva 1 matematikus 6 permisivos 2 Halictidae 1 LaWanda 1 flexibilizar 3 Manox 1 piedades 1 Hemicolina 1 Oomuta 1 Kringvarp 1 Mehmandarova 2 negrexadas 21 fliscorno 132 pedidos 1 '?ost??p?r???sn 1 insolubilizar 1 Karengo 2 maldivensis 25 occidentale 1 masais 1 Ourentã 1 meditacional 1 katan 1 limonea 13 mostrador 1 manchen 3 galanteo 3 Franzese 2 Mesonada 1 Krönungsmesse 2 Idarrubicina 1 Freedomless 1 indexg 1 gärna 1 Koštroman 2 Jangada 4 Hortobagy 1 MartiniMuse 36 píntega 13 Littorina 1 Kixinje 25 Pet 1 Maruan 6 Mazurka 1 kambari 18 Fenteira 1 mobilier 1 Handl 1 gdépa 1 Maquinarte 7 Giacomini 6 periodonto 1 mazudo 1 fornalla 1 Messan 7 fracturadas 6 Marcato 4 Kapono 6 focénidos 1 Mhilis 6 Orgeira 1 Niushou 1 patrocinantes 3 Ignas 1 luchisty 1 numerat 1 Mälarhöjdens 2 fotolitótrofas 1 Nad 1 Medjebar 1 Marindegi 3 incida 1 geminifolium 1 hostiliza 1 Letestu 1 heptavalente 1 hakki 1 Hezbolá 2 Hirschovits 1 Kurzgefasstes 2 nivelouse 10 horreum 1 Goresh 1 kreisel 3 Peches 3 Kisumu 49 morra 1 gigurrorum 1 Mashel 1 Iasuda 1 Fournet 1 Iztacalco 88 Hi 4 garfa 1 Labrapoodles 11 Lumbrigante 14 flanqueados 12 Kebir 8 obxectores 1 giria 2 monoinsaturada 1 hoodoo 1 Fisiolóxicamente 1 Kritische 1 homotrímeros 3 liberi 2 Pannella 1 Menticirrhus 1 Paxt 1 muscarínica 1 Gamarten 2 hestoria 11 inferiormente 1 HOSPITAL 1 Hispanocubana 11 Kindelán 1 funileiros 3 hispaniae 1 Luchsinher 6 Melin 1 Pålsson 1 Pistachia 1 Helenicos 4 Kostrzyn 1 Ial 1 mogut 13 Joglars 286 Laza 1 Mégaron 9 guardameta 1 Kakkaroto 1 minaret 15 Perca 2 Majagua 1 Filhas 2 pademelons 1 Lächel 1 Fasinex 3 Inula 35 Grenchen 1 galactites 1 geassebeaivvᚠ5 mostrarnos 6 oogonios 1 fáustica 1 Mousavi 1 Gjergja 1 kkha 2 Korroskada 5 Jory 5 macronuclear 1 mére 7 Musicae 2 HititasHurritasAlepo 1 PJA 12 Kiviuq 1 ordinatio 1 Massini 3 Leks 1 Monolingual 2 Macrotocinclus 2 Ganínedes 1 Perímede 1 Leppävaara 24 mariscais 1 Gefitinib 4 Lofn 1 Maureillas 1 Geaney 2 hematites 1 Laien 1 limin 42 Huub 1 Fulfulde 264 Gold 10 Hoje 1 Øyan 1 Malavika 1 humistratus 16 Neuville 1 Lhuntse 1 filarszkyana 1 fortalecerán 1 Goffic 1 manipúlanas 1 Letristas 2 phagedenis 1 Könnyved 1 fosfinitos 1 Muzaffárida 4 picoutos 1 Halabxa 5 Philly 1 Heterotiquio 5 Persoalmente 29 histeria 1 n? 1 galumphing 1 Monurol 3 gastroesplénico 2 MMG 1 nephalia 3 named 1 Ienari 22 orixinaban 2 Ferdjioua 1 Galpões 4 Isna 5 Nazim 5 Obeid 1 ingerlaniarusuleqaagut 20 Kampuchea 1 Kelbassa 7 infractor 2 incrementasen 1 Gelatxo 1 Herchel 1 NAOandCL 2 lingoa 1 Masterji 2 foglie 1 invertelos 1 newii 1 Gyachung 3 Pfizer 1 Finaron 10 Pennino 1 ItalyLazio 2 Forejt 1 Pèrche 4 PBG 1 Lotrscak 3 kurteni 1 NHE 1 Himamaa 1 köpeg 8 Feirón 2 Flindersiaceae 18 Philipe 1 malograron 1 Gualo 2 Lud 1 Khubeev 7 gablete 1 Mietskasernen 1 ka?n 1 Kelb 1 Guitarrón 2 Hummingbird 2 Livingstonia 2 Hasson 6 Juani 8223 Lugo 1 Oxyletum 1 Ovali 11 pastizais 3 Ideologia 3 Parapoxvirus 55 nicaraguano 1 Klaw 2 Legon 1 nañgunhas 1 histolíticos 2 geloso 1 glucana 1 parisu 1 Nòmada 1 manusa 1 NCAD 8 Ocotea 1 orthocarpa 2 Phonola 1 Kastilla 73 Peirao 1 osismos 4 Gac 1 Lafferre 1 oportet 1 Kaiserstuhl 2 Gardía 7 Nankín 1 Lavignonus 97 Mercat 2 ?ena 16 Pedagogía 9 Guifões 1 Höchel 1 Lucijan 6 ofendeu 4 Namuka 1 penamdyr 3 NORs 20 Genetta 103 leyenda 1 Ludgin 4 iVi 20 instar 1 Magallães 5 Leanne 1 Jyoti 2 malpartos 97 péndulo 1 næ?t 1 gyeongbi 17 indagación 1 obidueiro 13 Farmacoloxía 4 Neiburger 21 Hael 1 Odontopera 1 normativizáronse 1 longispinis 1 Mystkowski 4 Physikalische 54 ilimitado 2 Matarí 1 Nahrin 1 jot?s? 4 Heka 1 máynti 2 Luftverkehr 1 Meisterhäue 1 ignari 1 neotropicales 1 Golinger 1 Jezika 1 gaedil 1 Markiegi 1 parnassi 1 morcegosdegalicia 2 filmográfica 1 impugnando 2 Foghorn 1 geiger 1 inatividade 1 Favored 1 parecieron 1 Halfbreed 87 hematoencefálica 1 helgolandica 1 Ghulám 1 Gomorov 4 Onga 1 Loveparade 3 Kawamura 1 farine 1 Oxaliplatino 2 habiamos 3 perritos 6 limitadamente 1 Icebox 1 LIBRI 1 neoplásicos 10 Nok 1 hidroxibencilideno 6 Hultén 3 okla 1 Honti 1 Mentesa 5 mercamos 1 Jungfrusund 1 granizos 1 Osciloscopio 1 Munksgaard 2 Karpovsky 1 Hethitica 1 Maredsous 1 Pitmedden 1 Morrisette 93 Hole 1 gillii 2 Ironclad 2 Mendro 5 Laghi 1 mintus 1 Intuicionismo 14 Híspalis 1 komikiak 1 medu 1 lendiazo 1 Okkar 1 Mudas 653 Nela 1 leverworst 16 Insuas 1 Guilermina 1 Mantere 1 Fiqir 1 habilitándose 1 Gruyer 1 Iospilidae 29 Leyton 1 medsmo 1 Miasmi 14 obrigará 1 Noos 1 pentanediona 1 muchy 1 inmunoreactivo 1 guindara 1 MMEJ 1 Peroxysomes 1 GSMD 2 Gambusia 10 Fersen 1 Ferulago 15 Mariel 1 Parisca 6 laminosus 2 nightclub 7 galani 433 fotógrafo 1 Leodegrance† 3 Kikunae 2 Oehring 6 insaciábel 14 personificacións 12 NTFS 2 Meindl 1 necessity 7 Palanca 1 geunnan 8 Kestutis 2 MMNY 16 Hilliard 3 Mijailovich 1 Mbalmayo 1 Microsoap 1 Kelpies 1 permutatus 1 Gigantohyrax 1 pescaíto 1 Foodfight 1 invadirá 2 Lipschutz 4553 italiano 1 Guionizado 1 Lurocalis 1 mengtszense 3 Hidr 1 maitotoxina 1 Ivao 2 heterofaxia 1 paeriférica 1 Hollinwood 2 Hiposfera 5 Helmeppo 3 parties 1 Fedusa 1 Guthries 1 gulopiranosa 2 Margem 1 OLÉ 1 Mélisandes 7 incapacitante 1 oorlog 16 navegábeis 2 Largentière 3 immunes 80 patriarcas 1 na?si 1 Platysomatichthys 1 Opsvulmede 1 periodisme 1 Lesgles 1 lamblíase 2 Lozna 4 irreparábeis 4 mioepiteliais 1 orotstsents 28 Orbital 1 periacueductais 1 Gufa 1 menyhartii 1 levedase 2 Lustenau 2 Fioramonte 5 Foxados 92 Palaemon 1 hlangapies 1 Maxipime 1 flazzames 1 megaciudades 2806 fondo 1 Kéltike 36 Indicacións 1 Ferreyro 1 GridION 4 MacGuffin 1 HEYWOOD 1 GRACIA 1 heredanzas 1 Plasticitat 1 Mekongina 1 MagostoGraba 1 Pacífcio 1 myconi 2 Nefta 41 KB 1 henrardi 1 habilitades 2 Intrépido 1 koun 4 interdependente 1 Karymsky 45 manteren 1 ofrecéuse 2 Kaliz 2 Organizativamente 1 Picollec 8 Gum 2 Mosterín 26 optimamente 5 htpasswd 2 Osteomielite 1 Ordieres 1 moigracións 1 irrompa 5 Milfontes 1 Hispanoasia 2 Ngounie 3 Invitaron 2 Marzales 2 Mawle 1 Hayle 1 kl?yakos 1 Orestiás 16 Hind 7 impedancias 5 Ostreoida 2 Lichtervelde 1 ostracologicæ 1 messaggeri 2 partirades 1 Ouahid 73 Johán 5 Mirlande 1 Feitiço 2 nkp 1 Pasthus 2 lintuseni 1 gosse 1 Liddicoatita 1 fructofuranose 1 hosanna 22 Kermadec 1 Innokienti 2 háselles 30 Guxarat 1 Obaka 1 Jugendstill 1 Hupf 11 Papaveraceae 3 Irepodun 19 Maquinaria 40 Malory 2 PEW 2 Ormazabal 1 Galliarun 1 Mezoberény 3 physicae 2 maleantes 8 Kieft 1 gastásense 1 Loyen 1 Maikal 1 Kuzusareta 1 papulosa 1 Kpor 1 Otok 1 Nargiz 1 Glingal 52 Jiloca 1 irlandensa 1 neurocientíficos 2 MoBio 2 Naters 1 Grönwall 68 laminar 2 isabel 1 Iddris 2 Lúgubre 1 istalou 1 Modifícanse 1 Formars 1 hipotizaba 1 Nibaw 1 Jaurégui 23 obteren 1 LTNP 2 Orthostemon 11 Memoriam 1 huautlense 1 Piugos 1 nivicola 3 Naiara 1 Musharafah 2 margacela 1 lives 9 moinantes 1 hacklabs 10 gv 1 Lengún 1 Lanzelet 1 greba 3 faneras 1 frae 1 Huwayik 1 minipromotores 1 kálamos 4 jostii 1 leys 34 Lemna 3 Jette 1 nomotética 5 lambonadas 1 Kafiréos 1 Floigan 9 Ghizo 9 parindo 1 koj 2 Juuninme 10 nothosubsp 1 intramundana 1 Legnitz 1 Kalongo 12 filatélica 1 Kolbio 1 liaupse 5 improdutivo 5 Gey 1 Hwéeldi 1 KPFA 89 ionización 1 indiviual 1 héxo 13 Globus 2 Kyougoku 1 Pichey 1 Methyl 1 moissons 1 Hadrosauridos 93 helenística 1 Naturblick 1 Leuresthes 6 formento 1 Lakusta 4 paripinnadas 1 Jilynn 1 picábanse 14 Kadima 6 Morde 2 pescudaron 2 Literários 1 fosfatidilglicerois 4 igennem 3 marcho 2 interpretarmos 3 Muntasir 1 FRIEDMAN 16 mazos 70 Mediterráneos 20 Marburgvirus 1 Ihojin 1 Lamasendín 5 Hacén 2 Longobardo 1 Nöbetçi 722 Pireneos 1 Kobenz 2 Leichttraktor 1 ichuun 1 Orthocerida 1 palingénésie 14 Pasteurellaceae 1 Intempériome 1 pericolo 1 pesoal 3 Pedúnculos 1 Oícles 2 Manaure 70 nutritivas 34 Pelargonium 2 hónrano 1 orlodo 1 Geneanthropeia 1 orii 1 Liida 2 osteosínteses 3 Lachenmann 4 Hitori 1 Perryville 1 persone 1 nDeise 1 MetOH 8 Párt 3 Lantero 1 ig'na?jo? 20 Metasequoia 1 herr 43 moderador 1 gloquidiadas 15 maternais 306 Group 1 HomenaxePontesampaio 1 Iletisim 19 mordedura 1 Kalthoum 1 hernaniarra 2 Lagariños 1 infundíndolles 3 Lelia 1 IFES 1 Merguia 1 jacobensis 27 perros 3 Fergal 7 ferira 2 Leturiaren 1 Rn 283 Feijoo 335 mostraron 1 infiltrando 4 menosprezando 4 mistéricas 1 parascpeckles 1 nozomu 27763 ó 1 Miyagawanella 58 Mañana 7 Mahuida 1 Loitarei 2 Hauk 1 Figuerolenc 15 kp 1 Lules 6 Nampula 1 osamosvojitvena 32 fuxía 6 Loránd 1 Niantan 1 holándricos 20 Gad 9 Garachico 2 forcados 1 Frostbiten 12 Hangar 1 Hormizdeghan 3 lamosos 15 Individuos 1 larinx 1 migrase 1 Nanichiton 11 Fayyad 1 Kiriotissa 1 metastatizarse 1 Loke 3 parenquimática 1 Isbili 1 Lachute 2 Marreca 1 feriadellibrodesevilla 1 invremento 5 Laureus 1 gurutza 1 Frakull 4 locomotores 1 Nettezza 1 Hano 5 hye 73 Llull 63 Moresby 2 Mushrooms 2 Gica 1 liberias 1 lipolyticum 3 Iltirta 29 Istituto 1 Lumoli 1 pi?to 9 ostentaron 7 Malgaxe 2 Morax 1 ObterY 1 Motomete 1 Laufer 4 Orotz 2 misero 10 fótica 1 Lepidozia 1 Fevva 1 imprimimos 2 Goodine 10 gastrótricos 2 NNW 1 Phønix 10 Fracasa 2 Neonicholsonia 2 mutS 2 Jászfényszaru 1 gwiñver 1 Pilum 1 Peluqueros 10 Juve 1 Hontanares 5 Legou 1 Pendinas 3 interpolados 1 Luvdisc 1 OrcaBay 1 Giftgas 1 lyeštih 1 imporíase 3 Lacadena 4 Gaelscoileanna 14 intracranial 1 Germânico 4 isometría 1 o latín erudito 1 Peyrau 1 Lestaio 1 GEML 1 Hirman 1 Kurzmann 1 Kylli 1 Matouno 1 Palabros 1 Lichtst 1 GICC 1 Lekuidar 4 Funme 6 fango 1 Inyenzi 1 Ilichev 1 hiperesplenismo 6 Lidepla 1 Látrar 3 Ighil 1 Paavolainen 6 legumen 5 Muruzábal 22 Hervella 1 magnetodinámica 2 Heliocéntrico 1 Karoma 2 lâ 1 Lagouira 2 negru 1 —Operación 1 kikapúes 1 Marótica 1 Maiyama 1 patalón 1 oluble 1 Gudeguia 13 Miescher 10 fracturado 9 lemavos 1 Ocorrer 2 kapten 1 Fanel 1 Metionil 1 kokkina 2 limando 1 Piztiaren 2 Huertos 1 Guadamatilla 1 Metrocable 433 mudouse 1 mariyskiy 1 Fascíname 1 Onzains 1 pachyacra 1 Namurois 1 Gminy 6 guantes 1 Machamp 1 owale 1 monocompartimental 50 GMPc 1 Occitanie 1 omediterráneo 3 Genesaret 2 Gambir 1 Piga 1 Kawisenhawe 2 febbraio 1 Nestl 10 kofun 1 Maxmo 14 Lexislativas 1 Palancas 1 Nirgal 1 Heterocaracterización 1 Klidoura 4 imaret 71 gozaban 8 Günz 1 oxíseno 2 Gadow 5 Meurtre 5 miembros 1 PedrasBatalla 1 Orbiculares 9 Lewy 17 malacostráceo 1 Giorgetta 1 Infusas 1 identités 1 Galarde 1 imbayas 1 Grotca 2 Kist 2 folguista 2 perle 1 Mesóclise 1 Omoi 1 jelegi 1 fladmen 4 ouviran 30 Pitchfork 10 Henshin 23 herético 1 Oileánach 1 Isoyama 1 Leucoaglutinina 2 pingue 1 muracego 1 fulvícomos 5 Linoy 1 Lloque 2 Frontela 2 Izarne 1 Panthong 1 peoniles 1 Lendelede 1 manifestáronase 3 francocanadenses 14 Nabeira 14 melanesia 2 filiados 4 fiscalizador 1 nebras 1 Jackobson 1 mustio 1 Lanzagranadas 1 fosfglicerato 13 Farid 8 monedas 1 Pelka 2 marchábase 1 gegenwärtige 2 Hallen 1 Partideiros 1 Marschang 4 Minimum 5 Figli 4 marxinalización 2 necesitemos 1 MiApuesta 1 Nerineoidea 3 mangón 1977 lago 1 oú 1 NTX 1 pKw 1 Mobili 6 Havelange 20 Penrose 1 Gellu 3 gardarríos 1 Indiscutible 15 Mindstorms 11 monzónico 9 obsesivos 1 intraxenómico 4 falles 1 HOSTIA 85 Guayaquil 2 Katash 7 fracturouse 1969 pilotos 5 Maedhros 1 GayVN 12 Leap 1 Oldán 1 Faurer 7 hidrólises 8 herdarán 1 Ixcaquixtla 1 Maurenzio 2 Ixabepilone 1 grandit 295 lentes 1 Oeteldonk 2 MLT 1 Klassenbewusstsein 12 pedículo 1 Felustaðurinn 88 Marley 1 Osteoporoses 1 phaseolina 2 moscoviensis 1 gleyzado 1 fartalo 1 karnáim 1 KickOff 2 Közi 1 McKellog 2 Mörike 3 óctupla 1 Obsoleta 1 nacersano 7 Ichthyaetus 1 Namuno 6 haplodiploide 1 mutáxenenos 1 Penafita 2 lobista 1 Parlo 1 otterbein 1 Hexford 1 innoxium 15 Montego 1 Mudamos 23 Node 1 micetanxios 1 notitiae 1 mitificadora 36 Pei 7 hiperbólicas 1 Jaekin 70 metazoos 3 llafar 1 perdoádeme 1 folosofías 6 inconveniencia 35 ovíparos 4 Pegu 1 Gorgasali 1 Kyojo 2 Flagge 5 PBY 1 pertenencias 1 Neretse 14 Kullervo 9 integren 3 identificarían 3 Karole 1 Mammola 1 Oreodeira 4 Leppä 1 lincenciatura 1 fermionico 1 NCL 1 frencuencia 1 iltaa 2 hemorroidal 3 Maricruz 3 MENSA 10 Nuclease 13 Jacint 1 frisou 1 morfosintaxis 1 PARKER 1 Jalance 12 Ier 1 Hafenstraße 2 montezumae 1 Lilliput 116 ilustre 6 IPM 3 graduase 1 loz 1 Mulqueen 1 Mardos 1 Nosostros 2 Muraköz 1 indenil 1 Helal 3 Mitchel 1 Muhoho 1 Massironi 1 Meirieu 2 Munksjön 1 Leiopotherapon 61 fibroso 2 guardiado 2 Kutum 5 Paleoxeno 1 localizaría 1 peyrierasii 2 Galtier 1 Khamanelsk 1 invocábanas 3 Pezet 9 Models 2 Ozamiz 1 ipecacuánico 4 hemofílico 37 honorarios 24 Karsávina 1 Korrui 1 Insist 1 Faracy 26 Haden 185 penetrar 45 hospitalario 18 Hamed 1 PFP 2 laeviforia 13 Localidades 1 Gaidi 1 iguánidos 4 LOG 22 modificadores 1 mutha 1 Pidikab 1 Lundur 1 Lewotin 1 Ghioroiu 2 Matthijs 9 Mandíbula 1 Mazalin 2 lendh 52 Peñón 10 Figuera 1 Mirtilos 1831 Olímpicos 1 Himiltruda 10 Nance 1 fiscalizaba 1 Peixateria 2 pastelerías 31 Maquiavelo 24 Jato 1 Picquingny 37 Pegasus 3 molduradas 3 maxos 2 novelescas 2 feuilleton 1 megistus 7 navn 1 haplóos 4 mellistas 1 Mu 4 Lapislázuli 1 mentat 1 immunogenum 1 MECCA 10 lactoglobulina 15 Frechas 1 lémbralle 12 Moyse 1 ouvella 15 Newtown 1 piccolino 1 Fatline 1 mercerias 1 meibum 2 Kambach 1 Monogrphs 1309 Guinea 43 napolitana 80 Meryl 1 Grinling 11 lidios 4 ingrato 1 Halaula 1 Maletas 6 Oveco 1 guaraína 1 Impósibol 3 mielomas 1 Lisronagh 3 Gwenhwyvach 10 HEAD 1 mitíns 2 lineolatus 3 Marschall 1 khrtinkh 1 Humfrid 62 novel 2 Middlessex 1 Hongisto— 2 Michel 11 petar 27 Pichi 3 Heiwa 1 Impopulares 2 Manni 4 Nenúfares 4 fozando 1 Lamelipodio 1 Jubinville 1 Ilmington 1 opuxérono 3 Monkstown 20 mierda 1 Glenio 2 gi 7 Nurkic 1 Nar 1 Malake 1 ostoclasto 1 FEDC 1 impronunciable 1 persecutorum 5 Morold 1 Leash 3 molecules 1 husserliana 212 Garfield 6 Ortí 1 Golmés 1 lyga 1 organicidade 11 Nishikawa 1 Micromonosporineae 2 Nouïssy 1 Palhetas 2 Lünen 5 Kabylie 3 Mosely 1 modelalo 3 Glo 11 límicos 1 hachinoko 1 Meruso 1 Louzeiro 2 McLain 8 hindúes 1 Gaidaros 1 Nerviosos 6 Feacios 1 Orfista 1 Oprelvekin 1 Kaushal 1 Malize 3 glicono 1 Gibsonton 3 okkur 35 incrustadas 4 Locomoción 1 NATUR 3 Partija 2 Lishui 36 insecticida 5 Pachytriton 1 Kembasuden 1 liure 5 Lifford 27 Falmouth 2 mimic 1 hunteriana 3 McDonalds 10 FORAN 1 Frize 1 Lestrígones 9 Julbe 1 Patriotisme 1 mediterrània 1 Llaneros 2 mesotelios 2030 localiza 8 Ladysmith 11 liberaría 1 Haired 11 nostalgia 2 Mogos 1 g?snet 29 Palomo 1 nais— 1 hoolligans 1 Klassifikatorensystem 23 ondear 1 Okvik 2 gafañotos 1 ostentándoa 5 gorecer 1 kétos 1 Frauenklinik 6 Handbol 36 Orontes 1 Leporid 1 Legendarium 97 nadador 9 Knowle 1 Oppio 1 Irat 5 lanatum 1 Oxocano 1 Marcianita 2 papón 1 Fröndenberg 1 Nefchateau 1 fritidura 1 lembraríao 5 Mettmann 2 invernadero 3 futuramente 111 Fidalgo 126 Inda 1 Outorgando 1 Glucagon 1 Márcha 1 Mesambria 1 phlei 1 habilísimo 4 IDOPNX 3 Graft 65 minimalista 42 Midland 8 lembrarse 2 Hinaningyou 2 Marabilloso 1 Fontanini 7 mei 1 fernen 1 harmonizala 1 Gunterodis 9 plantexado 1 Milkilu 1 Motocycliste 4 Gwrgi 1 Iberpapel 1 Patabendige 3 inmunofluorescente 2 lubrican 4 Okur 1 Organics 1 Nunhems 68 inflamacións 1 Glave 2 oxyacantha 1 Gundavaro 1 Orbelle 1 Gansido 1 Heathers 1 Japonicarum 1 noutroura 1 inelástico 1 inveja 1 kalka 1 Hoffens 374 interveñen 1 mandáballe 1 hattu 4 MpDC 1 Mykytsei 1 Nanwang 1 formella 1 outoneira 1 Fitomédica 1 Generationen 2 Kavaja 6 Marchan 1 mullerengo 1 Kuljian 1 Huerces 1 Nanhoï 1 Kaileena 1 nanais 1 Plattner 9 optativa 1 Intelixentemente 2 Gardamariñas 2 pirivato 3 Nidan 24 Ní 3 pelícano 2 narbasos 5 financiamiento 1 Ornithologist 1 Larrivee 1 Fornminnissavn 1 Neurobiolóxicas 1 percrassa 1 Phrynosomatidae 1 mallorcae 2 Palaciolis 87 nebulosas 3 meridianas 1 Fleshies 1 Mansvelt 1 fenzeliana 2 Heilbrunn 2 Galey 1 impactaría 1 nummularius 1 KRLA 1 Nodame 5 Mochi 2 Jornod 24 grou 1 Pitufiña 1 Fogodemo 3 param 1 Goffert 1 Letyat 2 Grimancelos 1 lguitarra 1 Lintz 1 Frembleya 4 Frollais 1 Páseslles 1 Grandras 1 Océan 1 forraxeando 15 negábanse 2 Kombi 88 Physalis 2 Oriolidae 1 Miteq 1 Glennie 160 Lavadores 3 notofagáceas 1 Pandetrave 220 It 24 Labarthe 1 grappe 1 Guimatey 4 Krok 2 Franchitti 1 IACNT 2 Interchange 1 länkar 21 Fecha 1 Piret 3 Harina 5 Foss 4 Lemuy 1 kommenden 2 Kujan 1 Hogaraka 3 Pellam 66 Kipling 3 molli 8 fúnxico 18 gregarias 2 perifrástica 193 Fillos 1 FANCA 1 Guas 1 Jadelle 1 Musqat 1 Metamatics 1 Katritzky 1 Piusada 1 hemionitis 2 narrativamente 3 leucocephalus 1 Gahard 6 Latido 2 Pistyan 5 Pendueles 1 ministeria 1 neurostriatum 1 merontes 1 Kivimäki 1 kawakudari 1 Mixedema 3 Heimaey 1 ledodelpozo 5 filitas 82 Hungaroring 11 incesantemente 29 Ica 365 Naval 149 latinas 1 Herbor 2 Marenostrum 126 inflexión 1 kondo 1 Graupner 7 Gravata 61 Hancock 2 obxectivando 2 muxián 4 lepturoides 1 Ifoghas 1 Iohán 1 kamchatka 1 Oxiatres 1 Pepinster 1 naturezadesde 36 Journey 120 pesticidas 2 ouvre 1 Kreposuk 1 Lubanas 1 Microdoncia 1 Monomákhoviches 1 Gauvain† 1 ferrocarli 1 in Linien 1 omri 1 magnitudine 2 insalvábel 1 Kiudang 1 Louvou 1 Nitinol 1 microscópiocs 3 MacCrohon 13 nerviación 2 mississaugas 9 Mirrorcle 1 Nickelsdorf 55 Maple 1 Palaetiro 1 métisse 1 Permutotetraviridae 1 Malkuth 5 Kluyveromyces 1 Oriunda 3 Gokyo 9 Makhachkala 1 ondansetron 13 heterónimos 1 Meneiroas 2 Fenway 1 Mariscadora 1 isomiarianas 1 lingqi 1 FrixiaLidiaCatividade 1 Langdorp 1 OlbersdSeeW 2 Foca 1 Glumova 3 Grianna 1 MJY 13 piroxeno 1 maltaise 136 planicies 1 Monmoscoy 1 honki 89 Melissa 1 Haryari 2 Mioma 1 MartianSea 65 GHz 1 Ingjaldsholl 75 narcotráfico 1 habíta 2 idaltu† 4 Muette 1 Holina 1 ìsoformas 3 Gratiae 7 gardneriana 9 louca 3 Marconato 1 lesionen 1 hòu 1 Ordralfabetix 1 Kalekas 2 heredanza 1 Mouguías 4 Makrembolitissa 1 Khojaev 1 opoñérselle 1 neoplátónica 1 Grünkohlfahrt 2 Olib 1 padecese 20 forrado 1 invitabao 1 Nxgowa 2 Maglic 1 Livathinos 2 obstruídos 6 Hooligans 1 khagán 4 oplot 17576 I 1 Laudomia 1 ombord 2 federarse 8 interglaciais 1 glucosiltrehalosa 2 fote 1 Loxley 2 multicinctus 4 Kasa 2 Ibaraqui 1 farouches 1 Mocaorà 1 Fargus 1 granosimanus 6 levarnos 1 Ganapán 2 Keihin 2 naciente 32 glifos 19 Masao 1 Grainha 1 Lanaro 1 Imdawlin 1 lorealis 1 oirase 2 Lábor 1 Manice 1 Newsome 1 fermentation 1 Nokelainen 216 madrileño 30 imperialistas 1 Frühlingsfest 1 Naturalia 2 Hebbel 5 indianas 4 Permanecer 47 if 1 Iblís 1 FFOA 1 forxárase 7 hokku 15 institucionalmente 2 HOLLENWEGGER 2 Monteu 9 lixas 3 indicatriz 2 Manaobago 3 ferrea 1 golfowy 1 jutjat 3 fantoches 1 olafita 2 Kassiots 1 Fazari 1 Negábase 3 plaing 1 Nadiá 13 Lahoz 1 Marupua 1 Metopimazina 7 iridescentes 1 Gasea 1 literàrias 1 Ileanda 75 influenciou 1 Köga 2 mantaliña 1 Malacothamnus 2 kuningas 2 Phasianinae 1 Kyuin 17 nodoso 12 Madinat 5 Hiromichi 1 Jinga 2 FPLE 89 finito 1 mdf 1 Grivnais 43 interceptar 6 igualitarios 1 Isnardi 38 parva 1 Hydantal 2 pequeos 1 Maxclatl 3 Kames 109 Mills 1 Inflar 1 Jugoslavenske 1 kalatensis 1 Miêr 35 Francorum 2 Fuko 2 iconódulo 56 moldura 60 molduras 1 lagáchema 1 kalbinde 13 multiétnico 2 oide 1 Lobótidos 1 Magari 1 Nanobots 1 Ghimbav 2 Leighlinbridge 2 Golpejas 2 Lisiansky 1 Fiutowski 10 Ladri 49 Garman 1 Niclocide 1 Negueiroá 1 pipotes 4 Minn 5 passage 2 Lonxitudinais 18 Kaka 1 patentación 222 pasaxes 3 Guadián 5 photographie 3 Ghislanzoni 1 paraesporais 49 Indian 1 Pija 2 Liat 1 MKWSN 30 paleolíticas 1 Grysaels 3 particulas 1 Oidios 1 Favarin 2 nähren 63 Pedrido 1 guf 3 metioninas 1 Furbol 5 Moreneta 1 hómericos 1 imunes 1 Nomados 1 highveld 1 Meaka 2 locuaz 1 NavHead 4 Finechrinn 11 Koichi 1 heminodos 3 Kareaga 19 lc 126 Hidrogalicia 1 Gasamáns 8 mielínicos 1 Noppharat 6 Permítense 3 Niilo 1 Personae 1 mèche 4 miliaria 3 Onkyo 1 lisérgica 4 inmolación 2 IzCa 2 luma 1 optoacoplador 1 Obrigábaselle 2 gozamos 1 Inishmacowney 1 kralestwo 4 Inquart 4 Jer 2 Gª 2 Oibor 1 Lovenstad 2 imaa 1 Modaine 2 Garrie 1 IZCA 1 Mixiuhca 1 Inimica 1 Mafuike 1 Norbertus 1 lavradeiras 2 neurocognitivos 1 militasen 1 Maker da 2 Masamasa 3 Lengefeld 3 Fliscorno 10 flaps 5 Iluminada 74 Minami 176 hipertensión 2 Hurma 2 gåtan 1 Molesey 1 fluorescen 3 Jutland 5 Ivanja 1 Pátroklos 1 placido 1 Kainita 1 Mavrocordato 1 Fassino 2 Nuprator 3 leonensis 1 henos 1 ousasen 2 glicuronidases 1 Oullim 47 IRC 1 Livadhó 281 Luca 1 Loveleen 56 orquestración 26 Farrow 1 Feyo 1 Katibi 23 liviá 8 Kensley 1 intramunicipal 7 Olhos 1 incluíunos 4 Planellas 1 mencionanse 9 Fas 694 Minnesota 2 paulistana 2 Masculinas 1 Hauti 1 kway 1 Fedelloso 9 Paseando 6 planches 2 lugii 1 Lolibulo 4 oxazolinas 2 Ifon 3 IJsselmeer 1 Helichrysion 1 Integracion 2 incinación 1 Gibelin 2 hrvatska 1 ? 1 Mirceta 1 Habitou 1 metabolizándose 18 Mima 1 humanizándose 1 ImproCompris 1 Kasianov 1 OeC 1 leoparden 2 grazioso 1 golpexador 1 Lippari 2 Jodoin 7 Phalle 1 Isyo 4 operis 45 FDJ 15 Hermana 2 fiii 1 Kosei 4 muroideos 1 Kosyk 1 Pitohuidae 2 phycidae 2 maceradas 1 numeosas 1 lâmina 2 H?L 5 farnesilación 1 karomp 11 Periplo 2 Nattergalen 9 lamentándose 2 GMZ 2 Mikeldi 1 megalomaníacas 1 Marguet 16 pisiforme 1 Gemena 1 Íth 2 Flasche 1 göktürk 39 Iturbide 1 identifíquense 1 flebotómidos 38 Marcio 1 lepelen 1 Perinal 1 MSAs 1 Mustafina 1 Konstantino 1 militarizables 1 Linji 381 fósil 14 Järvenpää 1 Incesu 4 Kouyunjik 1 Giulbert 1 mobilizadoras 7 pana 2 Muricidae 1 Nukunu 2 Pestivirus 3 PALISCA 2 Khenpo 1 I?Bß 1 Mogarraz 13 Minton 2 Ombro 1 gauchère 6 Koumpentoum 3 neutralizadas 3 ilicitude 2 Huáng 8 Indumentaria 6 glauconita 202 Hernán 1 Mitsukuni 5 Khand 1 Lutetita 1 Golariz 170 fixas 1 Kikhpinych 1 Lossit 11 impactando 1 Idiarte 1 Jonia 4 Obtendo 1 öngrar 12 Huila 1 interconectándoos 1 óeas 2 mobility 1 nomalía 11 mountain 101 institucionais 30 Marsilio 1 mallador 1 ímpares 1 Ossète 1 michaeliana 2 Olszewski 1 kakatonga 1 picha 1 lavi 1 Markgrafschaft 4 Perussuomalaiset 6 pileus 1 Palffy 1 jonques 124 islandesa 1 octoploide 1 MacThòmais 1 HEALTH 2 Penniä 42 Frutos 1 fgcu 68 pianos 1 increpouno 1 Navigatium 2 gardalama 2 ibérienne 3 Gomá 3 FES 1 Obersteiermark 31 Lines 3 Fortællinger 4 nemico 1 multicistrónico 3 neueren 2 fola 1 Obedeceu 1 Hyperboreale 3 Kovinotehna 2 mimético 388 nomear 1 Pentaplaris 48 nora 1 Fawdowy 1 freconte 1 Folkesprogs 1 huegelii 13 página 4 geesterani 3 fashioned 1 ousaron 4 Nohant 1 nerth 2 Howieson 1 packers 1 Nepalesa 1 Loganicáceas 4 FDLI 1 Himel 1 Mephistomon 1 homínimo 1 Konflickto 27 humillacións 6 Naturkunde 2 Ichou 1 Norskehavet 5 Lukasik 1 Mezotúr 1 generacions 5 pâté 6 Mathers 1 Manuke 1 Münsterlingen 1 Mentz 131 Plasencia 5 GLAAD 2 ombrose 1 himsá 1 Gaudich 372 Pedrafita 1 Garrus 9 Fossati 2 lunda 1 hexanoilhomoserina 11 Houari 1 Maszewski 2 Matagu 1 Freytag 1 modéranse 2 lopesca 4 froallo 1 Montangy 2 Ghitu 1 hidroxiheptanoíl 1 Jequitinhonha 1 Kuye 4 Lendario 38 peneira 1 Koonan 1 Maizieres 1 gafea 17 Helicón 20 neuramínico 1 Picureas 128 penalti 1 joliv 1 netiy 2 Indopazifik 1 orthographe 20 pendurada 1 gaudia 2 Gabarras 1 Gesellsch 6 Machismo 258 inventou 173 pantalóns 1 Messukylä 227 mama 1 outorgalles 2 Pilibos 1 hamiltonianos 1 Mainake 13 partidista 4 Ksi 3 Lèze 1 Kitao 1 normalizaban 58 Masma 2 Juniperion 1 Pib 9 Ogawa 2 Kalery 1 Pilblad 1 Likantropo 2 honum 2 ixcateco 1 mexiquense 1 Gunman 26 Plataformas 2 Melcon 1 Kherad 1 Gestilren 8 Lévanse 3 monocolor 1 Matumtum 1 oracle 11 fenólico 12 Physik 1 Malvalanda 1 Palmade 1 Iklan 1 minyaense 12 Megatrix 1 Kilker 2 Fawcet 2 Fisiolóxico 1 Glaucosciadium 1 Parastacoidea 4 Nosendo 1 iarta 1 Macrofilia 2 Leodegario 2 FIDELIDADE 2 máximum 6 Garzo 2 fiorentine 2 metiluracilo 4 Myctophidae 1 impresionáronse 1 IntraText 2 Mahtar 22 Invasor 1 Lobys 1 Indianeye 9 Formiguera 4 fenilcromen 1 Melesíxenes 10 fray 34 lembraba 1 Fluffé 1 Phau 7 Montague 3 Midžor 7 Gotenba 1 Lateralización 3 Metabolicamente 2 fluviatilium 1 Hakäpi 3 Margaritense 1 opsininas 1 Kuniva 1 Kttsd 1 Hickam 4 merecendo 1 Irazoki 1 Monita 1 lcio 3 hànyu 27 Fión 2 Gypsyhook 31 Mirás 1 Nordischen 1 Khaldjî 2 kaple 6 laparotomía 5 guxarati 1 IOCU 1 nuboeiros 1 palmiformes 2 Gunnbjorn 1 metalocarboxipeptidases 2 Lorenzon 1 ILPs 42 Grimau 4 noieses 1 îs 15 ordines 209 Padua 1 KCR 2 llegué 10 Peninos 21 Odom 3 odobénidos 797 Lakers 3 latgalianos 1 Klonowska 2 Mitochondrial 3 Miravent 2 Monplaisir 6 fumadoras 1 fumeira 1 hacrobios 1 Marineria 4 Lundmark 1 Minimalario 3 Fânzeres 1 Houm 3 Ichido 3 interfluvio 1 iambógrafos 30 levadiza 1 GrassOnStone 1 icodense 11 Flaçà 2 Horma 1 fonatoria 1 Iapis 2 Ouche 1 Franciaca 50 patín 1 Hennacy 1 Klafsky 1 Munen 1 Illapa 1 Gonnersdorf 1 Kumet 1 Odontostomum 1 Mulhacen 1 Österåker 1 hamman 1 kesrouanensis 1 hemocina 2 Miljevci 1 multifidus 15 Hermóðr 1 Järviseutu 1 Foramontanos 1 plausibilide 1 minores 3 nuristaní 4 limpadoras 1 pekto 1 patriliñal 1 Matthey 1 Koyékro 1 Niekerk 1 intercapilar 1 Lakabeg 2 Lalleu 1 Oikawa 26 FI 2 Grácia 3 Paralichthyidae 1 Fauveau 6 Gaete 1 gundams 2 Persebaya 6 Inhibina 1 Paraf 1 Humbling 2 neurovasculares 1 Farricoco 9 heterodoxas 55 investigado 1 Kärntens 2 Lafferty 1 Identificátonse 2 KTBH 1 iránse 1 nanonewtons 1 Mitchellt 1872 plano 6 Masque 1 Karatau 1 Helamán 3 Fenilcetonuria 7 Papineau 1 mutig 7 figuriña 1 Merelbeke 44 gigas 10 Hutten 1 Periam 8 Meirande 2 McGavin 4 glicídico 1 Lusigliè 13 impactantes 1 Naziritor 1 GROUPLOVE 1 Pireos 29 Katia 1 Menestrier 194 herexía 1 Lageranza 1 Folz 2 Krymsk 1 Gyllensten 1 impugna 1 Hadropareia 1 permitiunos 835 moral 1 Mannsåker 1 Physalospora 2 mahabo 2 f?? 3 oled 2 maudite 1 Imdad 93 patos 67 ferritina 1 Judite 1 Iosa 1 ferramente 8 Launceston 4 frailes 1 Geschichtsbilder 3 Morín 8 Galiñas 1 Pejanovic 2 megacontinente 5 Noakes 3 Kitasatospora 1 partitua 8 Kukas 7 Nabos 2 Flynton 2 MyWindow 1 Felin 1 Ludwigshöhe 1 Pangkalpinang 5 indemnizados 1 Livsfilosofi 2 Kunibertistraße 7 innova 5 morgadío 2 Heiduschka 1 Maduri 1 ocultaríaa 1 Ilumínanse 17 plántase 1 Pentoo 2 Fortino 1 —ovos 1 Nemataplexus 1 Hotteterre 1 independizarzn 1 Heines 1 passera 1 Glossolepis 3 hechizado 1 Néstôr 4 imám 1 Murchisonioidea 4 Kolak 1 Kemunpasu 281 Opera 1 itxar 3 pelosa 5 Leuconostocaceae 1 ouriñaba 8 Folículo 1 Marriages 3 Perdendo 2 Nariezhna 1 mob 4 hivern 3 Miiako 1 nordmannii 5 galle 3 Felizes 1 Maduabum 1 Naturrecht 1 licuefeita 4 Heu 1 LEDESMA 1 Ochate 2 Markhan 1 Microphrys 1 Gerens 1 laacht 1 ostiolo 1 microescleras 1 MiniSAP 2 griseum 1 Gerwen 19 paté 1 Manouchehr 1 Jufayr 1 Mulrone 1 konto 1 Jarreño 61 Lysmata 1 Otrante 14 máns 2 Philetairus 3 Merostomata 1 Guoping 7 fisionable 33 mandatario 1 gabábano 2 hegal 1 Goroabe 6 pericárdico 4 Glendalough 1 pesquisadores 4 Frescainha 1 Fusano 2 perturbaren 1 mudbura 1 menphítico 1 Orneos 4 microlingüística 8 pec 1 meirolas 1 Negaban 1 partios 1 ibazoricum 2 floristería 34 Nikolay 1 pantimedias 2 imitaren 1 intemporaris 1 Modéré 1 infixación 1 inmunobioloxía 1 Luneto 28 ontolóxica 2 Horreur 1 lehte 1 Pimelil 4 Maiernigg 1 Genny 5 hipovolémico 1 Hirpinos 10 Jüri 4 landing 7 Goewin 1 Ovod 10 Gusta 1 negáballes 1 Obocel 1 Kayßler 267 Maximiliano 1 Hemicyonidae 2 gaigeae 7 Homininae 1 pedestrian 8 Paganismo 1 Kachuga 1 localizánse 1 Gabeskiria 1 peptidilglicina 3 IIIA 1409 pazo 2 honremos 1 Megalopidae 1 LEMG 1 lucianesca 7 Foehn 1 glicerinados 1 palumba 2 liaisons 1 metitransferases 1 Inmortals 4 Katonga 1 metilnoradrenalina 1 Mühll 1 Mahnung 4 lacio 1 pedrés 4 míúdo 1 Mikuni 9 Natantia 5 Lumeares 1 Magnétometro 4 Kaf 1 Ocalenie 1 Paridades 1 Naturmagazin 1 frutarianos 3 Martu 1 Oxymonads 1 Koppa 1 ircop 1 Littlehorse 1 Mongeville 1 plages 16 intermolecular 1 obxectivaríase 1 Fifield 2 hnýta 14 Györgyi 2 Klisa 1 Infotainment 1 Loste 5 LOZ 3 Kottak 1 Libitum 4 hidrogalicia 26 Paúl 1 Nowra 2 granota 1 Planchado 6 lipoato 42 Importancia 2 Gònghéguó 225 Grupos 1 nivelles 1 Ogotai 1 Mestský 1 lousadas 1 LPPD 2 Gerrikabeitia 1 Massabielle 2 Grameen 1 obrigoulles 30 Jalabert 1 organitzción 2 Moorcroft 1 Ornithomimidae 3 magnificar 1 iugis 1 Jalasvaara 1 Kravia 1 Nuketaaa 1 libertus 4 multiorgánica 4 LaRoche 16 kvas 1 Freisin 2 f?'la 1 Jujika 3 insistiuse 1 Galeoides 40 KERS 5 microti 27 Mikawa 2 megaron 1 Melchoir 5 Hohokam 1 incoaba 3 Haszprunar 1 Invivo 1 isimbi 4 isan 1 loreneses 5 ofrécelles 1 Niesiolowski 1 Phrenology 1 gonocórico 29 identidad 1 kikaichu 1 infaustos 10 pentámeros 1 Fonaments 60 Pep 38 jpg? 3 histiocitoses 43 Lamote 69 HIFK 2 Fontemalle 1 Opin 1 kentei 1 grossier 2 fullonum 1 múscia 6 Hexágono 1 HDS 2 Mortality 1 Kandandu 1 idealizacions 2 Musebu 1 mercurial 5 Lanzi 1 Makraduli 2 Palisa 1 furanonas 11 Mimnermo 84 microscópicas 1 Marguilis 7 Guillotin 1 Gosho 1 miricitrina 1 Nakdimon 2 Freberg 1 Gavanesti 1 lamfada 7 Interglacial 13 infanticidio 11 Joselito 1 Kholós 2 mudaronse 1 Placidus 4 Moendo 3 Hipnosis 1 malliflora 2 Hemoglobinuria 3 Län 194 Nirvana 1 ?Gn 2 jura 7 Messing 1 Muižnieks 1 Neofolclore 1 Nokotchi 1 Morcón 1 intermodulación 5 Oryzeae 1 losarqueño 1 neosintetizadas 1 Kozieglowy 1 hipodensa 2 jetfoil 1 Nou 1 Marcon 734 Iván 6 Monflorite 2 inflámanse 3 Hecto 1 paleiros 1 Inesquecibles 1 Orientadas 2 Neecha 1 Joceline 1 inarimensis 5 limusinas 2 Litho 3 Leninovy 7 institucionalizar 18 Mojácar 2 Matlatzinca 1 lateriflorum 1 PlasaDeLEraVella 1 p?pa 1 obtusangulus 22 imaxinou 1 Figueretes 1 OCMI 1 glýphein 1 lululemon 1 Parvaud 20 gluóns 1 Lumián 1 Importaríavos 1 festexouno 94 Huerta 1 ningyo 2 phycis 2 Perello 7 Lomachenko 1 gevret 1 foniatría 1 Hobhouse 1 Fallarás 1 fprov 14 Fornells 24 levo 2 Linker 1 Goutu 2 Koagulationsvitamin 1 fibrocartilaxinoso 1 Kaseda 1 Mandsh 1 Noiturnio 1 Gamsen 1 Muspiceida 1 Koitjärve 1 interfemoral 1 macroúridos 6 Kisses 1 Herennius 6 PECAM 5 gusten 4 Morredero 1 Frenita 20 Pertinax 1 gondolatnyi 10 lacas 2 pentamérico 6 Fáñez 1 Idearon 1 mumerosas 8 LVII 1 lastii 2 Nune 1 golpeoulle 18 Nederlandse 1 Liceus 5 hipnotizar 1 Necon 1 hachís 1 filoheleno 3 großer 1 heseloni 1 piquiño 1 ??nas 1 metacuarcita 7 Muchachito 5 Gradanski 1 karbovánets 2 lactamización 2 Líos 1 Farmacosiderita 1 krake 68 Odontocetos 28 fragmentados 3 install 5 IUBMB 1 Keverne 84 Goldberg 1 Ngereklmadel 1 parietinum 1 Kanije 2 Mayriti 2 Lantamne 25 Piadela 1 Paguropsis 6 Ghadames 6 Maléfica 1 oferecían 4 lápiz 2 Mecherchar 4 PKSH 57 folguistas 1 Phjiola 1 Nyankanzi 1 Jidaimono 1 Hendecasílabo 1 gliofiamentos 1 Monlam 6 gnatostomúlidos 1 Fionavar 1 Pegriceiro 1 Mairtin 25 Ordelles 1 Moans 1 Oradora 7 identitaria 1 Parricidio 6 Pernambucana 1 Folkesprog 3 maruxa 2 Fisting 26 intentase 1 feudal— 1 Manahil 1 nuptiarum 1 Macaques 9 Josée 246 orixínase 1 Geetbets 4 Guanche 1 Krasang 1 fritíndoa 3 orquestal 20 pintaron 20 manifestos 1 negrillas 1 matizados 1 microdrive 2 Grundiss 1 miniaturizados 2 Naajaat 8 forcado 5 Nonso 2 Ministrers 3 karamojong 1 Nombrar 3 lises 3 Kuntz 2 Lavoy 1 Paraformaldehido 1 Financiábase 1 persnal 2 mairía 1 Nepetoideae 2 Garabís 1 phasa 1 Parm 2 Nula 1 pero moi expresivo 2 musu 1 noricum 1 Nisima 2 Morbilidade 2 Fuentepelayo 11 parida 4 meditaba 53 irrelevante 15 observara 1 permitíaos 1 Naftil 1 illertensis 1 Furie 92 pautas 1 Hasianycteris 1 Kajona 2 lehua 1 kannst 3 Microteatro 1 glicosidados 1 Fischbek 1 Khouang 1 philippiensis 1 Novg 1 leetway 49 Fobos 11 Kosai 1 Litzenberg 1 interpunctella 1 Manti 1 lomce 1 Hasenjaeger 3 merinos 3 Hiji 1 nisten 1 hyperphyllar 1 íngremes 1 millorada 1 Gormul 4 Katla 1 Phoeniciloricus 1 Hipertropia 14 Liliopsida 1 NUCARIA 1 IPPase 2 Parkeyi 5 Phytolacca 1 isun 2 Jalinier 1 Mamestra 2 Laraki 1 Nagashige 1 Galaticas 16 oxidarse 1 Petzschner 1 Pallí 6 Guangxu 2 Philatelic 1 Ortemberg 7 Oradea 1 Phlong 1 —Felip 5 Mizrachi 1 Oosterzele 1 hidromedusa 6 Pardeconde 1 monospérmico 1 Kallsberg 1 Ingulec 1 Fontebecha 11 fixacións 2 Ive 5 hiperfosforilada 3 Motihari 7 haptonema 1 Mycolic 6 Pasargadas 1 Khaeng 1 Kamimine 2 Ondurman 1 Malusteni 3 Pesquisa 5 leasing 6 plantexarse 2 piná 16 Peiro 1 Nefererkare 379 pese 1 kharijitas 4 Hepatocitos 1 Mandj 1 Ljetopis 39 geohack 2 metéronlle 1 Permiaca 1 Glaubenberg 1 monoliforme 1 Lendzion 3 Longan 1 paracentral 1 ovoproduto 1 ovátidas 6 percances 1 Krasnobor 1 Lexesp 1 Fortza 1 Lestoros 1 Filminuto 1 Mezeven 1 MOWAG 1 locáis 1 Landreira 12 Perucho 1 menskenes 1 Janerand 1 Nnywane 1 Pintusevich 3 Perruqueiro 2 negándoo 1 Gawronski 11 Mankell 23 localizaba 2 HUNOSA 2 flavanois 3 Guanilato 2 Nogalera 2 Journalen 8 nervosa 4 homofónico 1 manufacturer 4 Keino 1 Kanrei 1 óss 2 Folatos 4 inaugurouna 3 Harbou 1 Nyarko 1 Magaloni 3 Piontek 1 Pepel 12 hippoglossoides 2 modernizarse 1 Parvimolge 1 luitas 4 Lancel 3 Hadith 1 FogBugz 8 Llan 81 musa 18 feiticeiros 1 Pispieiro 1 ontou 5 Heilderberg 4 Fontina 1 Klarinetový 1 Figuriñas 1 multifásicos 2 happenings 1 Heretgies 1 Finhaut 1 Maryo 2 Pasqualet 2 Pechan 1 Farcy 5 focha 15 Lopera 15 palmitoíl 1 grønt 12 Fradique 42 imparten 1579 Palacio 4 Mafsa 1 Macfarren 1 Moullins 1 Formulado 1 Oberschütze 2 Foroneo 402 Pere 1 Outworld 1 Gaylon 4 paternais 2 Pasahe 5 Ifelodun 5 Frenchman 1 Ichs 1 Kunitsyn 4 Glicerofosfocolina 9 Maze 4 Fuqua 1 hepoatocitos 30 IDL 5 Gatão 3 oxys 1 Grazniak 3 Melchtal 4 metodicamente 1 Muesca 29 guiso 1 Lípa 7 Lescano 1 Paleodicotyledoneae 195 Nash 1 Gaikokugo 2 nosis 1 Nabât 1 Hérésie 2 panónicos 12 infectividade 1 Guinéto 1 Guinoux 1 Niederönz 33 Niš 2 Ghevont 1 panaxanos 4 osteofibrótico 1 Ndzuwenie 1 perduraciones 1 jaspis 2 indultan 1 Ormoloma 1 NOMEE 1 Lalinda 1 Flóagaflshverfi 2 Piove 10 Pezobre 1 Generally 1 Ganggalida 3 lebt 6 nostris 1 Kirinriki 2 Moonfleet 2 Pibidal 5 lupi 1 Lepelstraat 1 fogar— 1 Hawadax 1 Macaza 2 Leonela 1 graficala 1 kbir 2 Micronovela 1 operation 2 Flambard 1 Madskillz 1 legandaria 1 iodinación 2 Guillamas 8 Grandvalira 1 lån 4 Lanceloto 1 Glyptaspis 4 Jeepneys 4 Manchega 3 Karamázovi 104 hemisferios 3 Jánoshalma 1 Kahf 1 invente 2 Paramio 8 Outside 1 matérial 1 Guainí 1 Merecemos 1 Peraud 1 jøde 1 mesogeensis 1 Leida 1680 hidróxeno 120 Midway 3 índicos 19 olmeca 1 médicina 1 Fórmao 4 Kniaz 1 Lanthanotidae 1 Gündisch 1 Marida 3 nanae 11 hamza 1 guatemaladesdeavion 1 Huntemann 1 Nôus 2 Ofrecese 6 Mss 1 kälj 1 Moraitov 1 Pato 1 Nadelhölz 15 FBPase 1 luitador 1 Giuseppantonio 1 Kikamulo 44 Lyndon 1 lasiopetala 2 luci 4 Liatroim 4 Peut 1 Menchón 223 ligandos 1 intercambialas 1 hippopotami 15 mamiferoides 1 Farea 1 Oliveberg 11 Omagh 2 Morskie 1 Marmorosphax 1 Mensuais 1 Gretry 1 Nodus 1 humidostatos 1 Pazih 1 Jetmore 1 macrota 1 Levavasseur 26 perdición 1 Jömper 1 Meissonnier 2 kosmos 2 onicofóros 8 oficializada 6 HIZO 1 Farmaceúticos 1 Grangeinae 1 Kimono 1 faret 1 mirlo 1 Nougaro 2 nomparell 5 Flamurtari 1 Kuato 2 Písac 1 manobran 1 Muntean 1 oubbliée 1 mielomeningoceli 12 Own 6 mordedela 39 JSON 1 mazote 1 Hipomedano 20 Hindú 2 kalet 3 homoacetóxenos 9 Miráns 4 lamben 3 Marchawc 17 louros 1 malaccensis 1 Linning 1 Hurstville 1 ispanu 1 fés 2 Olawa 1 Macaronésica 1 leuceia 3 Oteando 47 indispensables 3 Homunculus 1 Huércanos 1 Greibach 2 Glencree 3 Fotovoltaica 1 Nabû 1 Novodevitvhi 1 Molingo 4 Liturxias 1 galdrapo 1 Giroldus 13 labradío 8 Ominosa 1 fatimídas 19 perfeccionada 1 Paulien 4 isoamílico 2 Irízar 1 Gethyllis 2 Marrying 4 Jetafe 2 Hadaka 2 Liors 3 nostri 1 parónima 1 Paternalismo 2 Padrairo 1 Nukaaka 1 nput 1 piñeira 1 hämähäkkirapu 13 organizaría 5 Ioánina 3 genética 3 Odhner 185 leira 1 Münchenstein 1 Jachère 2 Nibbiola 93 impresionantes 3 Metaponto 1 felizes 66 melancolía 19 Lacombe 1 Infantly 1 Lelande 1 jacobaeae 2 Illuminating 1 IROC 2 nitrofosfatos 1 Macheth 3 pedradas 2 gorais 1 lan 3 pinchado 1 Hitsville 2 Papadópoulos 9 Flipper 10 magnetómetros 5 Geertruida 1 Lanzarian 1 ovacionouna 1 intercromosómica 1 ORRACHI 4 imperando 2 Matapitos 1 Hightown 2 Picheiras 5 nestoriano 1 Feyassé 14 pacientemente 1 intrafolicular 63 fideos 1 OIG 1 milletimindir 29 Mahdi 3 kinako 3 Ferde 1 hues 2 hillebrandii 5 Mamas 1 Peñayos 1 GloboMedia 21 galiciens 1 Pedalea 1 gryzt 1 Hospitalitatis 6 Iko 1 lbmol 1 Mazgirt 2 Filmófono 93 Loriga 1 Pascualinos 1 pGLO 1 Pantardo 1 Helsinkiläinen 9 Lorenzini 4 Ilunak 1 lation 1 FERRÍN 18 Hubbell 1 Nikosinas 5 Galsoft 1 Imbonggu 19 pentosas 5 Microcromosoma 1 garanteselles 2 Gueno 1 mutábel 1 Hivernáculo 1 leucodonta 1 istahili 1 Gallerskjæra 1 Márchate 8 Iitsu 1 mung 4 interfascicular 4 Mareiras 1 Harmstorf 1 Indoamericano 2 Flask 1 irrefreable 1306 localizado 2 impredecibel 1 Griptonite 2 Forzar 2 frisia 2 ftohtë 2 patis 1 Hspital 8 mariposas 1 fortalecimento 4 Notelaea 23 Gravidade 2 huitième 1 neutropénicos 1 legHb 1 konia 2 Friaul 101 gravando 2 MAB 1 limega 1 insaponificábel 1123 Limia 1 Nadejda 1 homs 2 nortamericano 1 niquelina 3 máficos 108 Pantín 1 Fantagraphics 1 grunder 1 madrensis 1 oprimilos 2 holosericea 1 inauguardo 3 Malonil 1 performativos 1 Mogoru 29 mortem 2 Oktiabrskaya 7 Ferdulfo 7 Ninotchka 1 Florència 1 misacantano 2 Hexilo 1 funcionabilidade 73 Gamper 1 Gelsomino 1 opolas 1 Lauterbrunnen 1 haematoxylon 2 ferroviere 161 greco 2 Mergini 1 Hackelberg 1 grauen 2 Jugement 43 Food 1 Hebrews 2 Khelat 1 Macrostomida 1 Fontibus 34 Gabor 1 Mancos 6 Olympio 2 Leneas 1 Philatéliques 9 Murch 1 Gakwe 11 Pedrola 2 necesitade 1 pauperización 8 Gamela 1 Patuxet 1 fughetta 2 Magadan 1 Patrem 1 Keong 5 n?chein 1 Manmade 1 Modwheelmood 1 frigido 1 Menæchmus 2 Petronela 1 Jachymov 2 Pesar 9 invitan 1 Mladorossi 1 hukila 2 Kaishounachi 20 persoaxes 1 Ogai 23 Fulget 14 inefable 8 Gundar 1 Ófeigsfjörður 1 Melgazo 1 grapiúna 2 Pedrafurada 3 Gardanne 4 phosphoreum 1 obreirosm 1 moléculsas 3 Ministeria 1 Löffelmann 2 Mersh 3 Kexholm 1 macneilii 1 Neoscorpis 24 Matapozuelos 1 Oreto 1 Jesminder 1 Khatchkar 3 márcaa 7 filagrina 1 impugnacións 1 frigoristas 1 Havn 3 oféndese 1 Ordbog 1 Paracostoira 1 Ortyxelos 1 peidorreira 1 LYPSA 7 IteradorVector 1 interepiscopal 10 nui 1 oprimiran 19 fois 2 impulsaran 1 Petóns 1 matogueias 6 groseiros 19 monocromática 8 Passio 4 Ilford 1 Fleanzio 1 Oulie 124 monde 1 Inaugurados 1 pilastro 1 Ishkur 2 Marilín 137 Marisa 1 Lubombo 2 irradiala 1 Maltoni 5 masjid 2 Pantego 1 Kenins 14 MVR 1 PKP 2 gradualista 1 ouvres 1 Kapixi 1 frugis 1 Górna 1 monomial 6 MSM 1 Nanpan 8 JG 1 Ogíjares 1 Narvallos 1 incombustiveis 53 Llosa 10 Hame 1 indsutrial 5 genetic 1 passés 2 LXR 1 Oceanofráfic 1 Fozado 1 Hormilleja 1 mocoví 1 Narudasia 1 pêcheries 2 Mateevici 4 Neotropical 4 moribus 86 Liutprando 1 Hibernianos 4 Griffo 3 Omeyas 4 Fuxidos 8 np 3 Ochenta 1 Glucocortociodes 2 Gettin 2 Gotobed 35 Peñalba 4 pincipio 637 intelectuais 1 Malayan 1 Grovelands 1 Piensas 162 finlandesa 1 Maúnfe 6 Neurosis 87 Gethin 6 PINTOS 1 hidróeno 1 Jacaranda 1 himnólogo 102 fúndase 29 Homem 1 Paleologuina 2 mill² 1 Nuarbe 35 outorgándolle 1 Munokoa 1 neoclasico 1 Nicktoons 4 indutivas 10 gateira 10 Fixós 1 piegano 4 Luva 2 Inktpot 44 pacificar 54 Malaia 1 mamoria 1 Filmstars 1 Malignas 1 Perillona 1 hepatotrópicos 3 Kelleher 1 Kompyuter 4 Irae 1 mescolanza 1 Ihmiselon 1 Parrinieddu 1 Golgothan 42 Loretta 4 Fennoman 1 fronterisa 13 Kabardino 1 neoáticos 1 Léléblé 1 IME 13 Parámetros 2 Jonava 3 Itsuka 5 Malacologica 3 paleoindios 1 friíño 3 Medallion 1 Kirchenzeitun 1 Kedayan 2 krajské 27 Ong 1 Inrerow 1 Mucopolisacáridos 36 mergulladas 1 Geisenfeld 1 manoscritto 220 haberá 1 loqueretur 4 hiperalxesia 5 Pekovic 1 glag 29 Necker 28 Frondizi 2 Montaigu 1 Pindolas 1 nulocigoto 1 Lankadas 2 identificacion 3 galvanismo 7 Kyrenia 1 Heteroclamídea 2 inventaría 1 Nettapus 14 Moson 1 Kinyakin 1 Freethinker 13 lejos 1 nacionalísmo 3 historic 4 inadvertidos 1 Milll 3 gravítico 96 Osma 8 Nefroloxía 3 labarada 1 monometilaminas 2 orizo 1 Horrea 35 Liderou 15 Guztiak 1 Iazúa 1 inwardly 9 monopolo 1 parágoxe 1 Perén 1 igrtexas 7 Ormondo 1 Okouchi 1 ordinaires 1 Krakkó 51 Medinaceli 18 Groot 8 juliana 1 kam? 1 Namibio 47 nombres 1 hervorbringen 5 Hölzinger 3 herpetos 2 Melkonian 1 litkicks 1 Gorongosa 1 Giginta 6 Keops 1 Mequínez 1 Jaason 1 MediaLive 1 Palmense 1 Glente 3 pastoriles 57 manx 1 Foscarnet 5 FEDERAL 4 hiperenxebrismos 1 Heptameron 1 Mefi 4 Hapag 19 occhi 2 Kagayaki 4 Lehninger 1 monstruosamente 1 Gedaliah 47 implementa 1 gijam 1 naghala 4 Kanak 1 phoirt 2 pertencido 2 Géczy 2 Kaempfert 1 LXXXIV 1 habíano 1 Magidov 2 festaxando 1 Hédé 1 Leleu 1 glucolise 1 Mackays 1 gueifas 7 interconectar 3 hidroxipropanoico 1 ficion 5 focalízase 5 Landolt 1 hypertext 1 ocultarllos 1 Herritarra 39 paternos 1 lyseo 7 mucoide 1 levenslied 3 Nimm 2 Gonzal 48 Lied 1 gilsonita 1 Hotate 1 herbáceaas 1 Laparose 2 Grampon 2 Faran 14 Hepa 1 Ollariis 8 fantasioso 1 Käru 1 obteniendo 1 GoodPlanet 2 Museet 25 Káiser 3 Lateinischen 162 júnior 1 Guillarme 9 Krueger 18 framework 3 mancou 5 Molecules 1 hreinu 38 Globe 11 granatum 1 Frankowsky 1818 http 2 Gamescom 3 Junger 2 LNT 1 noc 1 oxitócicos 5 Gràcies 2 Jonico 20 Ibrahimovic 15 Lomond 2 pigeons 2 Lupato 4 heterodontiformes 1 Koll 1 Nonat 1 Katsuiama 1 Mugihito 27 Mirabeau 1 ilimitación 4 Lluita 2 metilguanina 2 fù 1 loubar 2 Osmorhiza 1 Forgescedario 1 Krobatsch 2 Perfórase 4 peidear 1 kolei 10 Nagumo 1 Kaishain 3 Manatsu 1 parde 1 glucuro 2 Merecedor 1 grans— 2 nära 1 Laurido 1 gellygen 4 Insularum 3 Orders 1 Klinika 1 MICHELA 17 Heemstra 5 Gioco 3 onc 1 perteceron 1 Isguen 1 Feozva 1 micobacterianos 1 mahoinnaise 1 Nowheresville 2 Garnil 4 Fírgoas 6 Hordern 1 individualizadamente 2 Leuna 1 munificentia 1 lamellipodios 18 Fungo 1 Labie 1 Maldad 3 fimbriadas 5 nogometni 1 Menda 1 OED 1 Kamensky 1 Néboas 2 Hormonal 511 Matt 1 licoreira 1 Literarum 2 igualador 136 Monzón 1 Lazarum 7 farsante 1 Paratiisisaaren 2 pirometalúrxicos 5 plantaba 2 Mersenni 1 lúsis 1 Gorevision 11 Massalia 24 gentes 1 Makara 1 monxo 3 Nelo 1 Nápravník 4 Lathrop 27 Lúas 1 Peristaltismo 2 Fregat 1 inusulamente 1 Minervina 1 interfértil 1 Ioakim 4 mencionara 1 Mandouse 2 Montceaux 8 Iesu 1 heeno 27 haptófitas 1 —Lucrezia 1 Iwrch 2 neuronio 1 Jondon 23 fartura 1 Favoreu 13 micrantha 2 Halolamina 2 Leipoldtia 1 ovde 1 holD 3 insípidas 5 Pándroso 1 planteable 1 Kog 1 Pinggai 1 gañean 1 Loughkeel 1 nomees 1 Pituriaspida 1 Lazán 11 iarda 1 Hesei 1 pittore 1 Hracek 1 malacologie 1 Mulá 57 Mycoplasma 259 Hispano 17 Mamut 3 Patriarcheîon 1 Madhuri 1 melania 1 Haridin 1 Majchrowski 1 innanz 46 Oolong 5 neutralista 3 Honeymooners 2 Koaderno 1 Lazaroni 241 nacida 1 paraoccipital 1 Misimovic 12 motel 1 Mischkaffee 2 Iena 3 pagábanlle 1 litiásica 1 mailla 1 Ih 80 Malaca 7 lexislou 7 Liliom 1 ocupásenos 1 Inmunoensaio 2 Lanceros 1 Neptocarcinus 1 Foronlle 2 Feminae 1 Kantine 1 Mateotti 5 párrafo 1 gestorben 3 Pioz 2 Genouilly 2 Hohenwart 2 Kratos 1 Pallarense 320 marciais 1 Henriade 1 novaiorquino 1 Friúce 2 Meadowlark 5 marge 1 Offenbarungen 2 Neoptera 2 Hidroxilisina 1 NaHCO 13 planitia 18 jujutsu 8 Langlois 1 menorah 8 NACA 117 ntilde 1 Llibert 1 habituouse 1 Lahmani 1 marxinalízanse 10 Hamelin 1 pilóricos 2 fueloil 4 nubosos 3 magnas 6 Lobby 4 incomprensiblemente 1 Korkios 34 necesitado 2 Franqui 1 Maccarie 31 Ilúvatar 2 Marrano 3 fibróticas 1 Killzone 1 Peralonso 1 perxudicada 1 periescapular 32 inuktitut 1 Ismenias 4 insulínico 5 Normandia 13 furano 6 Mastigocladus 1 Makomanai 1 Onesy 1 ofreciería 1903 ópera 5 Halt 429 interpretada 1 gummosis 1 Kring 3 penalizan 1 Kasahara 2 physikalischen 2 nomenada 1 inflíxanse 1 guarnecidas 3 Mitnick 1 Giornalista 11 libran 2 Fljótsdæla 13 piacere 1 glicopiranosilamina 1 notificaban 93 licores 1 Hostil 2 fotometricamente 1 grevi 1 Pérdena 12 Hoboken 1 icrementar 2 insensiblemente 1 Morgongiori 4 Oldoini 1 Pachypleurum 15 Mancera 1 impúdico 1 Hyadaphis 1 palidamente 1 Nicolaykin 6 Hardie 3 Pachacutec 1 Licantén 3 ma_ndré?a_m 1 Muratovic 2 PISCE 10 Königin 10 Herlin 45 Fredrik 7 Gallotia 3 lyeh 66 patrimoniais 3 maxwell 1 identica 3 Motru 4 Pietrasanta 2 glamurosa 32 irritante 10 McKagan 3 herligste 3 mudial 2 pardusca 62 lentitude 1 Heerufer 3 improvisaban 66 intimista 1 kusunda 2 HDLs 6 Librazhd 1 Fiaman 1 HELIX 1 Maxwellia 1 Forcadel 1 Martakis 1 Micul 1 Kylmämaa 10 Hashima 1 Isometepteno 5 Hardturm 1 minerario 1 Phiman 4 Phalaenopsis 1 Mijtovic 1 pesra 1 Ivanovs 1 Gemeinsamkeiten 2 Lillois 1 neuromedina 1 fototermólise 1 nauruana 1 Issenheim 1 independete 1 joyneri 4 kidaritas 1 Göttling 5 Karleby 17 Gorges 1 Lovango 1 papables 1 Gracewing 1 Hoffmannstahl 31 pechaba 3 Hunsaker 1 nositi 1 Marišta 2 Grecques 91 melanocitos 2 Lahmar 1 ketsiap 1 Kazutoshi 1 Makete 12 Nia 1 microsopio 1 KSDO 2 Nagari 1 Pantana 3 hipofisiarias 1 Musikarchiv 1 Libror 6 nardo 462 MAL 4 Mazet 2 McEachran 1 perfides 1 hissarica 1 liger 1 ortocromatófila 3 limacha 2 obsequiada 103 mozárabe 1 heptahelicoidal 3 nasofarínxea 7 Minúsculas 10 Gunung 1 Lefooga 4 Kishinev 1 Hochberga 8 Katya 1 Hermonius 1 panav 1 Omfalo 2 perdonou 1 Marktbrunnen 1 Maundiaceae 7 Katun 1 Grigórievna 1 Nork 1 lexicalizadas 1 internacionalizouna 50 percebes 2 Kanapoi 1 Musumarra 2 multiunitarios 1 goguettier 1 Nywane 1 Levinger 2 Magacela 1 Parécenme 1 picomoles 1 Jesuíno 1 Lessingia 2 Perdican 1 ímposíbel 70 Nicky 1 Padován 2 marcela 1 imprescriptíbel 8 Otawara 7 Olivet 2 Fesga 350 Igualmente 3 Hipercolesterolemia 1 Mírate 5 Grandinetti 9 filtrante 1 footjam 113 miniserie 1 Jekabpils 5 Láinez 1 Hayko 5 pantin 1 Gaviformes 1 Husarengolf 1 ouvide 1 Panserhjerte 419 patrocinio 1 NAPH 1 pertegana 1 geleidi 6 Haumaka 1 Kainardii 2 holocarboxilase 1 Kloser 4 Mataix 1 Karlic 1 Olst 2 Mankinen 1 Korwin 52 hipocampo 2 Gabardan 5 Matija 156 pementa 1 Katsuhito 9 Galliano 3 Jacanidae 1 Nkwerre 20 Pessach 1 Lawndale 1 Hidalcão 2 Muqdisho 1 Muirecán 6 Luzim 8 Peynado 4 Kovacic 3 Guajava 2 Humbrock 1 ouls 1 Lolowai 1 paradentipes 7 macha 2 Houda 1 omišt 1 Mortorio 2 monoxeneos 1 nanomáquina 24 Meadows 1 mannon 2 Meskene 1 lambeuse 2 nicetistas 1 Kutahya 1 galegoparlantes 1 Peranakan 2 oscarizado 1 Navel 1 Meamán 1 Freydank 2 maschi 7 Illuminati 3 Guanidinium 1 linguograma 1 —paulatino 1 paravaginata 1 Guinchos 1 MFG 29 Laon 1 peon 1 Frauenverein 1 intrasonicas 1 mustero 14 neuroblastoma 2 Oxyrrhis 4 luxs 1 narrantes 1 Hatlin 1 Lotarías 1 Macropipidae 3 masturba 1 monopus 72 Mirador 1 Fougerus 1 gardarroupas 28 Gentleman 2 Irpen 1 Obverse 2 Isopropamida 2 hidatiformes 18 Langa 3 Immediatamente 3 gummifer 1 Metilhidrazinas 1 Mugel 1 Loganberry 11 Ocón 1 lynceorum 1 Peninsaari 1 Penouseira 1 montrealés 1 miszczenkoi 1 Iguifou 3 impasíbel 1 Freezer~ 7 Glaucoma 1 Lentejas 2 Kimeramon 81 óboes 1 Marlenheim 1 louvándoo 1 Komisarek 1 perforábase 4 Glicolípidos 1 gepard 5 Piston 2 jesuitas 1 Líbues 1 Magueijo 6 Maktoum 1 Osbodeus 23 hacen 1 Pambiqçi 1 Grundwiesen 10 Indopacífico 1 neurofibrilles 3 garabato 1 Nadouessioux 3 francoflamenga 2 FlashCast 1 Goderich 1 larpeiros 1 pincharía 1 Olympiodorus 1 perfiláronse 1 kostatarra 2 Lamíaca 2 Graváronse 1 Khorhoi 6 Meurig 4 Kassam 1 metilpirrolcarboxílico 27 Glarus 2008 Martin 1 Krevoy 1 Niouldé 1 Hilkevich 1 líbano 1 heteromórficos 45 Hop 2 Julfa 1 IVI 2 multiarticulados 1 Fichet 1 Haino 3 Litre 19 Maroussi 1 Ifc 1 Floranges 1 mutilak 2 GESTAPO 1 Istitut 6 oportunidad 2 Kupper 6 neurodexeneración 15 Mclaren 2 Mostyn 1 Péchambert 1 Kivisild 1 Massinga 1 falsificacionismo 1 Hornuez 1 Patroklou 1 festividad 1 Maubourg 3 PDLPEA 3 graxento 1 Lumic 1 Petalios 1 Mástil 12 Moiras 1 Nishinomiyahama 1 Finkenzeller 1 Kashmiri 1 paraplacentaria 1 Moreo 6770 municipais 35 Galtieri 1 femí 5 HOK 24 mediametraxe 1 Ländern 1 Milevi 1 malagaxe 9 osteoproxenitoras 12 orbitales 1 Montautour 1 Leabar 15 neuropatías 1 Hilazas 1 pascoa 16 mogois 2 Monklands 16 halóxeno 5 Femés 1 Nissille 1 Miscellania 40 periodistas 1 latissimum 2 nucula 3 Pendletones 9 Liberador 1 Parargyrops 1 mesocracia 24 planar 1 Nasatyas 1 Maywood 1 Mlynarczyk 1 pentasílabas 1 Nagybajom 33 perdices 1 opinables 1 katsudón 43 Hannu 4 ? 2 Llïonesa 1 jazzcore 1 Matachana 3 malheur 3 pericentromérica 1 Jerduñe 1 Ofiacodontos 3 Hyadum 1 kleisurarka 1 latrocinios 1 malherbi 43 Gen 1 Khayrulla 2 KIN 4 Mamajek 1 Oegstgeest 1 Finlandiae 8 Luvas 6 Llyn 1 Meguetha 1 Köves 1 gnatocerebro 1 Overnite 1 Lukianov 3 Gigurrorum 3 Ikorodu 36 Kiwi 3 Jacke 5 paroleiro 1 lackeen 5 garibaldinos 1 ismaelismo 2 insubstituíbeis 332 Galegas 1 Monton 3 JYSK 68 Peñafiel 2 Naroa 1 pecuário 1 paleocristá 1 luteol 5 Gets 1 lixiviaba 28 miristoilación 1 melanosómicas 2 Inxeniería 1 genericamente 3 Nedelya 1 Marsnik 3 Koru 1 Meigan 1 incertidumbre 2 Fariñeiros 1 Nordschleswiger 56 Nation 8 Governor 2 Latinae 13 morganático 1 mentirlle 1 Parlour 1 lávllodemiin 5 Nanoviridae 19 Mme 1 Mailly 5 Luzía 1 Pazuengos 1 libSerial 2 Obhádhyah 7 húsar 1 motivándose 1 Permisiva 5 ingenio 1 Jiujiang 1 plasmábanse 1 Perdoma 1 Ortrud 8 Feodorovna 1 Planilla 1 Galleríes 1 mitanni 2 Lebensbild 1 menganos 1 Pelletán 2 Monfortaine 1 paucicostata 1 miid 4 Nanger 1 Hrp 2 internación 54 Internazionale 1 Kirikú 1 Labaronas 4 Lichnowsky 2 Nummenkylä 1 Favrot 7 follosas 1 HarperEntertainment 2 Phaeodarea 3 permetrina 3 Paralel 1 Gerky 1 Mólidos 1 Müllerin 3 oriundas 8 Gradaílle 30 Modalidade 30 Nuñez 6 Geographische 12 letingos 1 Galila 1 Modale 2 Jip 41 garanten 1 Mouramia 30 obsoletas 1 meänkeli 1 Kalinski 1 juckâ 174 ficar 2 fratesque 3 gravalo 1 neriifolia 1 mainzo 1 gittinsii 1 glathei 1 Lužické 1 Nejjarîn 1 Maasel 1 interpretadora 1 manceau 1 Náuatls 1 percórrense 19 Panadero 1 Fibrilações 3 Gomail 125 meteorolóxicas 15 fragmentar 2 occípito 5 Identifica 2 IIT 1 Kurfi 1 Kokyogaku 2 Ioichi 2 habérselle 1 Kajlich 71 Pio 1 Mäkilä 14 Pasini 1 MOA 4 Pambley 1 Fonyou 1 helicoideus 2 Pentacerotidae 1 Gukansho 2 Neasy 1 kalathos 1 Pausuac 2 katapugon 1 Irulan 1 Ilimuda 2 Marsonnas 1 McNight 4 Orientalium 1 Mainchín 6 Mainat 1 petreos 5 Gayón 2 Heissler 1 Felicítase 3 Gardeny 14 Lukin 2 peelii 1 neantización 1 misase 1 Hexacianomanganato 1 Lambinet 3 laxis 3 Magnox 4 Heckscher 1 pasaou 1 fuwa 3 latinus 43 maleico 57 invisíbel 2 organizala 1 Perjura 1 Obèye 4 Pagliara 2 Lolobo 35 ? 4 Kazuyuki 1 Inemuri 9 Galende 8 fixaran 1 Llafar 1 Gerzeense 1 pedíalles 234 Kerry 1 Kerkûk 1 Jezior 1 Meletta 1 Loucetius 1 Jiachang 3 Óllese 2 Flatman 1 Haljala 1 Optatissimo 1 Koepchen 1 Malyân 7 peine 374 Láncara 19 paradeiro 1 manoscrita 1 Geit 24799 forma 4 míseras 1 miocenos 2 lidou 1 patersoniae 1 paci 1 Morawitz 1 Innenhof 2 Omalogyra 1 gabinente 6 mauritiana 1 Hisenda 3 Hrivna 3 Gotische 1 Läänemeri 1 metaphisicorum 1 glicoproteómica 241 Gomesende 2 Lipchitz 7 Freuden 1 Gaspà 1 màquia 1 occidental— 6 Kekilli 3 ferð 1 Microhyrax 9 iluminismo 11 Permítese 1 Kalombo 1 Kantrex 2 pa?angas 1 Houynhnhms 41 Miers 1 kendayan 1 nodula 111 Llanos 1 Jende 1 lassent 9 pandeiros 10 Ladrones 1 HTT 1 imidazolio 6 perdona 1 malteadas 1 Janenz 1 myristiciformis 1 Komaña 8 mythologie 28 Morrow 46 NEP 3 Jolanta 3 Pelusa 1 Hišam 11 operandi 1 günleri 1 Lazzeri 3 Isoude 7 Parrús 1 nemaeus 16 habilidoso 1 foss 142 levará 1 FOH 1 fluvioglaciario 7 oxycoccus 1 Ghoi 1 Kokuwa 1 Guloyan 1 Olimpique 62 medraron 3 Fethiye 1 Fudoshin 8 Kakuzu 1 Kuriru 1 novase 4 Oberlé 5 garantirá 2 Mughira 1 Mícala 2 Hatori 1 Nyren 1 mediobasal 1 Mollados 805 Ordes 1 Horusu 2 mormons 1 nabigazionekoa 3 Laskonogi 1 Gothardo 13 iranse 2 naga 1 negócios 1 Michelangelo e 2 Lallans 1 Labonté 1 holl 1 gnomónica 1 hixienizados 780 funciona 4 larínxeos 1 Kouadioblékro 321 faro 1 Oltár 1 favorecimentos 34 Passos 8 g 1 invariance 1 Glodrydd 1 gorduras 1 Înviati 447 ibn 8 Iurreta 1 Kondossou 3 Hoddar 1 invecta 25 Fallon 1 Iracema 10 nominalismo 5 hasídicos 25 marchante 1 localízana 1 Madriceiras 3 GEORGE 1 Pabay 1 Gluconsäure 1 Leitneriales 1 Obaid 1 hemicigótico 1 läuft 6 felpa 24 Guti 2 Hipalan 1 Kannemeyeriiformes 109 Miraflores 1 Hrayr 3 hrad 75 negaron 16 Meek 1 Hubschrauber 1 'fl?k? 1 Kiitet 1 Glæsisvellir 98 festivos 1 inspetor 2 Gömbös 1 glutinosum 1 Pardachirus 10 Moralia 2 minorización 1 Pawana 6 LEÓN 1 Pamco 1 FSCG 2 legionis 16 Ouverture 1 Kapoera 1 Nisling 1 pederneiras 2 macrocephalum 1 pellirosse 1 irmáns Pedro e 2 lógico 1 Montaliñu 1 Melisma 2 Oduro 1 Gliedmassen 1 Jávea 54 palustris 2 Mucopolisacaridose 1 Heen 3 Japonica 1 Linneano 1 Nausori 1 martensítico 2 Igoe 2199 familias 1 faoadriamed 3 Mixteco 30 Holbein 1 laosiensis 1 luchó 2 Inductancia 27 Historiae 1 Hollenbeck 2 Fundaçao 1 Keydell 18 Mansa 1 glos 1 Matxinada 3 Kolár 1 Hochwagen 1 Lemovici 2 Lomear 1 Fornjóti 1 Lusiadas 1 kdeextragear 1 fanfarrona 2 Leopoldstadt 3 ofrécenche 1 Novoo 5 FCM 2 LOVER?I 2 jurchens 1 Hanakamp 1 Nerol 1 Olimpíades 1 Kunene 3 Helitt 1 Mayilraj 2 Lagunera 4 Georgievich 51 Palestrina 13 Flame 6 Mýrdalsjökull 3 Oikarinen 1 Lintberg 48 OIT 2 kopieika 1 Florentinum 16 neurotransmisión 1 planam 4 Intrón 5 Ikite 1 Impiedade 122 Labor 11 Frenkel 9 lunga 891 mellora 2 nunavik 2 haptorios 29 fosfoglicéridos 1 MetroBilbao 1 fecunde 1 irin 1 microecolóxicos 1 Ferin 1 FASN 1 LadyDevimon 1 norbixina 5 Lesneven 3 Hantzsch 1 Pipinae 1 laiu 5 Mehadia 2 Oumu 3 Hurus 2 fjórir 1 Horjales 2 Omnipotente 1 hérissée 50 Palomares 1 inaugurásese 22 iii 8 Livistona 2 piedemonte 1 Holzwickede 1 Hornito 1 Petrolio 1 Krykus 2 Himiuli 20 PK 10 pensionistas 19 isleños 1 ispf 1 Khenemetamon 2 Maravilhas 3 guindaban 5 Gloriana 1 Meravelle 1 NTF 2 liceístas 2 Jovinovac 1 Lehmer 1 Kýklôpes 3 fumeante 1 jugo 1 Luciedo 1 GALIza 1 Ganapatihridaya 1 Korso 5 Mortillet 1 Lärm 1 ? 2 joda 182 Hondarribia 1 ha???k 3 incrementaran 1 Kareli 2 matrika 4 Muta 1 intelingue 1 Lincousky 3 forxara 1 Höfðakaupstaður 1 inoperatividade 1 Ishac 11 Hedroso 2 Mayúscula 3 Fontanares 1 GFD 3 Gestoras 1 Mágus 1 Fussión 2 fotónico 1 landship 1 Nautical 2 lacónica 7 Glaze 45 nozze 1 Heredabilidade 1 glépa 423 monarcas 1 Latchford 1 Nelec 1 Meyerowitz 1 MBit 1 megacalyx 173 morcego 3 fichaba 5 Mlle 1 metananus 29 humaine 1 mainteñan 1 lardeado 8 MDP 3 Ghorasán 1 Liptow 1 Luderitzbucht 18 Peitieiros 1 Millichamp 1 Offerman 3 fluoradas 1 lamuio 1 Hemiandra 1 Lizarrán 12 géyseres 1 Leptoseps 108 Nomeamento 55 Petite 1 Hügel 1 Obakasan 1 Panchina 2 Macgillycuddy 8 Fibronectina 1 Kukweza 2 Mase 54 Halobacterium 1 Lekce 2 Mazahua 1 Jumentos 2 jazzista 1 Pantxineta 2 huettneriana 7 Harai 1 Maxineni 89 modernistas 1 Fondaque 1 Moscoba 3 geckos 20 inválidos 1 kaledos 8 Myristicaceae 1 Paruzzaro 1 Geoprocesos 2 hypothesis 2 Kuyper 2 Noucentisme 1 leveilleana 1 kacke 4 Leskovik 1 multos 1 Goutte 1 Myxininae 1 Intipata 1 Íosa 1 Gymnocarpos 1 penial 4 Pandenulfo 32 Joris 1 Moina 3 Leutgeb 1 Fylgja 1 Jenz 5 laminadas 1 Ongtüstik 1 mutato 2 hika 1 panayanus 2 nubica 5 glicerolípidos 2 Giric 1 Midoi 2 Lanoë 7 houben 2 Melior 1 Meska 3 Opelius 12 piercings 17 paporrubio 6 Mihails 1 Landaagiraavaru 11 IEV 68 hepáticos 1 homotoxicoloxía 2 Magnadramon 1 JAKOBSON 2 HEp 6 oraculares 44 patrocinada 1 Peterpan 1 Niperotidina 24 Negrelos 13 peneidos 37 laxante 1 Paletta 2 Larysa 1 kash 1 mangui 4 Pacheta 1 Kanemaru 2 Pampeana 1 Hálfsrekka 40 pineal 20 Goleadores 2 Herzgewächse 1 Isser 2 Kidush 2 McNicholas 1 pacificaban 1 Hed 1 Ophthalmophyllum 53 Kathryn 595 Filoloxía 3 pityusensis 1 Feirionnydd 1 íštit 1 Personalidad 1 Observed 34 Gradualmente 31 Obiang 1 Nebela 2 Kalamua 104 Jena 1 Mulgrave 45 Néboa 2 ouvín 1 Pecharse 3 nesgadas 1 Octástilo 19 Nabónido 1 kasitas 1 ocupadísimo 2 Moreve 1 Petrogasa 3 monasterial 1 kanon 2 meteorítico 1 Groselleiro 3 Kolendo 9 Llanto 2 Neolamprologus 2 Geminiano 5 Lorisidae 1 luchemos 32945 onde 11 Muskegon 1 impelidos 5 Ophisoma 1 Kisuru 1 pinteinos 1 hidroxilfenilpiruvato 1 murzak 5 monsteiro 342 metrópole 4 Haukr 1 Fuarce 2 Itaára 2 olanzapina 2 fluidal 174 Honor 1 Otieva 1 Lubaki 3 Kniphofia 1 irrationalis 18 Penya 1 Inazares 1 jungere 1 Henrique II 2 Meilás 3 Khilji 1 Kuritz 4 Godi 1 hemopexina 1 Leòdhas 79 Ph 1 Nikichina 1 natrium 1 Nanashi 27 Lim 1 majades 1 legóns 3 Kinkyu 1 Pasquati 46 iroqueses 1 gojë 3 infecto 3 Millerieae 1 Gouotro 1 Narfao 1 Montets 1 Parbig 1 Hispaniam 2 guerrillieros 1 gax^ 1 Naitomea 14 Fusobacterium 1 Muzic 1 Illuga 1 Mikhaylo 2 Inclinacións 27 persica 31 If 1 Notomabuya 3 Glossotherium 1 Palamios 1 medicinaria 3 indiviso 1 Grustau 29 ocupante 2 indómitos 8 Outón 6 Grima 2 Guaresma 1 mbembe 1 Neón 1 Pisania 7 Johto 27 Piazzi 4 Fortúnez 1 heteroxeneidades 6 formosus 1 initial 1 Mostarda 201 Frédéric 1 Lipertis 1 pit? 1 OLLO 28 Masjid 2 Izkiriaturik 17 Incident 1 lematización 90 hormonal 1 nádiheged 1 Klattenhoff 4 Mossen 4 Marmalade 1 Phosphaenus 1 Galleguillos 1 Mirimiri 1 feitizasen 2 Pistolero 69 FTP 1 fresquiñas 1 Medramento 1 Monocalyptus 3 Kalea 1 handa 1 globulifera 1 graupo 5 Maximilià 1 itda 1 PGR 18 Jeannette 1 interpretaríao 1 pistacchio 1 Khakassk 5 opacus 6 Golson 2 inscríbiuse 1 Gulnazar 1 parlemnto 1 gorir 2 fosfopropofol 14 inmóbel 9 IIIC 22 Lacón 1 manchara 1 macroporosa 18 olfactorios 1 ingrami 2 Herrenchiemsee 2 penichairas 12 lingüístas 2 Hammersley 16 Oxfam 4 gostan 2 intresse 1 oscae 1 Lipizzan 3 Galluzzo 3 Guetteur 1 kalkhoffii 5 FeS 2 HOPE 1 igerewen 2 glicose 49 marionetas 1 platizoos 4 focalizados 2 helgener 1 fýrs 1 organizacióin 1 Hypermastigida 91 fornecemento 1 levantóuse 1 Methil 1 Murrupula 4 pactismo 23 Hampden 2 Hydrazine 2 Mustasaari 1 Konchak 31 Laxas 1 massamma 1 Joelson 1 Khemisset 1 Monfortinos 1 lisonjas 1 fucosas 1 hurry 21 FireWire 1 nicornio 2 Legendario 1 Pitcos 2 malherboloxía 1 Majolikahaus 1 neurofibromina 1 meterlles 1 Giovanbattista 1 ordeNomeNome 2 idearan 16 LNA 4 kopek 1 fisioloxicamentes 119 Mia 2 Landolfo 1 Mandarino 458 invertebrados 4 Gine 1 myrde 1 Magelhães 1 lottini 1 Orlovka 1 Inishnabro 33 Guthrie 1 Fiquei 1 Fridolino 1 FARR 1 Heysátan 3 locrio 1 Jòri 4 Heparán 1 Kendarat 1 himnoImmenso 3 incluiríanse 1 highered 220 Mon 25 operario 1 Petrificata 1 nigroniquia 1 Neboade 5 Nocello 1 Hibble 1 Ghiraldini 1 nankina 4 multiencimáticos 1 hbac 9 fielatos 1 Ph? 2 Fuentelarreina 4 Joëlle 1 Garbet 29 inesperados 1 Garupá 1 Lakarra 2599 Media 5 lineis 58 nomeaba 1 Habrian 1 perado 2 ochruros 1 fojaensis 190 peptidoglicano 1 Malezalera 1 orballiñas 97 mitolóxica 1 FerroAtlantica 1 Ókhi 1 Mandandanyi 1 Mystras 1 gristnogawl 1 flipped 4 liberarían 1 Kameelperd 1 Hostellerie 2 Nemaathapy 1 Iwelmaden 3 intalacións 1 Iudaeus 1 Filabo 1 incubará 3 medicado 1 Kand 1 notábaselle 1 gemtuzumab 1 Malgana 1 oqaken 7 paxareiro 53 nad 4 maydis 1 megápodo 12 hipnose 1 indigestae 1 llúa 1 intraxénicas 1 heatha 1 JEME 12 Infelizmente 3 glicoconxugado 2 hattili 1 Natrun 3 Fodón 1 Haymet 6 Luhansk 2 Halosicyos 4 Glanz 1 Gontrada 56 Nabucodonosor 6 Papandreou 96 matrix 13 Ils 26 peches 1 Neguse 201 paradoxo 1 mensuales 5 fannos 13 gin 3 GTZ 1 maluso 1 Firmina 1 Mockery 1 hemiliguladas 1 FangLongmon 2 Lomellina 29 mamilas 1 pegándoas 24 Nostradamus 1 Kazachya 4 Litótrofos 1 neogeus 1 jumalrunot 1 miyiense 4 Morsi 3 Frares 2 litura 361 observa 5 Masterización 67 Nubia 1 Knust 110 oclusivas 1 Olitsky 1 Grayer 2 Juh 19 Perrelos 1 Papajaran 1 Köcherbaum 1 Parasect 2 frutofuranósido 4 Ilustrísimo 4 Pardas 4 Gilze 2 Lavadora 9 floruit 3 internalizada 4 Palmetto 7 kasua 3 pegarlle 1 Macray 13 Monkees 124 picado 129 Fra 2 Menstrie 1 odpowiedzialnoscia 1 mecanoquímicos 77 Lóxica 2 inflexíbeis 2 Konohagakure 1 Ordin 1 Lebia 2 Martinamor 2 Iñurrategi 1 fotográficamente 1 Mære 1 magoás 2 Iraniano 3 Fúndanse 1 Montheurt 2 lexicamente 1 mlg 6 Nik 7 Gangnam 4 fracasaba 2 inepta 1 flicka 4 incorporaríanse 1 megaloblásticas 2 penalízase 1 IDUS 2 Innichen 33 montañés 3 interprétaos 4 Patelisio 1 Parergodrilidae 1 Hiuan 1 Juviño 1 Nelyubov 1 irioideo 6 Larena 85 Federica 2 Hilir 2 Garbagna 1 Libertatii 2 leptoclada 24 Nogent 2 Kogiopsis 2 gastrónomos 18 kaj 1 Neuenkirchen 1 mateix 12 Higaxi 3 Miramon 1 Marcu 1 Fettah 4 Jannus 1 överordnade 1 Mengrai 2 Farmacopeia 1 Lahüntze 1 joyas 3 Mandara 3 manifestarían 1 horrorcore 1 Kondô 461 incluíu 1 Niokosso 2 Matey 3 Phascogale 6 investigaciones 1 Gollin 1 maldicíndoa 1 Maifeuer 1 phycomata 6 Mexuto 1 Intellectuel 1 paravas 1 GGTGTACGGATGTCTAACTTCTT 1 Murov 1 †Microdium 1 Kimbla 5 Megabeat 1 Intertrack 1 perdomai 3 Pinyol 1 penourenta 2 Hinojal 2 Nakhóda 1 kisopa 13 homonimia 32 Ivor 5 Koré 1 lumi 31 Molino 1 metelúrxica 1 monoparamylon 6 Idles 1 lucíndoa 1 Furbo 8 formaríase 1 Laokóon 1 LETE 1 Jubileu 18 Mogwai 1 Gaissau 1 NICE 3 Massar 14 humo 1 payate 1 Pauliteiros 1 Kyusaku 1 mostrades 1 Feck 7 Perpètua 12 Mustelidae 1 Ngatendo 55 Her 1 OpenbravoPOS 1 Phlyctaeniina 1 Környey 2 Felicité 5 Fraco 1 hydromeli 4 Gayant 1 grahma 2 IEGPS 2 Invólucro 2 Lequeitio 27 Jeltzalea 1 naufragatori 6 heredero 1 Ohakune 5 Operou 1 indidpensable 2 metanoíl 76 patrulla 5 McLellan 3 pargo 27 NMR 1 Lichteneckert 1 Nasrin 1 pinhão 1 Nysten 2 Huljic 2 mammé 6 Ovejero 17 heteroátomos 1 Hágase 71 humillación 1 Gurete 3 hibridoxénese 1 Órán 1 Oranjeboom 38 ocorridas 2 Insbruck 1 iranística 4 galgas 3 Faulkes 2 PHIL 2 Persi 1 Inishturlin 1 haubitce 4 nul 16 Ofreceu 1 Gazafello 2 Nkomo 6 Nzinga 1 Hessman 2 pFra 1 KoFax 1 Lycosuchidae 8 fotoquímicas 1 Odsuren 1 Majerský 1 opolos 1 Lepidosirenidae 1 Isotiocianato 160 Planck 10 omnidireccionais 1 inagurárase 1 Jaslene 3 parvipalmata 2 Pausoka 1 irfanview 2 mastigado 1 Legallois 33 Filangieri 63 omeia 1 Glycobiology 1433 igrexas 1 glicoxenolítico 1 Mehoffer 1 MIRV 12 Münzer 5 Opie 3 Kenton 1 Naore 1 Kujo 1 Imperatividade 1 Kaunan 1 gryphoides 13 Lichtenberg 1 Noviales 13 mandibulares 1 Nölome 1 Kupferschmidt 2 Greverud 1 hulseanum 5 Masudi 5 Glucósidos 19 lusitanicus 1 Márkovich 3 Indoram 4 ortosa 2 PANTOJA 3 Mirandairexe 1 jouets 3 Jewels 913 impostos 1 Kyao 3 Lydekker 29 Listado 3 Oenanthe 2 Nariokotome 1 implevit 1 peajes 1 Nafténica 1 metropolítana 29 heroicas 116 monárquicos 1 lávate 7 Lonzas 2 Mahle 1 Landedo 1 män 1 inflatum 1 Kongreß 2 Neiger 1 Jonima 1 Limacea 1 Montesigno 1 Micic 1 monoxéneo 2 Oceanidae 2 Marracuene 1 Mulberg 10 HTP 1 Oddjob 5 Guetaria 6 Nerthus 1 Liata 1 FSP 7 manchiñas 2 léon 12 Mantilla 1 Invernante 1 Mehriz 1 GALBA 3 Marrakesch 5 MDS 1 Flyting 1 orbelica 59 irrupción 3 oligomerizarse 1 Harbouria 19 Foitek 1 Mastigonema 17 MacKaye 1 nigrostriatal 11 Marnela 6 Monier 6 Oudenaarde 3 Ferrão 1 mesenquial 51 lactancia 5 Monona 1 Fattakhathna 3 Landais 2 Marun 13 Moo 1 frumentaria 1 Mendinueta 1 Oilthigh 1 Lycaonia 1 Gornecello 2 Maiko 3 Molwynog 8 Hyrrokkin 1 peditório 9 Oddi 1 Littrell 8 monofásica 4 Malachy 3 mænd 2 Istorie 13 irradian 25 Mendonça 14 Masoliver 1 Mahâbhârata 1 nucifer 1 Lespius 1 Fildu 10 Goldberger 2 Fuentesnuevas 1 Namukulu 1 Moinard 8 impedidos 92 focal 1 Kådisbellan 5 fragmentando 1 Gushandere 1 paloteo 26 Fribourg 1 milas 8 Kitsuki 1 limiago 1 jamaicana 2 Hildyard 1 ofértalle 1 Microvenator 1 pechenegas 5 Olelas 2 Kleiser 1 Ikkiuchi 8 miofibrila 1 Furbaide 2 natufienses 2 Penasgarfas 1 Láhol 2 ?îreq 4 Molk 4 linguistici 3 Inauguráronse 1 perlé 2 forzárona 1 maratoniano 3 martiroloxios 10 hibridado 5 ortopnea 2 Fiord 1 motocultores 6 partiya 1 Odondebuenia 2 fantàstica 1 inscribírono 1 inseidas 2 Lyrik 1 Leptocodon 3 Jingo 32 grilos 40 froiteira 1 Gamerra 1 irredutível 2 Ironie 1 Lumialani 4 Mancino 2 Noveles 1 Montura 1 Pashë 5 metamería 3 Graios 1 favorecíanse 5 Goiabeira 1 holofrásico 31 Getaria 1 MIQE 2 ontoxeneticamente 61 perfectos 3 Hachigatsu 1 lacunosus 5 intricada 1 Inserida 1 hetaîroi 1 Impedida 3 Mendenhall 1 fórmica 1 Ivireanul 1 Frosolone 2 Franzke 9 Monserrate 1 Massena 1 Mevlevi 99 Noutra 2 grammy 1 Komës 1 Latosol 1 lençol 1 Hakkert 2 Nevesinje 3 Magdiwang 1 Novegil 1 Malmi 177 Guillén 4 Pacquiao 207 Naturais 1 Mestreech 1 nDerg 79 graduándose 1 lermodinámica 2 Links 3 Midden 2 ibones 2 Golpeado 13 PDGFR 1 Learra 18 Mitte 1 Gedenschtrom 1 laterise 1 Hogenberg 7 Levoulle 1 luscinia 3 intercráteres 2 Machan 3 Maximinus 1 Menecmo 1 Nawila 1 pexaba 22 galán 4 Folman 1 figliu 12 —os 4 Pestonit 1 Hausner 11 Natacha 1 Longare 1 Perlucidibaca 1 Kuzya 1 gòtico 2 Kitsu 10 Itero 3 Picker 1 Gruwell 43 marta 3 Ituren 21 inflado 2 observemos 2 Mokola 25 impuxéronse 1 kingly 1 leopoldae 1 Geymonat 7 plafóns 26 Invitados 2 Mutanabbi 1 graderios 3 Metaforicamente 5 Plaisirs 3 himlens 1 Février 2 multilateralismo 1 Persinger 1 Inishnacross 2 forestales 1 interxecta 1 Interminas 2 Fursa 58 mecenado 2085 industrial 1 lanceoladosubuladas 1 lioica 1 Femmina 1 phryg 1 Musicalischen 2 Meyriat 2 Hertel 2 Lagache 3 Fanzara 77 Pinilla 1 menandreas 1 Iacobi comezaron 1 kapitan 1 Högfjällets 1 leucocitoclástica 17 inactivada 2 MyNetworkTV 4 flashforward 1 leið 1684 Murcia 1 fumarentos 2 mulares 7 paraguas 1 Gagneux 1 jeant 9 Méd 1 OBISPO 6 insatisfactorias 2 Pacá 1 Jankau 1 Jashin 18 mudara 1 GYM 2 Fermé 52 incendiada 4 Kinsella 1 fuchito 30 Gilliam 6 pescaría 4 Nanne 1 Kammermusicus 1 'haltour 1 Gildea 84 oca 65 levala 1 ozónidos 1 Loraldia 1 Konzil 1 límtite 1 Gbazoa 1 Inhabited 3 incursionar 1 Nuenonne 50 perfumaría 33 Grieg 2 Língula 14 limícola 76 fitónimo 3 lapidarias 3 firewalls 65 Mortimer 4 Migliore 1 Fotolitótrofos 2 Mamoiada 1 Imagawa 5 Harriot 1 PetN 1 Periéxeta 4 LXXIV 2 fenéticos 1 heteroxénicos 1 Karaita 1 Monocultivo 1 patriciae 2 Nerija 1 keinai 1 Iorek 532 Paquistán 2 Naqara 1 otorgaría 2 mvector 1 Nikaria 2 jamesi 9 nicaragüense 1 Geoffroi 101 Orozco 1 Islandpferden 1 Mamadakov 1 irmanadas 4 Gg 1 grotei 1 Platine 1 Guadua 1 focum 9 Igualdad 219 malaio 6 mellea 2 mocedá 9 parasitose 1 hititólogos 1 foqueiro 2 metiladenina 4 Harelik 29 Iacobi 1 Korei 1 metalofone 1 ltzá 1 Jariaíz 3 oncolóxicas 1 Javna 1 hemodinamicamente 1 Monoterpendiois 2 Lujan 59 Falopio 1 Mikolᚠ1 Naoual 8 Perurena 13 Opening 1 Lichten 13 liv 147 Ida 1 Fontanal 1 Gogota 3 Framboeseiro 2 Kelleners 1 Luxovium 4 levaranse 1 Ojerada 8 ñandú 1 Inarijärvi 2 Fundição 567 faraón 1 Legata 2 Lachavicy 1 hizki 1 Kalimotxo 144 Hood 6 oxoácido 1 incapacitándoo 1 fotoprotectoras 4 Paruarangi 7 fastuosa 1 glyphós 1 Forquita 2 Pelagiidae 1 Garmanella 2 pakinoita 1 Fikret 4 mongoloides 1 Mastacani 1 NORDHAUS 245 metálica 8 foliculoxénese 1 Odenberg 15 Hashim 4 pemón 2 pélase 1 intermitências 4 HAŠK 11 Orientada 1 Mediocris 13 Ortodoxas 3 Overview 1 Nagarjun 2 Maxtor 1 Miuçalhas 70 Katie 9 Folke 2 Netjerikhet 11 Koudougou 1 lineaxe 7 OIRA 1 nutricións 1 metegol 1 pertecía 2 microeconómica 2 Homiel 8 Hydrochoerus 1 Papius 1 fomentarla 10 Krone 4 meritorios 1 Ouissan 1 Gradeparda 5 Orthopoxvirus 1 Pétigoa 330 Neil 2 Inclan 1 perdigueiros 2 influenciándoo 1 inflinxirlle 5 interligados 1 Fuenclara 1 formicinae 1 Manim 1 Peperga 1 hal 1 Megáfono 1 Junguiana 6 Helguera 4 orejas 1 Ornalina 2 gwlad 2 ieith 2 Mikrofoto 5 Nichelle 1 Huseyn 1 Neomorphinae 1 Iawata 3 Justinus 1 idealist 1 Freidorf 1 Hicksville 28 fallida 24 Funeral 146 peninsulares 1 lyv 12 frühen 5 peristálticas 1 Inoidea 1 hechados 1 Garben 1 fixeronlles 8 Pensei 41 Naranco 2 Kishkindha 1 ICCINVI 1 macedoniensis 1 monolitismo 1 ilusionados 1 mouth 3 lozi 1 neoidealismo 144 invernal 94 invasoras 1 kumbh 1 Necktar 2 Jufuku 3 incongruente 1 Incrición 2 Penamil 1 Kotoghira 6 ligaban 1 Necesitabamos 4 misericordiosos 1 FILIU 1 Hiendelancina 1 metáis 1 Machliniec 1 Nguludi 1 hanglu 2340 planeta 3 Flavus 1 iluvación 1 pañabra 1 peinilla 1 hiperextensibilidade 81 pegado 1 Marisyen 5 perdéndoa 4 Gauen 6 Herdade 1 PANAVISION 1 Paleontológicas 2 Hituro 1 Itapetininga 1 lasceremo 16 Lavrov 9 imanes 1 Leptachirus 1 Loty 1 Odyshape 1 localizua 2 Impertérrito 2 Paranal 9 m? 1 Gymnelus 17 pedwar 41 Pistola 23 latifundistas 3 LRD 3 Gelditu 1 Fersaliti 1 Kamferboom 1 nanocompoñentes 1 Messolongiou 2 Momoedonu 6 Honchou 1 pentosidina 1 Limpadora 1 oplo 1 pangolóns 15 iliria 1 Gealeargongen 1 Hondarribiko 5 Girgenti 25 lek 3 influido 4 Okkoto 4 Lahun 2 Parapontophilus 1 Meulan 1 ogg? 2 Muntada 1 gabanceira 1 höyöklö 10 marisqueiro 1 haploid 8 gateño 1 Neijia 1 Filicios 1 Pandeirete 1 Nübling 1 morreuse 1 intralingüística 1 Gunnlaugs 3 Glockenspiel 1 luzofonia 2 Hamadeyya 25 Morazán 1 Pettry 1 mehciid 1 Periyar 3 Nordica 1 kniphofioides 1 Maridunum 1 Kikanovic 3 grillos 1 Fuencisla 13 Northland 1 Geganius 7 interdición 2 MADOZ 1 Nastri 12 personalización 272 Lobeira 12 paladín 1 irrationnels 1 Fedorovych 1 Outil 4 Ntem 3 Josmar 1 minutae 2 idoma 2 Garibai 2 Genbikei 5 hospedaxes 4 Lutreolina 2 Musonius 16 Juliano 18 lucernarios 2 Pander 2 oitavado 1 Perpendiculars 1 hok 2 muxeriego 1 PAVEs 47 insolación 1 Médiaszolgáltatás 8 manitil 4 Graxal 1 msa 4 malladores 1 Lavapanos 2 hómoios 1 Lusófono 1 fidele 3 Illadas 261 Febreiro 4 operacionalmente 2 Mullem 1 libev 4 menciónaos 2 oporase 1 IpaB 3 karen 1 Nedved 5 Momoyama 15 mp 1 índo 1 Karrusell 2 goroda 1 fuscolineatus 5 Pitasa 16 Noces 1 Kartuli 8 ilimitados 1 masadera 1 Geltokia 12 idiotipo 1 omeiana 1 fedellando 2 McCooney 1 Kinteru 1 LQ 3 naccarii 3 Oppido 1 Ninfografía 1 OiNK 4 penis 1 Hensojutsu 1 Padruno 2 LEBB 2 Malaguti 2 haush 1 fanásticas 1 interempresarial 15 marcáronse 2 luur 1 Okeigbo 1 Pipínida 1 Peyre 1 nostocáceas 3 Gruidae 25 Landshut 2 lembeyei 1 misísticos 3 Pensemos 5 Lantarón 1 Gatze 336 Joachim 6 oocitos 1 Fiuczynski 1 Margny 1 Jottrand 1 Ki?m 1 Naoumoff 4 Jarod 1 Gundesindo 1 Häser 1 Microsporidiose 1 neutralizaba 1 Kurangun 1 intercommunale 1 Geodermatophilaceae 1 Lucanidae 34 loop 2 Høre 1 Neurótico 8 mores 3 Mauella 8 holártica 34 Ministerios 13 McDonagh 1 Makiese 1 Nogán 1 Kamakupa 1 Kolsås 2 monorhiza 1 Heteren 1 lamprera 1 Mariá 127 Mena 4 Kaji 1 Minima 7 Macastre 4 forbesii 2 Ghi 1 kizhuch 11 oficiosa 25 Iguña 2 jomfruer 2 Landrus 1 hvap 1 immunopoietic 1 Haremhab 19 lactamase 5 hubo 1 Internacionalistas 1 Fhile 21 naza 1 liberam 1 Kluyver 1 krov 1 Moriyoshi 2 faraone 1 mwd 1 Orasului 13 Kart 1 Mikebrown 4 Grido 1 flashcards 3 Pesce 1 Gunbarrel 2 Nyeleni 1 loracepan 1 magnetohidrodinámico 2 HIERRO 5 Masolino 4 Maiorana 1 Kyssen 1 Kobbert 3 plantaxináceas 2 foramontanos 1 NomeDaPáxina 2 Fugitivo 1 Musburger 4 Liamm 3 Lusia 2 Hispânica 1 Monteforte 6 Perdición 1 lectorile 30 Kircher 15 Giddens 1 Jugonostalgija 2 Océans 6 Lemnaceae 2 holoparasitas 1 papilomatose 1 Marxistische 4 phantom 1 Mihanovich 1 notificóuselles 130 petos 10 peliqueiro 1 Mote 1 Gesnerus 1 kag? 43 Perea 1 Kinane 8 Massamagrell 1 madrigaux 2 Gargouille 2 fehacientemente 3 manexábase 1 Merlebach 1 piroxenóides 1 Kalibre 21 mucosidade 1 nubo 3 libr 1 Jaycees 1 Larxe 1 Haldric 3 kunn 1 Nunamiut 2 Homura 1 Kviring 2 Lombiño 1 Mórrigan 1 Mareme 1 Kembar 29 farmacolóxicos 1 Lundie 1 oronda 13 Kodaira 2 fotosintetizadoras 5 manténdoa 2 Kozakura 19 Granville 1 jullieni 1 fletaban 6 Idina 1 plaqueto 1 Paralanguage 2 ourizada 3 Inventaire 91 placentarios 3 padawan 6 ocórreselle 1 Flammekuechle 1 Grossmünster 4 Neneh 2 Nergal 1 Oglodak 1 Jorry 15 Lotería 241 Hospitalet 1 Olov 1 màgic 1 ligularis 3 oubea 1 famanteda 3 Kihara 2 otorgados 1 george 1 Naopes 1 Fauset 1 insulator 1 inmesurable 1 noitébregos 2 gesagt 2 mellorouna 1 námobolos 108 penais 1 miaroseworld 5 muaxaha 12 Flamingo 11 Hermidita 1 méduses 2 Maleta 2 monetarista 6 oculata 1 Innocentium 1 Mootha 2 lycantropía 1 fanteria 24 Peleo 2 maralbaxí 1 Jaworow 1 Gardham 1 glicotransferase 1 mAChR 1 Magude 1 Jumhuriyah 1 gáballe 3 lowbrow 9 orográficos 1 Hirmil? 1 hospedarías 5 hospitales 2 McClarnon 1 perguntades 2 hiperciclos 2 peluquería 1 mutazilí 2 Hermafroditismo 1 Ooquiste 3 palpitar 1 Pithecantropus 61 ignición 2 hawaii 2 Inmaculadas 19 LGPL 1 Lustrationes 1 kink 1 Guttenbrunn 1 Magajna 1 nani 3 Hada 1 Ipuwer 1 operettas 23 marcación 2 Hl 1 lupe 2 Hulley 2 Haliwa 1 neuchâteloise 3 Grindel 2 Franscisco 3 KIDS 3 intégrano 2 Oix 15 hexámero 9 Nacidos 1 makink 3 Kenkyu 1 Higanbana 1 obvie 1 masteleiros 2 Kseur 1 HMMM 3 Kanmacher 46 intermodal 1 Hildutus 1 Friedrichskirche 6 Pijoan 21 Hummels 1 Fendidura 1 kuz 1 Kimberlee 3 Malucos 2 malfalado 2 machis 1 Oestremni 1 librivox 1 Morethia 3 pancatalanista 1 moderaron 2 Maumoon 12 Koro 1 pasadizador 2 Iroda 1 Outigulam 6 Jabor 1 nivelada 2 patensíns 5 Penzance 15 IIR 2 Gaizina 2 glotalizado 1 hypnos 1 Granov 1 Ketti 1 Gramat 22 joint 1 Hoecke 1 Katolski 2 Gattorno 1 Funo 6 Kapa 5 interpolado 13 hangar 7846 información 93 impresionismo 3 gladii 1 philtre 1 lecitidáceas 9 Melanitta 1 moeu 1 melim 2 metilador 3 oos 1 gdc 62 Manso 2 indes 1 Pahawh 1 Hrólf 5 iterbio 1 Malese 2 internalina 4 MVBs 2 interarticulares 4 Ionia 79 macizos 4 Lic 2 lanzarredes 2 Muradás 2 mihan 4 Hayez 24 folliñas 2 halére 1 kisumuensis 66 ofensivas 1 Matsuyo 2 Pece 1 Parlamentär 13 Maritza 2 filtrárase 40 indutores 1 fisisorbido 1 FNa 11 imitadas 19 Hielo 1 Mortadelc 8 Fogueira 58 Kinsey 20 perennifolia 1 giza 1 maniobres 3 Limitaban 5 Marbles 69 Million 1 Katinas 4 Mollá 1 Pasapalabras 1 Maruqez 1 Humión 1 Fitzg 1 Mugatu 1 hidroxioleico 8 Pavillion 4 hina 2 marcándoa 1 Kveni 2 Megalosauridae 2 luften 1 Menninghaus 1 loubán 6 gándaras 1 mi?t?'i 6 Mauléon 5 neuropacientes 228 mosaico 2 Mozárabes 1 familares 1 Kether 2 Pailleterie 10 Jalpa 13 pag 248 mellorou 1 Locatello 14 hortícola 1605 noutras 2 inundase 1 Galkin 2 mgf 1 Hauben 1 isl 17 Hedges 2 Gaizinkalns 3 Kallistos 1 garelo 1 fosfohexoquinase 163 Ovidio 1 Orgulho 179 kW 1 Moussobadougou 1 nuòch 9 Gulfar 1 Padran 25 Momentos 5 Jané 1 Krasheninnikov 1 jagnobsko 1 neurotóxica 1 Pellizotti 3 Partium 1 pantomina 4 internase 2 lactoxénese 1 Jousse 1 participarons 1 Fascetti 1 Japuta 1 Jüdischer 2 Geitler 1 floristerías 2 forzaría 9 Hedreiro 2 Pécheux 1 Ketelsen 3 Kiwala?o 12 Nafís 2 Ortogonal 8 Ketama 1 hungarizar 1 inculpatoria 1 Leovinci 1 pintamos 2 leixón 11 Matarile 1 Forestalia 4 IRWIN 1 Haghia 1 Lodewyck 47 fustes 3 Pardieiro 1 Nakajou 2 Obaku 1 Gicir 1 notals 4 Gumiliov 2 Khvolson 1 isoestrutural 1 Lefferty 1 Molucche 1 foleco 1 Kubrick casou 11 onocrotalus 9 Moià 1 Multân 1 híbrido— 1 Livilands 2 Fungueiriño 26 Marimón 1 klije 1 loteniensis 1 knu 10 gustativos 4 infectoria 1 Flamedramon 1 Murdoc 1 Hueteris 1 HuescaMadrid 1 Llandough 4 Okutu 3 Fiquet 1 Jürke 1 Mbengga 2 Hanratty 1 Maguette 1 koyamae 3 GROUT 3 manche 8 furan 2 Farc 1 Menhyt 4 Paular 1 Gilgun 1 Konchalovski 3 hónrase 143 Milton 1 mancanza 1 omloop 1 NIO 7 inquieto 1 months 5 Masboquera 1 hovuniform 1 hautausmaa 1 Malan 1 Offense 26 Galeguismo 4 fixolle 1 Hurtig 3 Jubany 1 maximinoi 2 Fañch 1 nanofibras 2 Frontinus 2 hotmail 1 Kishapu 400 over 7 keltiberischen 14 financiando 2 nitten 83 Lily 1 Ophiocephalus 1 onfraestructuras 1 lugarteniente 1 halinos—cloro 6 negóuselles 1 filoárabe 1 Peery 1 holosteum 12 humanístico 1 frequentados 14 Herzeg 2 Indixenista 2 Ndzuwani 9 Macready 2 Oryctographie 1 Muong 8 Kanjiža 25 Paxaros 32 fixen 1 phenylalanin 7 orgasmos 4 hidroxifenilpiruvato 12 Gústame 1 GGAs 3 Negima 1 n 1 melloria 1 paácticamente 15 Gende 1 Pentala 3 LaFace 1 Osmitopsis 4 Galgenwaard 4 nattereri 57 LFP 39 haluros 1 Kyoshi 29 Nepociano 9 Filgueiroa 2 Mtianeti 3 maniotas 2 Meduloblastoma 7 moráceas 71 GmbH 1 Lidforss 2 medusoides 1 Panguilef 1 litorales 2 Khwarezmshah 1 hvila 1 McCartismo 298 mariscal 1 Laab 1 Kiniko 1 Pentevr 7773 Historia 19 imprimíronse 6211 Ferrari 1 iktÿš 2 PhMgCl 9 integrala 17 Inger 95 fracasar 2 Gliwicki 3 Orujo 1 lipid 1 Niseema 1 muinoisista 1 Giovo 6 Nórdicos 1 Incineracións 21 orilla 1 helicáptero 56 olas 5 plagado 1 Normans 1 metilciclopropilcarboxílico 6 macrociclo 10 Iturbi 14 pair 15 monoinsaturado 1 huaylas 1 Landrum 1 FECAFOOT 1 garou 5 Kaiji 1 obedeceremos 19 imposibilita 1 HOPEFUL 4 glandulosus 2 Iunior 1 isoprenil 67 inseridas 1 Moraos 2 MEDÍN 14 irritacións 1 mwenyewe 1 Haltz 1 Mislinja 1 Mönchsgeier 16 Morral 11 Margarethe 1 Motusaga 1 Koumans 1 Jawre 4 Librouro 1 inquinas 1 Huberodendron 1 oligomerizado 1 Hobicha 1 katharevousa 6 mormonas 15 Novato 1 múscuslo 1 jiong 1 interaxentes 1 Nyak 1 ?hæl 1 inquiriu 1 Paršuhanta 52 Figueirido 1 peatonalmente 5 meto 2 Ledyard 1 fóronno 3 Jedinstvo 1 Inventaría 1 osnova 2 h1 1 Ivresse 2 mistérico 1 hunzikerianum 1 historizar 3 Modrow 1 Laax 1 Fumea 49 perdéndose 77 pallaso 13 indetectables 1 Kumejima 1 Gaffken 5 Parisiens 1 pianístico 2 Giennah 1 j? 4 hipoglucemiante 1 Förlag 1 Kilydd 1 parvipinnula 2 Gergiev 3 Migraciones 1 lingurianos 4 oncoxénese 1 galleteiro 1 negro† 2 Membranófonos 1 orotidílico 7 megáfonos 1 nAraidi 3 Makepeace 132 OK 3 Löwendal 11 MPc 22 pitagóricos 1 Manusr 1 Matvey 1 Langhirano 1 Giadáns 1 Oirschot 1 Inhibir 7 Heliografía 4 Ibai 1 ORDENANZAS 1 náiade 2 Gianduja 1 Kalpankalá 774 Iglesia 1 Parlér 1 fumé 1 owye 3 fusarium 1 Kortekangas 25 pantanosos 1 McChord 1 kamui 1 Paranoika 1 gènere 1 ilítico 4 hemofílicos 1 Maximilano 27 Mouskouri 45 parados 1 Ledererová 1 Gravio 1 Melyanna 2 inhibirá 1 Ixcán 249 Ons 1 Fromentin 6 Mirande 2 jaloux 1 Haces 1 irriten 1 Helgahnjúk 1 metia 1 mshtml 1 Planetes 16 Nidia 12 Jharkhand 1 Magkaya 1 madrileña— 1 Kailâs 1 Kabulete 3 Freixieiro 1 fulmina 1 Latzen 1 litchis 1 Pilonia 1 Miluco 1 Flavivirus 1 Mathiasella 1 Peñosiños 1 fotosensibilizante 13 low 3 Ourego 1 Norvell 3 oligosintéticas 566 naquel 1 fracturalo 207 paterna 1 Koulutie 2 pasacalle 1 litterature 15 Ortigosa 1 libéranos 3 fotoisomerases 1 Piscopi 3 Kazym 1 Lamut 1 grytman 3 fosxeno 17 marzán 1 láu 9 Nasoni 17 penungulados 1 Pentaeritritil 1 Pistacea 1 Ögonen 1 maseterinos 1 hortifrutigranxeiros 3 Lysis 24 g? 1 Internacionmal 2 glaukos 2 obliterante 1 Grenoblois 1 Merryland 1 Hadjin 1 moonlighting 1 illamente 5 Liñaio 1 MARM 3 heptámero 3 laevus 1 fixéronno 1 Isch 1 Mitzna 2 Humanización 5 Misturado 1 Isinbáyeva 1 mize 1 Llanddaniel 2 Limehouse 3 pitcher 1 Maneuvre 1 ñalbum 1 humanizando 4 ochavo 1 oudastan 3 Katiuska 2 Okeanos 1 kaarti 5 ordeada 3 klx 10 Fefiñans 8 Internacionalización 1 Marszalek 14 lactamas 1 Lomanha 1 Kihlstedt 2 Fuat 1 Jass 1 opsa 1 Melník 4 Orcininae 1 Pinnulas 1 Lambic 1 Garab 1 mostroullas 1 Galbiate 7 leitura 2 Métailié 52 forzosa 2 Hindák 1 Neuwahl 1 favorecimiento 2 Jarjoura 2 NATURAL 1 Pedragosa 1 Lather 13 Paixão 1 Peattie 1 Huascaran 1 LEVEM 26 metralla 1 loei 1 megasonetos 135 Juniperus 2 Malcesine 9 Kungliga 11 indefensa 321 Nord 1 Ghonchí 2 Matagua 1 Pedracoba 1 Kolloquium 3 habsburgués 1 ocorer 10 Lamiales 1 Moslehner 2 Piasenta 5 Lescot 2 labirintulomicetos 1 Ornan 1 Karunanidhi 2 Himuwa 1 Hidroxizincita 2 Francobordo 1 Farfanello 3 Federale 1 Humamay 24 neoplasia 1 Kubrick loitou 1 Národná 236 interpretando 4 Plaiaundi 2 mecrobio 6 Nomex 1 Kurleenbear 1 Lóxicas 20 motoneurona 1 Luschützky 4 landismo 2 Janelo 3 Pairoa 1 Hiddensee 2 Giorgino 1 patenilla 1 Phoxophrys 1 natiune 1 intraeclesial 1 Oloosson 1 Milisauti 1 KANDEL 1 hexestrol 2 lavandarías 1 härd 23 Planas 1 incementa 2 nácura 1 Lubsko 1 miersi 1 Kteatime 17 Napoleónico 1 festejeando 3 Lillebil 5 mixtilíneo 1 gastralxias 20 Mirando 1 kozo 49 Jellicoe 9 marinado 1 fussilínidos 1 Gaxotte 3 Manzo 9 Pentagrama 1 nanorrobots 1 perforásense 1 Lurés 1 Guillemet 1 Gualazzini 2 nombeado 4 mobiliar 2 Helleborine 2 forêt 40 ordinais 1 Helmonts 1 Maldovi 13 pedregosas 1 manina 1 Oírr 1 Macnabia 548 negativo 1 Oamaru 63 latinoamericana 1 FERRAMENTA 2 Ludovicus 1 Hammami 1 planocóncavas 1 isofónica 46 Gbagbo 1 mudeou 1 Kahleen 3 Lauring 1 Petrazzoli 6 Logar 5 labazadas 2 Mups 1 Lapitas 2 Gaulish 1 ostasiatische 1 Limblifter 6 fancines 1 Minimalia 5 Haytham 6 Jutzi 1 Hikawera 2 gianca 3 perduti 3 hidrólisis 1 Metoctramina 5 Lógrase 22 momificación 1 Garmarna 1 joscos 1 Graur 1 marcoou 1 Habif 2 gwest 1 lachmannismo 44 Hicks 1 Holocentrus 1 Khudojnazarov 2 Ngultrum 2 Hummelsbüttel 3 gwon 1 organos 1 juttuja 5 ictiose 3 liberatorio 8 Miya 1648 froito 2 k?esjo 33 medallista 2 Fontanilles 1 goukan 1 fotoblanqueado 1 Munyós 3 Muñecos 1 Galien 5 fotocopiadoras 11 heure 4 hupa 6 Intradorso 1 Krúnk 5 Lesebuch 398 ofreceu 6 Kostka 4 Peronistas 1 Moriches 5 Malachi 1 Heidemarie 6 Minuetto 1 Kunnas 12 partenoxeneticamente 2 Newsnight 10 francio 1 INSTRUMENTOS 1 glaucophyta 4 Lillestrøm 1 Himere 1 intelectuaiss 1 malvat 2 FVIII 1 Noriense 11 incomunicado 4 josephi 2 Goralot 2 Nautilida 1 Managwalah 1 Kutluay 2 interpoñer 1 jazik 1 gabbate 1 Lüzhu 1 officinialis 11 gallecs 2 Mostraba 1 Moit 2 Itimad 1 nagl 13 Medioambiental 2 Léster 2 hierarchy 1 mostrárllelas 1 nife 1 Harman 1 pessima 2 freistni 1 Indicadas 1 PARET 1 Ikedia 1 piacentinos 1 MUVa 2 Maillezais 4 Phyllanthaceae 1 illota 1 paries 1 Kirchenjahr 2 m?k?sa'be 1 Gimileo 1 nomu 8 Für 1 pakshas 1 Hefta 1 Oncocerida 1 Nacella 1 lalalalalá 2 Metildopa 1 Kogaku 2 fructificationis 1 Iperindo 1 Marginados 4 formilación 4 LCU 1 Kurzsichtigkeit 1 Matobo 2 miasténico 27 Gaos 1 iudicarias 1 Heterointegración 21 organum 1 indicativoe 1 Latofao 1 Kelamis 1 inclumpiu 1 metilidino 3 hyperboreus 1 HONYCHURCH 1 Lindar 1 panatería 1 p² 153 mostraba 1 mammiferi 55 leguas 1 frorece 1 Kohén 1 LALIENA 1 Lüft 8 Gidley 29 Montañoso 1 Monodactílidos 1 Maršicanin 1 paupérrimos 1 Kabrousse 6 flèche 2 mesam 1 Myrine 16 flatulencias 2 Mutuurunge 1 munros 4 Kohei 3 Issas 1 Metrocon 1 LDPE 1 Orcomenos 2 Padula 1 Guanartematos 2 Lacedelli 5 Outkast 1 Kikabdidze 1 Fixábase 1 gustito 1 Kovacevich 268 mudanza 1 Madduwatta 2 Papirusa 35 Gardiner 1 PAMPA 1 microachegas 1 Gavanelli 164 marcharon 5 Hardtop 4 Kirios 3 Notecia 4 Gsertel 17 hidrolizada 1 kurkum 4 Nawaki 3 Mesozoos 1 histos 74 láctea 50 Marciais 1 Lapparelli 1 Helreið 1 Marraquech 1 Órden 1 Intef 1 Meysenburg 2 Luitz 1 fréase 669 Iraq 3 Natation 1 internazonalismo 582 nubes 1 Mabandla 2 PBR 1 Gyömro 1 lisobifosfatídico 1 izade 39 Paleozoico 2 Ménem 2 Hungarelo 1 Megadorus 1 Mommies 1 Harios 6 Millvina 1 maquinilla 1 maldecido 66 formarán 6 negacionismo 1 kucuiba 42 Orfo 3 Maliciosa 1 LLuís 6 Hrant 11 Louriño 1 naucrarias 2 Mazzucchelli 1 másfélezer 540 oposto 1 Gollu 1 knistert 1 Gygis 1 Mhean 1 Hughleys 36 formativo 1 microgynum 1 Invasore 1 Falques 1 Pinches 25 Fiesole 3 Griffi 185 IBM 1 Haysi 1 homophyllum 32 PAGE 1 Menage 1 panárabe 1 Moggill 1 Khazri 26 Joop 2 Naifeh 1 Fosfoetanolamina 2 nigrifasciata 2 Matet 3 NIV 1 Fülle 2 pescudados 2 Houndmills 1 Indicação 1 Feafes 8 kbit 1 itroducíronse 1 Iroji 2 Gabriëlle 46 Frings 38017 nas 1 Inspiraron 1 Hameria 1 Nagyecsed 1 Frithugarnis 1 Molodizhne 1 gañariamos 49 papagaio 1 Nanzeg 1 Guichenotia 4 pertenecientes 609 organizar 1 Oscypek 1 Placocheilus 1 Löwit 1 Greystone 2 Herrschaft 1 introducindose 1 guarecer 2 Iconoclast 1 Farauolo 1 inhabilitacións 407 notables 1 Miquela 1 lingo 3 Nogi 1 Frombrock 4 haloperidol 1 Lurettes 1 orixinalidades 2 Lucumí 1 fangosas 1 Geido 2 filtrarase 1 gastæ 2 Navamorcuende 82 oleico 1 Leighin 7 fundentes 57 homenaxeado 1 Melam 2 Neumune 2 Mocquard 1 IfSAR 1 injuria 1 obterDuracionEstimada 2403 logrou 4 hidroides 1 Palumbi 1 katedry 1 Feestmars 6 Mottet 2 Kaben 1 Masquerader 1 Knocknagoshel 1 Papazian 1 malvivían 1 läßt 1 Piccone 12 madagascariensis 1 Heriotza 2 microlingüístico 1 Haidou 1 Hillardiella 1 Imbéciles 14 Jardiel 38 monzóns 2 pilárico 85 lexítimos 1 Hakimia 2 orballiña 61 peláxicos 12 piragua 4 Iranicarum 1 Merloni 1 Iakîn 11 patrullar 1 ornalina 1 mucronadas 6 McAdams 1 hiperinfeccións 1 Lânguido 2 Henkels 1 NAADP 4 Habeas 2 Holck 1 FruitBeard 1 haloformas 5 Paintsil 1 insanlar 6 Muromets 1 monocoordinantes 6 Lexo 1 Natalka 1 lyubvi 1 Machedonia 22 Herrán 30 infartos 10 helicoidalmente 24 Keflavík 1 Kámil 2 nucleosídicos 1 Llangynnwr 4 Landete 1 Modbus 1 nomadean 1 Massés 5 Peixoanes 8 insumos 6 Grimalt 10 Janie 1 Gedling 1 interere 5 Hanss 4 Imida 3 Motezuma 1 Graphidaceae 3 Laç 4 mitochondrial 2 Kaïn 1 hughi 3 Pernkopf 2 manifestándolle 2 Hahl 1 pereiôn 2 Marío 25 kven 1 Koydum 21 fetiche 5 incentiva 1 Fitoestróxenos 1 Kalbelaphard 11 muevas 5 Orbest 1 Geitlin 2 Lapebie 1 Mishkat 3 Musin 1 miige 5 historica 2 ignoraran 2 Marciel 4 Feirdd 1 neurotróficas 1 Fisiomás 4 Helvetius 1 Limburgan 4 métopa 1 Ondea 15 Nupraptor 1 Padwa 1 Muncyt 2 Hessois 1 Otólito 1 Gorostizu 1 Graffam 2 Lanceira 3 Kveld 1 OZOCOgz 1 opphør 5 Kicanovic 12 Karlowitz 1 Ninzi 1 Filamoeba 13 hippoglossus 1 Interposición 1 Hixiénicas 1 Leptathanas 2 Hardistiella 1 Petzita 1 Neuce 119701 ou 1 fiablidade 1 Matilands 1 ladins 1 hipogastrio 2 félagi 32 Nueve 1 hipertermofílicas 4 monospermo 10 invencibles 1 modificativo 2 gamut 2 glorificaron 12 mergúllanse 2 Ocelo 1 incumpríronse 1 o?s?a 12 fidedignas 16 numerada 1 gizona 11 Furness 1 iníciana 3 Joxean 1 listeis 19 Hamad 1 Golsby 1 Iljice 1 musiquiña 1 Kitaru 2 Mühe 1 Mobilize 1 Nocrich 1 multiplicábanse 19 fechadas 2 microcomputadoras 1 Irapiranga 1 imf 2 fosfoadenosina 23 halita 1 Ortler 1 Laage 1 meneur 2 gardaraís 3 Filos 1 metilpirrolidona 1 Fointanebleau 1 Intertuna 1 Narrene 2 Longisquama 1 kiloparsecs 1 Fratoni 1 Offord 1 Pannonian 1 Kwatta 1 Koltermann 1 Kerepakupai 8498 inglés 23 furar 2 Olyvar 2 Iacobeni 32 Host 1 hospitalais 3 Placodermos 76 participaran 130 neozelandés 2 megaplásmidos 1 Hlezna 12 madrasas 2 lifesci 1 Peranema 31 Lusitana 1 Micorrizas 4 Lurigancho 1 passaient 1 Hâgmatâna 3 meinen 592 Neira 1 Göös 1 indesligable 2 lesicograficos 1 Natchae 3 guanidinas 3 Pêr 1 magistrum 1 Petitorium 1 infrestrutura 1 Kreuzschule 7 marchen 2 Helgeandshuset 5 flexuosus 2 ócrico 6 intersexualidade 1 Mingozzi 8 Onak 4 Labiano 1 Milkailavich 1 koyomi 2 Garagardoa 1 Formarían 2 loitarmos 1 Kishin 4 Lataquia 2 hornazo 2 Gracey 1 ferrooxydans 2 Gaitanes 61 Onza 24 Lurdes 1 lacruma 1 Nesquim 16 Nmógadah 1 Haessens 2 Noss 1 Kerelan 3 Oestophora 1 marzocco 1 Millimeter 1 infalsificábel 1 miestä 1 Oresana 1 Feneiro 3 himenóforo 1 inspirarmos 24 montenegrina 1 jim 9 leonesismo 166 gravador 135 ken 1 fluctuaba 1 Manilán 1 Kamoro 16 Loving 1 Jokester 1 Plagiusa 21 nubio 6 lipoxénese 1 Garoafa 4 lábrido 1 Hànshui 32 hutu 1 hoschedei 1 Kopi 25 Isaura 5 keinen 50 maoísta 1 Kaedi 1 Percrocutidae 404 legado 2 Fibrina 1 Glaucocystophyta 1 Föglö 2 iyyat 1 Kirchmann 1 mantéñano 2 Maronea 2 iBoy 1 nahr 14 Laughing 1 Masselin 1 muridun 1 masato 4 Nanteuil 1 gae 2 méridionaux 9588 final 1 Lajeski 1 Kakero 1 Heptapora 163 miseria 1 Hintergerlach 17 Labort 1 hexapéptidos 2 Mopso 4 Iwai 1 lloró 2 Nep 1 Peduceo 1 Niego 1 OSH 8 Girod 3 municipi 2 PComboa 7 Minius 1 Florisea 1 opositivos 304 partidario 1 Muhuvesi 1 iloacanes 26 moduladores 3 Hoan 6 PALEXCO 9 Platemys 81 Gotha 4 Mörling 1 Furcht 1 mercury 1 frandello 4 Lixus 1 intenacionalmente 1 Peshchereva 1 favellar 2 Papadimitrou 27 nomeouna 1 Filolao 1 HPZ 1 Gompo 3 Luisma 1 Ofensivos 9 Glorias 29 OBL 2 formiltetrahidrofolato 2 Nalbant 2 luminecencia 1 Gosu 5 Michener 1 Levantará 1 Mittelpommersch 1 Hardenber 2 Lorisiformes 9 Freyja 29 insisten 38 Parrocha 2 Kurá 6 Frogn 5 liberadoras 1 Ostracina 1 Filatures 1 Kiliaen 1 mesenquemais 2 florecida 1 Lembradadora 15 parasimpática 34 Malley 1 Flavino 3 invitaban 3 Nanotubo 2 Legalizada 1 olimpos 1 Kymenlaakson 2 Haditha 1 Mantak 2 kotar 8 Odilo 1 FVG 1 Gotcha 1 Hunahpú 1 Mahendranath 1 Glorificámolo 4 Konets 187 Odón 1 incrementáis 1 financioulle 1 Pinito 1 kraja 22 Gisbert 2 Gogan 1 Giurau 1 Mahanoy 6 Hertford 7 lide 2 pescanova 1 Isprinsessian 1 Luigs 36 Muiño 2 Palera 2 Orodreth 1 Linociera 1 Nieuwenhuizen 2 Hladnikia 1 pátinas 2 Karabisianon 1 Federick 1 Pelegrins 12 Híades 261 Lobios 1 mioepiteliales 2 Petrillo 4 Fundación Miró 1 Kokei 1 Huigobio 1 muff 1 Parkinsoniana 1 Piesek 1 Luchulingo 2 Piscataway 2 mediterraneum 9 Partita 1 Nezhdanova 437 marchar 1 falli 5 oraba 7 numa 14 Hakata 1 Oché 4 Gimni 2 Muntanyes 83 ostras 1 Fonzworth 157 Master 1 Gehrig 1 Landesgeschichte 1 Myshlenie 3 oficiouse 1 Irado 55 Oural 6 Hokusetsu 2 Muhavura 257 linfáticos 1 hetasílabos 1 hipotraguino 22 Isernia 1 fyrstu 1 Kaijin 21 octosílabos 28 Lombard 3 fumus 7 marwnad 7 Muroidea 4 gametogonia 7 Lindes 1 Hagui 1 Namgeukilgi 21 lombos 1 Mosiah 3 okupación 12 frutescens 2 kadiwéus 1 Gardouse 81 Nogueirosa 1 Paelinck 1 hiriq 1 Isomerización 1 Münsterschwarzach 1 Kobacek 1 Mutatis 3 Kellii 1 Harriague 1 loud 6 Mainichi 1 Koromon 3 Lounds 1 miyata 2 Hypholoma 1 Gutanasar 1 Mightor 135 maxilar 1 lidaron 52 Fundação 1 Liuto 16 historiados 6 Garoña 1 Letcher 9 Oreña 74 infinitos 33 infrutuosos 1 funsai 7 militará 5 Furancho 5 faroleiro 1 MANDAZER 5 Festín 1 nisso 9 pierre 2 gutuater 46 Millar 1 pennnachio 2 hrafnar 1889 ideas 6 Pervez 1 idéase 123 impresionista 1 fustrigaba 10 Iaguelónica 1 Pásate 1 Moyu 1 Keon 1 Nothronychus 2 Nawal 3 itens 2 injustice 1 Irukurutzeta 1 irreprimible 1 GROPIUS 2 hioscina 1 matosinhense 1 Lasiospermum 1 máquina— 4 mesturara 1 haitzkolari 10 Mechnikov 1 Planetis 19 Penide 5 Ghulam 1 Krawatten 20 Pasto 1 Irima 5 Jeannet 2 novedades 9 mamma 1 luzonensis 2 hipoapnea 2 Gallegher 1 NETiquette 36 fero 2 Insignias 1 ígualmente 2 Opacus 1 Kusumapura 3 Glomerulopatías 1 Lizier 1 Isargas 4 FEPA 2 khaganato 2 Finalizados 1 Nauthólsvík 1 Gourmaz 1 lapillis 7 Pisin 28 maenas 3 go 1 pagés 1 Margori 1 Nablus 17 mostroulle 1 litoestratigrafía 19 Frascati 6 foetidum 2 Gorcey 3 farmacología 1 Morua 1 phthorá 1 Königgrätzer 180 observados 1 interiorizaríanse 2 Nyons 2 ilegaliza 2095 materia 3 interacciones 2 freen 1 Lukomsky 38 morfoxénese 1 mohicania 1 paririades 2 Peeta 4 glíptica 5 Karamoja 30 Ivano 3 orquestrados 1 Katzbach 1 Kaikutarra 60 meteorolóxicos 1 ogen 1 Mrr 11 Gex 1 mousiki 5 Musté 1 Galluzo 1 Nann 3 Hanahan 1 mirotz 1 Irmanciñas 1 Kromkamp 1 parquizarla 19 Nasal 5 Funke 1 Mowaten 2 incubatio 1 fluorescence 5 fiadeiros 3 microcolonia 1 pautados 2 invertíbel 63 Jenna 40 pedazo 2 Malacologists 2 Immobile 2 pauperum 1 Pajusi 3 Katarain 1 Panaeolopsis 1 metastasicen 1 ferimento 6 frag 2 isención 1 Haukipudas 1 Grooming 1 PLACUI 2 Honaine 1 Jatilla 4 movimientos 4 insuflada 2 Glogovac 1 Kleveland 1 nomeedes 13 Kad 1 ObjectLOGO 1 fluen 4 fingerprinting 1 Fedrico 26 Paoli 7 Korver 1 Iloaiei 1 Legbiter 4 Pericot 4 parrafeo 1 Minnaja 1 kestosa 3 Luxuria 1 Kétesso 1 parabén 63 Intifada 4 FMXD 2 Güyuk 1 Gormond 1 Otpor 8 Mahavira 1 Feuersteinaxt 1 Incruenta 18 Ligi 4 foma 5219 partidos 3 Manchots 2 instructio 1 Gopi 10 mitificación 6 Maluenda 1 Hofstad 9 Hy 1 PERPERCIT 2 Guimara 1 Labroux 3 fútbol español 1 Mitrofani 4 Grumbach 35 mandando 7 neidot 1 pickettii 60 Jurado 2 Haloxenación 1 nevarisca 20 gardería 20 licuado 13 Foción 1 Kyanita 1 Muhai 1 Niesink 1 Jagot 4 Hickory 6 Hide 41 obteña 1 Incuba 2 Geooff 1 idurar 2361 Pazo 2 Marshals 1 Kopaniewo 1 näytelmä 4 Kinyeti 34 Moor 3 Kaiserin 1 nicholii 1 organices 3 Maczek 1 Medugorje 6 Narracott 1 mordeuna 3 Kiesler 2 labializadas 1 nbx 27 Konya 4 Ozama 1 Lipoproteina 125 Groba 12 Maxín 1 Gertfred 2 Lardjem 1 Nictaginácea 1 Graighre 11 Massieu 8 infinitude 1 Lín 9 Jamil 5 Godet 33 ofrécense 1 generiques 4 florituras 2 Gutkin 2 Intercepta 13 molaridade 1 haxor 1 Kretschemer 1 jándalo 1 Naozumi 3 melios 2 Nikaia 1 Kerio 1 Mboekak 2 McLendon 1 omnisexual 60 Jordana 1 Gardoni 26 Patel 3 Navosa 9 fomentadas 3 Lachin 1 liboense 1 Lewinski 1 Iræn 2 nitrosilos 2 Folium 1 Kossil 3 Néveda 8 pensantes 1 glówny 4 Kuldigas 1 microsites 3 Ilícito 254 Mouriño 10 Froissart 1 llócara 2 Ladoeiro 1 Jambulat 3 LBP 2 filharmónico 2 Herido 2 interpretaión 1 Nicomède 1 Garinei 1 peloponesia 14 Metionina 2 Majesco 1 Lasaosa 4 Maiestas 1 Itaimbé 1 neodarwiniana 185 pesadas 6 Invicta 52 Peace 22 Jumeaux 1 Nelsón 1 Moržin 1 Hermoza 28 olivacea 1 nicolaesberchem 1 leukôlenê 2 Farah 1 'gæn?iz 32 Ning 1 Norcontrol 1 Offenen 1 Massú 2 Olmundo 2 manifestaran 11 indesexados 2 Mante 1 Infecció 26 Massey 2 Kârum 1 Llansa 9 Parras 4 Litauischen 15 Parmalat 1 pausi 1 impactados 3 licúa 9 Ludi 1 FILICARIA 1 Lazonafilms 1 iltirk 1 jumonji 4 Haussman 1 kilociclos 1 iliolumbar 3 Manzonia 1 Kiet 4 Hickel 1 fatados 1 Flossengeschoss 2 Hydrodynamics 2 Kamishev 1 Ordenan 1 Nordegraf 1 Muzeul 16 individualizada 1 Gandz 1 Kyouda 6 Friedhofer 1 Jianpin 1 flogra 1 ixiophylla 1 Mesylate 4 mesturándoa 1 florenskiite 1 Kierszebaum 1 Mylocheilus 1 lideralos 1 Implícase 1 flunitrazepam 1 Mantecon 1 koff 2 pasamadión 2 fenfluramina 41 Inclúen 1 Fictitious 1 Isusi 1 Fusionados 2 Photobook 4 Gonçal 3 MICAS 2531 pasar 2 huidas 6 Køge 1 Piriápolis 1 pilluelo 480 Menores 5 Nação 1 faraona 1 Márketing 4 Muramvya 1 Phonicoccus 2 Navacarros 1 marcharemos 1 MIRATIS 11 Mucosa 1 Mayyafariquin 1 Katahajime 1 Montrigiasco 3 herdárense 1 Peptona 1 Mycin 4 groserías 1 LOFT 33 Khomeini 1 Oššaié 1 ownegyon 4 Mosteiró 4 novaeseelandiae 1 petrificó 2 Hatria 1 Leptodon 1 Mittwoch 12 PiS 1 Multilvera 1 paohsingensis 9 Melghacho 1 perturbativos 1 Huetiris 7 leucocitose 77 fosfatidilcolina 11 Neogramáticos 2 Neutros 5 Pistoiese 30 Haberá 3 Jordache 1 gefundene 1 MKC 5 louras 1 investíu 9 Nandulfe 2 joder 40 Lies 1 ictérico 1 fileteados 1 Koreander 1 famantada 3 Landaburu 6 guaraníes 3 metilurea 2 Mylenium 1 Maquinismo 1 Nyokimon 1 migrañosa 3 Havemeyer 1 Inveruno 3 Izvestia 4 leunos 2 Guillelme 2 Nonante 1 Lagomarsino 1 Febeiro 1 Lupercal 1 fluxu 5 Intervisión 25 latrans 2 honoraba 5 Loural 17 Fotosíntese 6 Fuligo 1 Hellish 1 GWX 4 Lanuvio 4 Pathways 3 goral 5 kauris 3 Nulles 2 Kimé 1 pasturas 1 Nessen 10 Fredy 49 memorables 7 paneira 198 Plantas 2 Nemalion 2 Isotope 686 Nesa 2 Grine 1 HERR 8 Grelos 1 fotogramétricas 1 Huntigdon 18 Loisel 1 Moexmu 3 Piedimonte 1 Mandarinas 8 Kavieng 503 mostrar 2 Hikmet 22 movéronse 1 Kanchenxunga 1 Mistrovství 4 ortofosfatos 1 inmunoestimulantes 1 pe 2 Mattson 1 Pirose 1 incassable 3 Kalinovik 2 parifoplasma 1 Pillersdorf 2 faltarlles 2 Plastida 1 Menconico 4 Fergusa 4 incorporábanse 1 Malapane 20 Gorgullos 44 Hawking 2 Hassell 2 försvann 1 Jayasinghe 1 ornithodelphes 1 Massueville 1 gü 1 heterochromia 1 Havelik 55 innecesario 1 Macandé 7 Jesulín 6 Gorostidi 1 Hastin 1 Minkailu 4 Otopeni 1 Permanence 13 Maid 1 Ipecap 1 Ipsala 3 lomvia 4 Kristiansen 4 Gadu 1 Marlênio 73 nicotina 39 Kyuss 7 inscripciones 1 Olše 1 hirsutiusculus 2 Liberace 8 McSorley 3 méthodes 2 Insulza 51 macrocarpa 1 Gondreo 14 Habyarimana 19 guindar 2 Nobílior 6 juçara 4 Ménagier 2 glicocola 3 HiPIPs 41 Gainsbourg 2 Fuembellida 8 Hyper 2 Kelehan 1 firulete 5 Kojak 1 kanaresischen 1 Ortographia 1 Hadakajime 1 patrimono 5 idóneos 10 impactan 26 ks 1 LITE 1 festarolas 1 iridioides 3 glacés 2 Nonoma 1 joke 4 Manicongo 1 kæstæri 3 métea 1 melaninogenicus 2 maceracións 9 feloderme 14 Ossian 4 ?Iolani 14 pbk 1 percórrena 7 metilmercurio 1 Mandiás 7 igreja 2 Noizpop 1 núicleos 5 marabillados 1 Navigajosi 1 Guadamez 1 pisica 1 Friameira 1 Ichirouganaim 9 madeireiros 1 Ningsia 1 Malkara 11 ordenacións 1 Geremía 2 mativo 2 Manderaggio 7 Orchies 2 insuflara 1 Kbely 17 platónicos 5 nf 2 mne 3 Ortona 1 LaMonte 7 miliaceum 1 Madias 1 Giljan 4 Geistliche 1 PKNS 13 Katsuragi 2 Novanca 1 Haakonsen 1 Kamitonda 1 Insoportables 1 lecto 3 Ormal 1 Kempenfelt 1 Nattis 1 Kebangkitan 2 lacres 2 Iconos 5 golas 1 Moet 1 Meidän 1 glaciolóxicos 1 Machiavel 1 gwaga 1 Licencias 7 FECIT 1 Pedregalejo 21 Pied 1 incorporarase 1 matematische 1 Mvskoke 136 fetal 3 mundiño 60 Molecular 1 Frizante 1 femater 1 pláneos 2 Lazarea 1 Keding 3 Ninlil 2 oubeo 5 Orrio 9 LHD 1 habitu 1 Pejeta 5 multidifusión 1 palomita 25 parecería 11 Kinks 8 Landoria 2 Mägdefrau 2 Fishburn 19 gastando 1 Intxaurraga 2 L?ng 5 palotes 5 Pahor 1 Golongan 1 Kraljic 15 Infraestrutura 1 Osiris foi 1 Morge 1 McPaint 1 interlaminar 405 Inclúe 2 Latrún 3 Parsley 1 Paintbox 20 modais 1 Feuerthalen 1 ištrauk 4 Mediterranea 1 Maturitas 1 Gallitrichum 2 Morfovar 1 leucoclada 2 LOX 1 masculinizan 1 Pacianus 1 minxar 4 HyperTransport 4 Meonia 1 funciional 4 Girotti 905 oral 4 nematocistes 2 Pesebre 22 invariables 33 GS 42 Fury 2 gRNA 1 Magalli 1 Gerdemann 5 peridotita 2 Gishernerë 7 nám 1 mastós 1 leptomeningite 2 Jeumont 1 Pèlags 1 Lahic 1 kurojnæ 1 Menodoropsis 2 manicura 2 flavigula 7 Hallman 7 ky 2 petardo 4 Motupuakaka 1 MWs 1 Padel 2 Misèria 5 Masindi 2 pinnadamente 1 Lagenodifflugia 3 GRB 1 Nomikonda 2 litiación 1 Keplersche 1 Felline 1 Linotipo 1 Metchley 1 Pijatonttu 1 incomodaban 1 Oblongo 3 Mapumai 2 Lisia 1 Maletí 1 osorno 2 Fundamentals 3 impedíndollo 13 guindastres 3 Phae 1 GWP 1 Literaturasa 1 împaratiei 1 Okeho 1 hooperiana 4 parterre 1 hipsofilos 1 nito 1 FPUs 2 mecanísticos 3 Hopeless 1 Kosva 10 indiscriminadas 2 percursos 1 Mortoniodendron 17 pirimidínica 19 mesturáronse 2 Hams 1 Gathar 54 Mehmet 1 Kirikava 2 monitoreadas 1 Liceum 1 Franquelo 9 modisto 1 Middlemarch 3 Gruffy 1 Frankiwsk 11 Galib 21 OAS 1 Farmacovixilancia 1 nroción 1 Ginebra e 27 Piñera 259 mísiles 2 Pífano 2 hermida 1 Mbañe 18 Lido 1 Kviabryggja 9 Gat 5 Inky 2 jas 1 ocnsiderablemente 1 impactarían 12 lévame 1 Pintubi 1 gelata 5 Hincks 2 Nakhkhunte 34 ocas 8 kru 1 Jbeli 22 inconstitucionalidade 3 Mahlberg 1 Izïa 2 Hidronio 2 languidamente 1 morabitinos 2 nomecacharro 2 Madrí 2 Muiredaig 1 Pathfoot 2 MacQuarrie 1 Indoors 1 pelandrana 9 Kotlyar 6 incluíren 14 Fizeau 207 Lozano 2 Fenil 1 Giribaldi 1 Heptonolactona 1 miofibra 1 Krusten 1 pintarraga 4 lujuria 1 Goughrane 1 Gaudos 1 Örgryte 1 Hamikdash 1 Kavalas 1 Giedrius 5 obreirismo 1 nakakaintindi 2 flechazo 1 mesotemperados 6 Lavallée 1 gueroy 1 Gueghrane 22 Fontenay 1 Goreopagurus 1 petersdom 12 fotodinámica 53 kaupunginorkesteri 102 formaren 1 Feytiat 15 Leguizamo 2 Marja 2 Heterocrypta 2 Howser 1 Kruize 21 Mengs 1 gianni 2 Hally 1 microsinalosomas 1 Planomerista 3 Neumarkt 13 Gaze 2 mening 1 Julja 3 picassiana 1 phalanges 1 Monteser 1 Oelun 1 outorgandolle 1 hipsófilos 30 galardonado 1 Ngunaitponi 1 Microsporales 2 Joren 13 IRFU 2 Laloy 2 myself 22 Mattias 1 maaku 2 Mönchaltorf 1 Oostkamp 4 Kullander 1 plasmacitoide 2 Gönc 58 liñais 31 Mollusca 2 Heynemann 1 Gudarovis 15 ilerxetes 1 Jugatae 1 platáramos 2 Lectureship 1 Graveto 2 Gonduíno 1 Peppina 1 observadoras 5 Limann 1 Holunder 1 grabaciós 8 isamaa 3 multidisciplinaria 1 GhostWriter 2 nulicigoto 1 Heteromyidae 1 Kwlhwch 1 kameleon 2 monstre 2 Mion 5 Gravadora 3 paroxísticas 2 Maungakiekie 5 honda 2 Kalokuokamaile 2 fanal 3 llotja 10 Infravermello 1 MacClumpha 4 Kairuan 1 Genfer 7 histónicas 2 Mongghol 5 mercouna 1 laperrinei 2 NacementoEumeLandro 1 Grishnak 2 Naraggara 1 Gwel 3 Indonesian 1 pichisermollii 24 planctónicas 1 Karku 1 MUF 1 Immenstaad 7 folklórica 1 helgast 61 Luzón 1 Habanero 1 mencionarllo 4 grossularia 2 Iroqués 1 nevesidade 2 Occhipinti 1 Ortel 1 menorraxias 7 moravos 1 Orkiestra 1 Finncomm 2 furtando 1 Lusarreta 131 Gould 1 Odysséas 1 Kas 2 orvallo 1 inactivala 1 Nomeará 1 pachyloba 1 Lutropina 1 Nuwás 7 matic 2 glucóxeno 4 Niederlausitz 36 ocasionadas 10 Manziana 3 Nakens 1 licenciuse 2 Giluwe 9 involucraba 7 farinosa 1 paysano 6 Kaulitz 1 Hitobito 5 kallis 4 hac 2 GCXO 1 Hinojedo 8 Moute 1 piloteaba 1 Mekhadma 3 Peteiros 2 Hazelmyer 1 kráb 1 golfmino 8 lege 1 Nigaku 1 Mastrizado 1 pesuntos 2 lepidosauria 1 Iyman 1 outotno 1 farfalletta 3 L 2 Fratautii 1 Pallavaras 1 Frikat 3 Galic 2 HsdS 5 mendelianos 1 Kadlin 3 Leana 2 jiaozi 3 haxiónimo 1 Peece 1 obxecticos 1 Gandras 1 infeior 1 Grigoriou 2 inmoralidades 23 Lemona 1 pesarde 1 fosilizaran 1 PirelliInternetional 1 fuxia 7 mencionase 1 fidalguiños 4 Ixikari 1 Guéoul 1 Melanoperdix 1 Peñes 1 INTERPRO 1 Imprevisible 3 Persky 5 partrir 7 LMB 1 Mbonyumutwa 1 Noojisan 1 Imbala 1 Kiriakula 1 Intimidade 1 hautanyel 36 Luso 1 nativistas 2 impactaba 1 liberounas 1 metastisados 1 Llucha 120 matrimonial 1 Otemae 1 kishnasar 15 Litros 1 paracelulares 1 hurras 1 hutsik 3 houyhnhnms 3 manteis 157 pistola 3 pellegrini 1 Paczek 1 Gelandri 28 Khaldun 25 fé 1 iuspoitivismo 4 Matira 2 Follegada 1 Khaltoyarish 1 misteris 1 Matchas 2 Niccó 5 merdeiro 17 Phanom 1 gus 105 fixan 7 Kone 2 kelpers 1 Navy e 1 Participazio 2 Lotharii 1 Jwarizmi 1 Ostipo 2 Kentaurus 11 Guadiaro 1 Navrozashvili 1 ibertador 2 lupulinos 1 Ocorréraselle 1 Paadi 1 legalismo 1 homilética 23 ordeou 1 Nachtwacht 1 handler 2 Hoogstraten 25 metanfetamina 1 géopolitiques 1 fugazi 1 gonagasriika 4 gauchesco 1 Myospalacinae 1 ICLC 225 May 1 hidraúlico 7 livres 1 Friume— 1 gouqizi 1 Instruciónn 1 Goldsworthy se 1 Madngele 2 Ihá?kt?u?wa? 1 Pantazis 126 municipalidades 1 Gjemt 1 Hwuanin 1 monaka 7 Mihama 13 Giamatti 1 FENOTÍPICOS 1 gizonik 1 Garimpo 1 finiais 1 Penduran 1 hoshinae 6 HAPAG 3 Janela 1 Horwood 3 osteonecrose 1 Matacandís 1 Formigator 9 fibrocito 1 Glymur 1 louvalo 1 Nadim 1 Fflur 1 percataron 8 outoniza 1 iceportal 1 matrilocales 732 galería 3 marmulo 1 moren 116 Ferrocarril 1 Huaynaputina 2 oríxes 1 ficocoloides 33 Motivo 1 igualaranse 3 linfopoese 3 Nakadomari 9 Fundadora 2 incumpridas 1 lázuli 2 Gouldia 1 Mompracem 2 Krestý 24 love 10 OrCAD 8 Haver 1 malía 1 JeromeEmiliani 1 Medallon 2 Koyamada 1 interviñéronse 2 Gieson 1 Moglena 11 Magnànim 1 fitábanos 1 Gepiden 1 Kenik 1 Haania 15 Parrado 2 FVESES 1 linapacanensis 1 Isshiqui 7 fixábase 1 Mangarongaro 5 iugoslavista 1 ionica 3 heteromérico 1 Frejas 5 occidentalizadas 1 Gundesheimer 4 Galanes 1 Kalkar 1 Illina 10 Galeorhinus 1 Mécanisme 4 Kythera 1 Pidemunt 1 Famouz 1 Munchh 1 Marielena 1 iqual 1 leugnen 12 Numerario 2 ghastaspista 1 moelle 1 Pínzio 2 MPEI 1 multifases 2 Freer 1 gratuza 1 orfano 5 Fisioloxicamente 1 losalbuminoides 1 Noctilien 35 Goscinny 2 Görries 1 Ordovicos 1 indeducibles 1 grávana 1 Gaviola 1 Openaki 5 orientativas 1 homoblásticos 3 Oleiro 7 Leóš 27 Nissl 1 Óspakseyri 1 perse 1 Humilladeiro 1 neerlancesa 1 ks? 1 Oremos 11 feniano 4 Hónved 61 pescado 1 Hoedekenskerke 1 GANAB 1 interdependenza 57 Kitty 2 Petrolul 6 Jinfengopteryx 1 Otakamori 1 ondeantes 1 Lebowitz 1 oliveroi 1 Junqali 5 globicefalinos 7 glicoformas 1 Laxamýri 9 guanilil 1 Grandperret 1 obedeciades 2 Kersner 2 pitado 1 meciona 1 Mecobrio 1 Heynhold 17 Molero 2 Planiplastron 1 inxectándollos 1 feraz— 3 Murinae 2 inicializamos 1 Mizrana 1 Karapanos 1 hiperactivas 3 Kokuen 1 mu?afa?ah 36 Herculis 7 ovatidoxénese 2 Landru 1 Kendira 1 Généalogie 11 Oghuz 3 mantena 1 insinuante 1 FRANGOSUL 1 Phtinosuchus 10637 guerra 5 personnes 1 Penetrándose 5 Gârla 1 ?a? 3 Izé 1 Hijona 6 Medak 12 Maebashi 1 Pistono 2 Foundry 1 Madjunsko 1 Lionhearts 3 Montegre 2 lembras 17 identitario 1 pékinois 123 microondas 1 Peripandalus 13 LottoNL 19 Oyama 1 fornecíano 2 KIBO 10 inestabilidades 1 Filoxeno 4 Mecanoscrit 2 NRY 1 nenote 1 kolgeh 1 Montí 2 Jaufrä 1 Merviel 2 pazopanib 1 Guiberti 1 libertouno 1 pendulicarpa 1 Görris 9 Fallaci 5 Huma 2 Libelo 190 Mohamed 1 oiredes 1 ñasco 11 GKRP 1 Gerday 1 meó 1 Kailek 2 Megabytes 2 Gentilhomme 1 lanilla 3 gozarían 1 Kijima 23 Karakorum 1 MSZMP 1 opdenboschi 1 koani 1 inarticulado 1 operábase 1 Kinishe 1 handi 1 pernoctaran 301 influente 1 Ladín 12 Felber 1 levantándoa 2 Papitu 1 fornicadores 1 Navini 1 Montory 3 Merendas 2 máthema 2 Kertabir 5 Menopausa 1 Mientes 16 Hrebeljanovic 49 não 1 Iochrominae 1 jinkaku 1 Jadot 3 Liath 1 Petrolífera 5 ?Francia 1 Petritsky 1 Mabeta 1 laberintiforme 1 Mokosii 1 Gianello 1 Ferrá 1 ofrendas votivas para 73 Giraud 3 novobiocina 1 moton 26 ien 13 Jrushchov 1 Fosbucrá 2 Goodbody 1 Jornais 2 Globetrotter 1 krivici 96 fazañas 1 indicarannos 1 metastasización 1 mantenendo 2 Petrᚠ1 Fungeoides 1 megámetro 3 Ianthasaurus 1 hipochlora 34 Gandería 1 Pharaonis 1 lourón 34 fueron 1 Kjeller 114 Introducción 2 Ngum 1 locativas 1 Frondosas 5 Joely 1 Megaville 73 Matos 5 monacita 1 Monfurado 1 Gavrus 17 Playfair 1 Flacher 2 noemática 3 Ledeni 2 padrastros 1 mivacurio 2 ladín 7 Fastenrath 3 Phaeocystis 2 Hashepsut 4 hemeritrinas 1 ninos 1 Landrover 1 Maridjabin 1 Kuarkx 2 paquicefalosauros 1 Nanosail 1 Kihon 1 frühbürgerlichen 28 glosa 1 Ninive 6 Microthrissa 1 Pilulariaceae 1 gallorum 17 Ferté 7 Hatohobei 1 Houttuyn 1 parenthesome 1 medesima 1 Lusong 1 Margianskoy 5 ITGAX 1 köpek 1 kunnan 1 femenia 3 Listeriáceas 1 Horodlo 1 Handbooks 4 Methedras 7 Lofoforados 6 interrumpida 1 ocratoxinas 1 Koiné 8 Maman 51 irritabilidade 1 mancjhas 8 Marullo 25 lucrativos 8 melanesio 1 parent 1 Onwards 1 Galler 8 Plantagenêt 1 Lupocyclus 1 hóminidos 3 Pinifarina 4 paddle 1 pilidum 1 harkrank 1 Jautz 6 gametanxios 2 llibret 1 perpretrado 2 H?i 1 Haniel 20 norteamérica 5 ovatus 1 Nitrowski 1 Ouang 4 Haparanda 1 Gwalchavad 1 Pardavela 13 KN 1 Mayaguduna 1 pachyloma 1 Lacillo 2 Jamuga 2 Gittenberger 1 femelles 6 Nuzi 1 Phyllocopus 2 Khairt 44 impoñen 1 neugriechischen 1 homosilabismo 1 MonteTaboadela 1 Mondrões 1 paraneumónico 2 Glicoesfingolípidos 1 Hardenberger 4 hexeno 1 nederste 1 Melendo 1 insomnnio 3 Oyamazumi 8 PDNI 5 Huguette 1 galan 1 oreig 1 Oprichnika 1 phenomena 2 Llao 3 filu 1 multithreading 1 Myrceugenia 5 Goux 1 Kanam 29 holocausto 11 Godina 5 MacDonogh 1 Meterse 1 Hipermetrope 2 oncostatina 1 Mackins 38 Infraclase 1 Macédonien 80 perro 33 Felip 1 Ostracum 1 Fernandiño 4 Izmir 273 name 2 Mesocarpo 3 PHV 28 paseriforme 1 Iskender 30 mollada 3 Medeiro 1 Konge 3001 Lotus 4 hbk 1 Meneácretes 38 lidas 1 marégrafos 14 Fiães 1 ghw 1 Komki 2 fermée 1 ollalo 2 Marosvásárhely 3 mostreados 2 ghilzai 3 Limberský 1 Hastapenak 1 'no? 2 Notarchinae 22 labortano 2 Peypoch 4 Odete 2 Marabú 1 Infundirei 1 Greziako 1 meister 1 Kaiserkeller 1 MayoClinic 1 Negra?i 2 glosaba 3 neumayri 28 Gouxa 1 LAURENTIU 3 marismortui 1 Obvia 228 Latinoamérica 15 glass 2 Galiwin 12 pilares 4 Forel 1 Fyb 1 heterogonia 3 Pellington 2 ke? 19 framboesa 9 mandase 1 Meiring 2 Nanaimo 1 ortigues 1 indestrutibilidade 1 instábel 4 hostelaría 1 Mecanízanse 7 petróleos 43 Pallota 1 Mramor 1 Graic 2 mesarco 1 Messala 19 Festina 1 OGX 30 Orientales 1 Lesažem 3 Mink 1 jorda 7 plasmodesmo 1 MICHOACÁN 1 Lamduan 1 hipoinflamatorias 1 Inalámbricos 2 pauloensis 1 palestinensis 1 Mirus 11 farándula 2 Lowrider 1 Linnida 1 hidropatía 8 Iahvé 1 ofrececeu 1 palaeojavanicus 1 Oxidados 1 Famines 1 Olekóvich 3 flanquear 1 Magwe 1 GaliciaDixital 1 Kharish 2 Miraculum 1 Logograma 7 lobosas 27 multiplicada 1 Peiteadores 1 furg 1 Langis 1 Livs 1 Kirghiz 3 Hakkenden 1 Glière 4 ofrecementos 3 noctámbulo 5 Meaney 1 neuropreservacións 1 Labacolla 1 lipidados 1 parsu 1 naselje 10 micela 2 Mexilloeira 1 Kramgrasse 5 Ostertag 1 Klemensker 1 Hornaday 11 Feuermann 1 Kiyoji 1 Fasoúlas 1 fantástcos 19 finxe 15 Melekeok 1 Pedagóxiga 8 Inuktitut 3 hetman 5 INMS 2 pitagorismo 3 Marquesados 2 lambdoides 7 Morbo 1 gâteau 1 hedge 4 Indis 2 ostajnica 1 farer 1 Motì 1 Jermi 1 PartosImperio 1 Ouroussoff 12 plaquetario 2 Lipowsky 1 Lorentzian 1 Plaice 1 pinceles 1 HSPA 1 Mülle 5 IML 1 leucomelaena 8 pilotes 1 hectosegundo 2 Odonata 13 Jat 3 lavadeiro 1 geody 1 Koulouris 1 Nakra 1 Misserghin 1 JunoCam 1 Khafizullin 33 Hogar 2 Mutafian 2 Marka 1 Panchaea 1 Kiefermäuler 20 materialmente 3 Huskvarna 4 Hedradas 1 moving 1 Fíate 1 Laterne 11 incompresíbel 1 Fischlham 1 Gašparovic 1 Jirbe 6 homenaxeou 4 Majewski 1 hermeneias 1 loreenamckennitt 2 Nemausicae 1 phaeus 1 PERKINS 15 intrusións 4 hoteles 16 opoudjis 1 fluoresceinada 2 Masci 3 IARR 13 Millers 1 Gherta 1 perención 1 mudrost 2 Magyarok 5 neoexpresionismo 3 Pictavia 6 peitear 1 Heuchler 1 kobiensis 1 Modíficáronse 1 Orosmán 63 metafísico 16 Graxa 1 macias 1 hipernasal 1 Fontataza 1 infranti 16 penetrantes 30 pipas 1 Indunesians 1 Ondou 57 nomean 1 interrumpen 3 Odontesthes 2 Irrompendo 3 MARÍN 1 Linebacker 4 Glennon 4 Linajes 1 Filomeleo 2 Pentaphragmaceae 9 Limpa 1 isotrópicos 1 Kirksay 1 Gandino 22 Meandro 1 Fumiñeo 39 normandas 3 Parintins 1 fungiformis 1 Metepata 1 metropilitana 1 Ghera 1 Finished 47 jutsu 5 Obtido 5 Missione 1 Karlus 1 FOMA 72 Marduk 1 Harinxma 3 fauve 1 greko 1 muxulmana 1 Mantid 1 galdera 15 Gallura 4 Papadiamantopoulos 1 Hundwil 1 minunutos 2 granseola 2 Kimolou 8 MKS 1 fíxanos 3 narody 18 Jimenez 6 Ginette 5 milleri 285 nocturno 1 Kaliterna 2 Glíptica 1 Margullis 1 Peiresc 1 hipersector 16 percibían 1 MARTINI 1 kalasha 91 gaiola 1 IUSSU 1 Gagaucia 3 feliç 1 ovolanceolada 1 Nishiocha 112 Mordor 1 Paradidle 1 FirOcasió 2 molturación 2 mobbers 16 Ginardo 4 maseiras 1 Loménie 1 Mecilio 4 kuda 1 Kanagonon 2 hiciste 3 Mórdomo 4 Lunn 2 neoproterozoico 1 PagL 1 Kikawada 1 Kaunto 1 microscopicus 3 neutralidad 4 Lambaréné 1 Pirinska 1 Gueltet 1 Kulp 209 pectorais 5 microambientes 1 moldeouse 1666 Lorenzo 63 NUTS 1 Imiphakatsi 1 monarquias 16 patentada 1 lomui 1 Korone 1 k?a 1 jachtluipaard 1 Pinateca 1 moaxe 55 matado 1 hipérbólico 1 parios 5 iwi 2 permitíanlles 1 Listaxes 1 Lototurf 2 Hiperprolactinemia 2 Lagas 7 ono 1 métoido 1 Kuruwe 5 Petico 1 mecanoreceptor 2 Hovenia 2 Follen 1 inutiliza 5 falsificada 1 Jusá 3 Jaynes 2 HCR 1 pacificara 5 Mapudungun 1 indicativamente 2 Lartigau 1 Hanjou 1 IXGiulio 1 nevarentos 1 felicitan 1 légume 1 Mittelwestfalen 1 feuille 1 McGuide 1 Keuea 1 ljartã 1 Moonbird 23 pinceis 4 hound 1 Hryp 3 Modorra 3 Gadé 3 frutado 1 Katernberg 27 metiladas 3 Knörr 2 Gravette 2 Omon 4 Holmio 5 Lévame 1 iiscor 1 Olinguito 2 medievali 1 Groenlandiako 3 Gmünd 1 Navialbión 1 mixoxenizándose 1 insiera 8 plant 1 Heliosismoloxía 1 Malaisha 1 grafados 1 gastrópodos 1 incorsión 14 musicoterapia 1 Piccioni 1 fezieron 1 Huszt 4 fondearon 19 interrexional 1 migraciones 11 livonios 1 Frayz 1 Ganduxer 100 Fogo 2 penobscot 9 Hijas 34 Macaca 1 madeirada 1 Nqamla 1 Nusbaum 10 fosfatídicos 1 Mandimba 5 metódicas 1 parfume 1 grosulariáceas 1 Oratore 3 Nemitos 2 neper 2 Jigüe 10 Liquidambar 2 Ngaoui 1 negotiantes 6 Moods 2 mock 1 Pinealocitos 1 Michallet 7 Kerkrade 1 Lucianna 1 Gailliard 8 Orseolo 2 Fechtens 17 Pensacola 4 Felpeto 1 lubricina 2 mandacións 2 GRANDE 51 Maiden 1 Oricola 4 Otmán 1 Oberreuter 1 motia 2 Mladina 2 Menestrel 38 Magnesia 1 invididuos 15 granado 1 Iskor 2 Grilanda 1 Motekaleman 1 Plankalkül 79 osteoporose 4 negocie 1 fritto 6 Ftiótide 1 obedecerades 1 Lenguao 1 McCarter 2 gaste 1 maltotetrosa 1 Nobere 1 molts 1 gavotte 129 metades 1 manalxia 1 Perfumadas 1 Gleibat 9 influirían 1 parafrenias 185 manganeso 1 octosílaba 1 —Halifax 2 Lognes 22 grecocatólico 2 Harangody 1 Glenmorangie 1 monometiladas 7 jelly 1 Jannik 2 Meininger 13 Garlic 1 Kamin 1 kecamatans 18 mexacán 1 Narwicz 1 margaretae 13 Kinokawa 2 Ihya 4 Hydromedusa 1 pandurs 1 Pediapirin 1 filibranquios 5 knut 1 Iñaqui 1 mitolografías 1 Garni 11 Lopburi 1 mikhu 1 lercho 1 Loungga 4 Illuminations 1 máqueina 215 Films 2 pantomime 1 kinnows 2 íolo 2 Gruel 43 horrible 1 Løkenåsen 2 hérdanos 149 inferno 6 Listanco 2 Guidance 4 Intransigeant 17 Kaeo 11 fílmica 4 Katarzyna 1 Novidio 1 Inviolabilidade 26 Firma 11 plaisir 1 Leova 1 Fundamentó 24 ping 1 Felda 2 pegáronlle 1 Gronco 5 integro 1 Gennig 1 Jonoon 3 Ildo 214 Fausto 6 Figa 2 inicializada 1 meñas 1 Galaxoidea 1 FEsteve 13 mola 1 mpst 8 Petrea 1 Fraxino 1 Gulidjan 1 †Parelasmotherium 1 nosferatu 1 LAURBELES 1 koroli 1 Loidl 1 fotoaclimatarse 1 kaddab 1 Krstanovic 37 nuncio 1 multiistrumentista 2 mantiene 3 Independentistes 1 migaba 1 Larrin 19 Kodokan 1 Kaishu 1 Luíses 1 Nigauds 1 GEREC 1 Glenford 1 fofas 1 LateLine 10 metacarpianas 20 filiformes 3 Luesma 35 Lindberg 5778 isto 1 Mikhajlovski 4 Kaige 1 Micestii 1 LASIK 4 Henie 1 Georgiu 6 holdings 1 Mónada 2 Photomaton 49 mora 2 Kalaureia 4 Monderman 2 Haddaway 1 Paully 1 Pipilo 1 Piperión 1 Nutrilab 1 Ferrobús 1 Osttimors 1 Maiakovskij 93 filosofal 268 Independentes 5 Omilos 2 Graubüunden 1 Micen 1 pichi 1 Imprimíronse 1 Notechidnopsis 1 Perignon 2 Makedones 1 iémer 1 microaerofílicos 19 metereológico 1 Jassie 1 hinu 2 gl 1 Manifestaron 2 flavidus 1 Fludarabine 1 PETRIS 338 máximos 2 ghazel 3 merinides 1 Patrizian 250 Mahler 1 Faragliones 5 Háblame 2 pasearse 7 ilírico 1 KMLdonkey 2 horadadas 3 holotricha 3 permanecem 1 Micromonas 1 Lubbeek 1 Fredbalus 1 homeótica 8 Osakasayama 2 Gremi 2 picamulos 14 Haryana 4 Microthamniales 2 Miiaguino 1 Lacaud 4 HSUS 1 gymnophylla 1 Fullieda 4 Hetepheres 1 kitobam 296 guerrilleiro 3 hvalr 1 iugonostálxico 26 Morren 9 kelleygreen 1 Garagartza 1 Herosín 1 Ilasa 2 olláronse 1 Plataneiro 1 Koryakuho 1 metamorfoseouna 1 Longsjo 1 pirahã 4 Peptidoglicano 1 Pelmatoza 2 Musetti 2 penitenciadas 6 moralización 30 Hierón 5 hyrcana 1 Ladinisch 1 lanzárono 64 NES 1 Mras 1 Modroño 1 nagorny 1 kineto 1 Passager 4 neobalénidos 1 Lattes 3 ínterin 1 galben 42 Fulham 1 Hachim 1 Montalbanejo 2 Franquesa 38 McLeod 7 leggero 1 onicorrexe 1 Ixcomán 1 lañada 2 Padamati 1 kwrmi 1 maximizado 3 gost 1 Phalangeroidea 1 mmarcas 2 Feroes 1 golabi 1 labarna 1 Mornico 1 Nolff 1 Jospeh 1 mær'???ne 2 Lecha 1 Gekiken 2 Nakba 1 historiografia 1 Luehm 1 Marcé 1 Menzen 1 Incitar 1 Pigelleto 1 Peaguda 62 flotando 1 miniCD 2 implicasen 2 mechada 1 Haüyle 2 plasmepsina 5 Lodoso 1 francés Charles de 63 Pesqueiras 1 Guptill 3 grecas 1 interprofesional 1 Nuraga 2 Goodboy 4 Forsman 2 Peramola 1 JCC 8 FPSO 6 Nymphaeales 1 morfoudec 112 ledicia 14 Mirabal 1 Lajeadinho 1 Manrese 2 oscure 1 Leeni 2 paleoxeografía 1 lizar 1 Menoponoidea 4 pelásxico 21 Hustle 4 Meisters 7 Omae 1 Muttis 2 Glanfevil 2 masmédula 2 Myshkin 1 Hegaz 3 neurorretinite 29 Gugelmin 1 oHG 1 gimnastyki 1 Microaerófilos 1 Ligeza 2 Lamellibranches 1 Olivceira 1 Myrskylä 4 parcelamento 1 obedeceredes 19 Neues 1 Frightening 2 Hajimete 2 Hreacción 3 pégase 3 Liaodón 6 MOSCOSO 11 homicidas 1 Humberside 3 muraiama 1 Kadiköyspor 17 Horkheimer 1 nonas 1 Maisoncelle 2 Morphok 1 Goicouría 1 gossa 1 Nehmt 23 Malavella 3 parots 4 Laidlaw 1 Glem 3 florarías 2 FastCGI 1 Fantoyano 6 ï 1 pancardite 1 Miichthys 1 pirético 1 Pireneos a 1 Maglificio 2 normativizador 1 orosán 1 Paradíso 4 impulsarse 1 indefinibres 1 Kamus 1 myun 1 g?b 22 Modernos 1 homeomorfos 14 Ovidi 1 macroconcerto 43 Mordomo 1 GHaiakawa 1 mucchio 3 gobérnanse 2 Kanchenjungha 3 Mullet 4 Howarth 2 Fancey 2 homolog 1 Iflaviridae 1 himny 7 Fórmana 1 Kweichow 1 Mykanów 1 juncifolium 1 informacná 1 Mackinaw 2 Ozeans 1 palloctas 1 Kotaque 1 meao 1 necrotrófica 7 Hortaliza 1 metamatemáticas 2 microcolon 1 INESCOP 1 mostrouno 1 homopirimidina 4 Gabála 1 LEVX 2 Fragneto 1 Oxígeno 1 Mulry 1 ögonen 12 Pardon 100 Magnussen 5 Mizoite 53 Integración 3 ghiaccio 120 Matrícula 1 Henwig 26 mostradas 346 incendios 35 pavimentadas 2 Neferubity 9 Imogene 24 Mocidades 85 pigmentado 1 felicitala 1 franxiverde 6 monda 1 Nishinari 7 Manuele 1 o Moon 1 Lunghi 1 ilustrándoo 14 Mitose 2 nauseas 1 Mashona 1 Obryv 1 Istiqlak 3 LCAT 2 pelargónico 5 Maimon 1 Phrygien 1 Geodesistoy 1 ferraia 16 orxías 21 Harrisburg 1 Iriki 5 Paseos 1 Patala 12 herdaba 1 Lexítima 1 Literarisches 2 ordenáralles 1 Mecadillo 1 montainboard 2 Kajuru 1 Loflox 173 Monroe 2 Pagotto 1 Furno 1 Nádkút 1 glomerulopatías 1 Kajola 4 mudadas 36 Pepín 1 pengene 1 necessaria 1 hrob 1 Oftalmólogica 5 GlobalCaja 1 Laurentiu 3 gustación 12 pisadas 1 GomezNoya 14 IGN 1 Orestilla 1 Garbanzuelo 23 Mañufe 2 mercat 1 kawki 1 GOMIS 26 inverna 1 Neglektra 1 Göbl 7 maridaxe 3 Oguchi 7 peritrica 4 Paneloux 9 Isehara 19 medina 10 Insectorum 4 Hopkinson 1 grilletes 1 Haizhu 71 Limburgo 12 Lecomte 1 Kuzmenko 1 perf 2 níspero 1 Mostraralle 1 Glaç 5 Mohicania 1 komikitan 9 Interlingue 1 Halonnesos 10 MIPS 1 mabedimin 1 Pindostan 1 ohate 1 Mohenjodaro 1 Häftling 1 Pednelissos 5 Hyperlophus 1 Fofoa 1 nemedianos 1 Fullerenes 3 Hurlingham 1 Leggi 1 Newbattle 1 Incancellabile 4 Pecíolo 1 Parascorpis 2 Lobez 1 masificarse 123 Mercia 1 igualaría 1 panchakaryam 1 ia~ 1 Gunns 3 Laba 2 Frádigas 1 ORBE 12 manifestábase 1 oposicilón 1 Inisherk 3 Neversoft 1 kindness 8 Masini 1 Lénk 45 illantes 7 Ott 1 Iliia 1 Legúa 1 ondina 1 Oleksandria 9 Ilmari 1 Gdunsk 1 Kesshin 1 mocheta 1 msema 1 nidamental 2 Homestake 1 paganum 1 Halvards 6 pasais 3 Martinair 57 percusionista 1 Nieuwsblad 3 Laganà 1 Jonssøn 1 masseters 1 Pangeran 2 folque 2 Kunsthistorische 3 metilaba 5 frustrouse 1 PEVK 1 langoesten 18 osmolaridade 1 Haagespostoa 1 IrelandMayo 8 lacrimóxeno 11 Marouane 6 koa 1 lupanina 1 kundalini 2 macroglobulinemia 11 ficoeritrocianina 1 fosilizarían 1 patagonum 4 onomatopeica 31 Kush 3 Geographica 1 fusíon 40 norepinefrina 8 Flux 2 monopolar 1 manejador 1 hiljlui 1 fetomaterna 1 krausii 4 financiadores 5 Opell 1 Numenoriana 2 Metke 1 Lepidomeniidae 1 Khrushev 1 igualásese 2 Ispica 1 Listou 19 Gemäldegalerie 1 Petrucho 1 nitros 1 Orthopristis 1 Lavandaría 1 Footon 1 lät 2 irrigacións 3 Henriksson 265 Paraná 1 Karamian 2 lamed 3 narracions 1 Lulia 1 Pelayeros 2 indivisoque 3 miasmas 1 förr 10 Manifestis 2 Mvouba 1 ínzase 1 macís 22 Founders 5 fenestradas 1 Hardråde 9 Instalou 2 Liñariños 7 Lobsdorf 1 fotopeiódicas 1 imparipinnada 10 Necrose 2 Menschliches 3 Kraditor 10 Mavis 1 Lancasteriana 5 Grind 2 Nexen 1 notoxéneros 2 PIF 3 Hormoaning 15 instigadores 1 Gourde 2 Formánek 5 Papai 8 Folgore 2 Nachtigall 1 Inheritors 1 Passantes 1 Gârbovi 1 pichina 27 Pecado 1 Hovercraft 2 Plautia 1 Garove 19 Nouakchott 3 fíase 1 mochilota 1 invertería 3 Panov 28 Octavia 1 Galardoárona 1 Filanbanco 256 lexións 1 plataformismo 9 Gatiss 2 Histri 1 Maldaeni 1 na Piazza della Signoria 4 Galardoada 1 Motordrom 4 Parpalló 1 obríganlle 1 Hedelfingen 1 Kilpeck 1 filopátricas 2 limpáronse 9 Iagá 9 Guarino 1 musivus 6 Meshuggah 1 Ferie 1 galletiña 1 HORTA 27 herbívoro 1 Metallurgia 1 Niitakayama 1 nonilfenois 3 Farquarson 1 Hartg 1 parisílaba 3 Healing 1 Padiérniga 6 orientalistas 159 óblast 1 Insalubrious 1 partíase 1 Levonaberd 1 globitos 4 Iagnob 35 fermentada 1 gonano 9 fecundan 1 Photographe 6 musicalización 5 Haemospororida 3 invectiva 1 Mokotu 2 Mesûd 1 Gleaner 1 Muncada 5 mij 5 imprímese 1 Pariza 3 lepóntica 1 Hemicaranx 3 OddParents 1 Partisan 5 khoikhoi 1 Pelmatosphaeridae 1 oroxéneses 13 Magaña 1 koritsia 9 Inland 1 Kajo 2 leuna 1 Matiacoali 1 Goathemala 1 katt 1 obyknovennaia 1 Néfertiti 6 Osroene 1 pastoreados 1 percorrermos 1 Interpelación 2 Korten 1 intrruptor 1 Hertzl 1 Korganov 1478 Ministro 2 mull 1 Megata 14 linn 1 oftalmoscópicos 3 Hylan 1 Nivelos 1 nimis 1 Kartsona 1 Malleiro 2 Levounion 1 ordinati 1 paleodeserto 30 Meet 1 mkfs 1 milicianas— 1 gnn 1 Kiberlain 75 loca 4 ingresaba 1 Filmfestival 1 Levésque 182 militancia 6 Marquês 1 petril 200 Mozo 2 Madrileñas 1 Pinelas 1 jewishvirtuallibrary 1 Krapatchouk 11 Foeniculum 4 Minny 1 Flamânzi 1 Panaeuropea 1 Lykketoppen 12 impídese 9 fotografando 4 Filípides 1 Ierushalaiim 53 irmandiña 1 Metaparadigma 1 Margao 1 Notopteroidei 1 paminobenzoico 4 Micénicos 1 Nomerosos 1 microperforado 1 Kirwall 1 Odde 47 ficoeritrina 30 funxicidas 1 Marelo 11 Phèdre 1 Nikoleta 1 Lumphanan 1 leyese 1 megamix 24 ofrezan 18 impera 1 Laflèche 2 Inistioge 1 Kimche 2 malheurs 1 kopsii 1 Justitie 8 picaresco 1 nanoelectromecánico 1 Meyba 2 Lalleyriat 3 Michoacan 1 KFKB 393 Obra 8 fitosanitario 1 Fenella 2 leichtliniana 499 Olímpico 1 feísmos 15 ordinariamente 133 marcaron 2 Higashiagatsuma 2 PFKL 1 picóuselle 2 fuorilegge 2 Nothofagaceae 1 inculurît 3 Mutakabbir 2 Matteoni 1 incorrido 1 Pampanico 1 fotografala 1 Ought 2 obscuras 1 Pasadizo 89 Global 1 lowellii 11 lingual 1 österreichischen 2 Indomalaia 1 palloilijat 1 Halti 2 hipnólogo 2 Papae 1 nicaragüenses 1 faringolarínxeos 19 Hate 14 obstruír 2 Myorycteropus 2 Picotes 2 moïamos 1 Gierdt 1 phenom 1 laghus 1 Haessig 1 fritt 32 Maseru 1 Kenshinkan 8 Gañemos 1 gwahatike 2 miosatélites 4 hispidula 1 FEDEKAMNIEUWS 13 Lagarteira 1 fellesskap 8 Franja 2 pendientedemigracion 1 Pettaquamscutt 1 klattianus 1 Ilsley 4 Monomotapa 23 Naissance 2 Faltognano 1 Frankenlied 1 meltrinas 297 FM 1 metacarpofalanxeais 2 Huitán 3 Niemiec 1 Gewande 18 Galarza 1 Jengibre 1 Kindlein 1 mancharlles 3 interdicción 2 Littéraire 2 Kostunica 8 Montini 1 Ijaw 1 Perchero 1 Michonneau 19 NRJ 3 paraplexía 1 Furlani 1 pastoreadas 1 opgehelderd 3 HGH 4 minimizarse 1 permansisse 1 Malvecino 4 Piricallo 2 parlé 1 k?ési?o 2 inequivalva 3 Nesterenko 1 loucura— 2 l? 1 hwibanat 2 Ouakam 1 Fontenot 1 Percussão 3 Fhear 2 Pariyawatri 1 labiernaga 7 Pecci 2 na ponte 1 Haguenauer 5 flutuando 2 GITAP 5 Peligna 3 pebre 1 Kåberg 11 Faramello 3 panži 1 Ligurie 1 Pattersson 2 Outeiru 2 majestuoso 4 igualitarias 1 perspicua 2 Pídeselles 1 municipoi 1 Insulo 1 penicilino 1 keypt 3 nesiotes 1 Fjeldså 1 interrompéndolles 2 friccionada 5 pedirá 1 Miróu 3 Husyev 5 Helespóntica 1 franzosischen 1 nearcticus 1 Ooooooohhh 1 Inmunorregulación 1 Liebknecth 1 Nemirovski 1 malononitrilo 38 fusionado 10 náutilo 1 Kanisa 1 floridanum 7 pieds 4 gazí 2 Pholien 7 FONT 1 Marsik 1 Herlighed 2 Malacanthidae 1 Karaksh 1 Fark 1 integriloba 1 helofíticas 1 Lågøxa 4 movente 4 fundirá 1 identitu 2 LRE 1 felipista 1 Juanta 1 natacion 1 kråkans 7 intolerable 8 Leboreira 2 Leamy 1 Kyteria 8 Lavandeiras 1 normoxia 1 Metaphors 1 Gunerius 1 Guipuzkoa 2 impartiulle 25 Nocturna 1 Guaccero 3 Litauische 28 Ovarense 9 Kashiba 5 Maciunas 2 Manned 4 Kvothe 4 mnt 1 Iano 1 Peracova 1 Mimarlari 2 hams 4 Gradski 5 Krupps 1 Mortelmans 1 Fenati 1 Gonyonyo 1 Iudaeorum 1 Marssonina 2 Mistela 1 Intensificáronse 1 Minarik 1 felixiosa 1 Landeck 1 Iheiche 32 LM 1 opgiver 28 paleontolóxico 1 incomúns 2 nymphaeifolium 1 LYNX 1 Herculianas 6 foliacea 1 oporán 10 guste 1 Gremiales 3 Martello 10 Fustat 8 infranqueable 1 Jukai 1 fóronose 18 glutinoso 2 Jóhannes 1 Oosterhogebrug 1 plastómetros 1 Misak 1 Guará 1 nèfle 1 Gobiocichla 1 mainboard 1 illade 1 madian 1 Larauco 1 Kerlinger 1 Ladjoul 1 guindaleta 1 gabábase 26 Paice 1 makashi 104 Flynn 8 navegabilidade 1 Magnenus 1 islahh 1 indixestos 3 nefrites 8 Gini 2 FANCF 1 GUANAJUATO 2 Lobachewski 1 Laleham 1 pendanga 1 hertziana 4 Hadromerida 4 Gramigni 1 glicosidicos 1 paleoamericano 1 Glaubensbahn 38 Oil 44 liderato 1 parternidad 1 pictures 1 Isafjordur 3 Overtime 2 Kapton 1 grossos 16 Implicadas 1 permafrosts 1 Gárdoma 27 manipulador 1 Mesopristes 8 Gaol 3 heterocario 1 Paleu 1 Gigliese 4 miroir 1 mu?Minin 1 latérale 886 Gabriel 1 italianistas 1 pandere 1 Hatayama 1 FATS 1 ngongensis 1 gnomons 1 infecundo 1 marsupiiformis 1 khatt 177 mariscos 13 Farmar 5 octonións 1 Kamenitsa 1 Naeva 3 iniquidades 1 Mikang 1 Gekiranger 1 Nikoalevich 6 Mykola 1 globifer 3 impredecibles 1 Pediconi 2 Moncur 5 hirudíneos 5 Mys 2 Gallada 1 geoc 8 mandárono 3 Judæo 37 Instalacións 1 funxívoros 1 Mesae 1 fisgar 1 Liégeois 1 Joad 1 hinduizarse 1 kalpak 1 osteolóxicas 3 Gleiwitz 3 Morenito 1 Gellér 2 Galbi 1 Gosud 1 innovaron 1 neoflavonoides 23 Ouvirmos 3 Locacia 2 Genolier 1 pentacycla 1 Jim 16 Montgó 1 ? 110 iniciarse 2 Kazaure 3 gavr 1 nesoi 1 Komsi 147 Opus 1 Oppland 1 JOE 2 Lannarstêr 4 Motecuhzoma 1 Kgoroge 1 gerbe 1 Ludorff 41 hemocianina 1 INTERART 8 lambertiana 1 meliorativo 1 Kspaceduel 1 Kastl 1 Michajlo 1 Härö 35 Hertha 1 limitarnos 1 pentosanos 1 Kruseman 2 Lebensformen 2 Haltung 2 paralarvae 1 Hannuka 1 minix 1 Itamaro 1 Gogoratzen 1 Meela 1 osmotrófica 13 Marinho 1 Nukulai 1 fraujis 1 logistique 2 Mazzarrone 4 hatar 1 padanno 1 Öffentliche 1 formenterae 16 Knopfler 1 maiframe 2 GECA 1 Manyen 1 Mazado 59 noches 1 fredelige 1 ilegalizan 123 insírese 1 MENT 25 Merz 4 Pantokrator 12 Neelsen 2 impicados 4 Kovalev 1 Kumirei 1 ladogensis 1 Pingtung 1239 longas 18 matutino 1 hirsutas 7 Italien 1 Karru 38 niacina 1 Pandulus 5 pedidas 16 Maía 4 organosulfurado 1 glückseligen 1 mollipilosus 10 fundamentados 1 nasalizábase 1 irrepreensíbel 1 galateidos 1 Fensum 1 Fraulino 2 Gorgan 1 Nídaros 1 pasteuriza 1 otkrîtîm 1 Lalaith 1 pateikti 4 Lenakel 2 Hamaca 1 metoxicinamato 14 Huya 1 litterariam 24 Pembrokeshire 1 Milbury 4 Gioventù 1 Macrotropis 12 Gyumao 1 fluorimétrica 1 Mottettos 1 paece 77 isquemia 2 Miesbach 5 Humban 4 hashalom 2 Intxauspe 2 MNK 1 multipantalla 1 Lautier 1 Gsspar 2 Lipsky 2 Galiñeiras 6 Kurbin 1 Mapper 1 Krauthammer 1 Jmm 3 Neumark 4 Occ 1 lacrimarum 5 kor 2 Oscularia 29 funcionaria 1 Fanos 1 Invitando 54 Olav 4 líquens 2 Herdara 2 GCTS 20 Mirambell 1 légamo 1 Planejar 5 Gudari 10 Manghüi 2 pediculares 1 Miediana 1 lirismoEsta 1 PalaMalaguti 1 Newtoonbrook 1 FUFEPO 1 Lunguletu 1 Loucas 4 juño 4 Kempf 6 Nihil 1 interor 6 Moliné 2 munxaniana 1 Nogareda 1 Norðurfjörður 1 miliwatios 1 Mondatta 7 grido 1 goanã 2 Garudamon 1 nacio 1 înainte 1 noris 19 Junction 1 Nataorano 7 Irlandesas 1 Lepidoperca 2 lumens 4 mitificado 2 Oligoelementos 1 obteran 31 GIMP 1 Krasae 6 Flunitracepam 1 Maizhokunggar 1 Lomoconcursos 1 hidrosol 3 Murcielago 4 Nitocris 3 Miniaev 1 FeSi 137 Pitágoras 12 Mesas 10 masónico 3 Heraion 2 Goldeneye 2 habrás 1 fistulosos 1 Hibok 2 Fragancias 2 menneske 1 guanfacina 1 langoneses 1 Intermeco 4 formalizando 13 IFT 42 Pausini 1 Ouesra 3 félsico 1 perdia 8 Moncalvillo 47 Fulvio 2 Fruean 1 Fallulah 2 Kuszczak 1 feminias 1 Lotero 1 Lincent 8 marmeleiro 1 Gemisto 21 Londonderry 1 Nutsy 1 ircutianum 1 LesserNordhausen 4 kefir 1 lampista 2 lusitanum 4 Imprímese 1 Monegro 8 JSSW 1 Nomenclatoris 1 Nationalatlas 1 Inishglora 1 foláceas 4 Kempster 1 novembros 1 Mustjala 1 Mowentike 2 Mwanuku 1 koronie 3 outorgábaselle 1 Pimm 5 Garity 4 heteronomía 1 Mediooeste 1 Indianola 1 pillory 1 palén 4 piñones 2 forasteiras 27 Miglia 1 Finnois 2 opensource 23 Franchi 1 fuqaha 1 MEASAT 1 mediumnidad 1 grisóns 4 McTavish 1 Heit 3 Iros 1 Levantareime 1 grogne 1 Gilewater 1 NUNES 1 Fautario 49 molibdeno 1 mdr 1 Mirabilia 1 Maikroekonomiks 163 neolítico 1 hCH 46 Moby 1 LIMETE 6 Masdías 1 Mudrock 16 Mame 1 nanoarqueotas 1 minóo 1 intepreta 3 Hellboss 1 Iaia 4 irmanciña 1 Meurier 1 Personenvervoer 1 Parikh 2 lembrará 1 Ogcocephalioidei 1 Gabantxo 1 Fioratti 1 feblezas 1 orientábanse 3 levaduras 30 minguando 1 fidxi 1 Jenkinstown 1 métoto 10 favelas 1 Gbèkèkro 1 osuusliike 21 Hijo 4 Keio 7 piroclastos 68 Linz 1 Petrogradskii 3 perí 16 Ouen 2 macclurei 6 inintelixíbeis 123 Ochoa 3 INLAND 48 pertinente 7 Jagan 14 Gyan 482 orixinaria 2 Fujin 4 Menschheit 1 panelados 1 glandularum 2 Linguo 1 maquinando 4 Hellás 1 Iodotironina 1 Hiun 3 Leptonychotes 1 KDEBluetoth 1 Gilady 1 grepcha 1 JERPV 1 Mancho 298 Patria 1 Musulmás 1 Pendaran 1 gheu 2 GII 91 fundadas 3 Franrobla 3 osificante 79 piden 1 normaleme 9 Moruxo 1 ofrecíaselle 1 longisiliqua 1 innern 1 Kesselbach 5 Ishall 1 Mufindi 1 ku?ul 5 malaguista 1 intestin 1 knikerbokers 1 Gloversville 35 Illescas 1 farrani 3 Muruxa 1 Jubilejní 1 Goiabeiro 1 hygiène 1 Pipriac 1 melanonota 1 Karwende 5 Filologica 1 intenciós 6 Paride 1 Graio 1 Lebleu 52 Medo 33 ligueiro 1 Metrodia 1 percentiles 11 patilonga 11 Gifford 1 interrumpeu 59 Mau 1 mobular 1 manex 2 IOA 1 Maris† 2 mionema 1 Obsrevatorio 6 Monteains 1 Ilanda 50 Intermedio 1 Natuurwetenschappen 1 pilotanod 1 fórm 1 Ligofilia 2 megaparsec 1 mediríanse 1 khabar 1 Otorrino 3 instrumentalizar 2 Galafura 1 Kohou 5 Nicodemus 1 Khraïcia 58 islamismo 7 maximum 1 Nasill?rd?n 1 futro 5 Insatiable 19 Pay 1 hankugensis 1 Perlo 1 firmarían 1 Pícola 46 Norbert 13 Oliveiras 2 hemal 56 Metafísica 1 hellige 5 kao 1 libúrnios 1 FELICITATE 1 Pihtla 18 pardinus 2 Melitopol 1 Mansío 6 LAS 4 Hérodote 1 Manitivo 4 Nim 2 Fontenlos 2 membri 7 palaciego 2 Gimpo 2 nisán 2 Fragos 2 Nomeada—Teen 1 machúcase 1 morrións 1 peldrachos 6 Kyo 6 paronomasia 1 listeri 1 pentanucleótidos 21 Oco 2 Ortográficos 7 malváceas 1 Kivennapa 1 Ghose 14 Malinowski 1 mwp 1 Grenouillère 1 Hastingues 1 Mégère 1 Ngalakan 105 incorrectamente 1 Jarandilla 4 Kouta 13 Ines 31 hidrolase 19 Mavs 1 gibberifrons 7 Øresund 1 moíanse 3 hipotecado 1 Melih 2 Hospira 1 MAY 1 lobosa 4 Malante 5 Judíos 2 joxemaritar 2 Nyle 1 fenugree 4 Famaillá 7 Natrialba 4 naka 1 karkut 4 LIQ 10 Levski 2 Haskouri 4 funky 1 Guelmin 2 Feulgen 1 ochroleucum 1 Ixil 7 mécanique 3 perra 1 floreaban 1 packaging 2 Köhlbrandtreppe 5 Giù 2 keme 1 habituamente 2 Mambrús 1 inventat 1 Godbout 1 helado 1 GMplayer 1 Lioppa 4 Farta 1 otuono 1 Inuttitut 1 Koenigstein 1 gemessenem 3 MUBLCOM 2 microfabricación 1 Lauku 10 Nesodden 40 Guinardó 1 Phiz 1 Miomorfa 57 paciencia 1 Hindustaní 2 kalla 1 grisaille 5 Munida 4 Lutgarda 2 Grandrith 1 féconde 1 Penavaqueira 1 insulin 6 Implicouse 1 lietuvis 10 Hamiltoniano 1 marcatto 1 Juror 1 LLADORRE 7 ordine 17 hostia 8 fusaiolas 7 Jakin 1 Jazzbuehne 37 farase 6 plaquetarias 203 Galán 1 orrazia 1 inambigua 4 kma 13 Honeywell 62 lácteo 1 Mardia 1 hãrziti 1 lindigii 1 LocMap 3 Matarrosa 1 Japonês 2 lourentinos 5 Falqués 55 obténdose 9 Gorj 1 Nyunga 3 Minard 1 Ohiti 1 Invitatie 3 Hertig 2 Joio 2 Hemiphractinae 3 Frederickson 1 Leverxer 44 Paulus 1 Gimcana 3 HW 3 Gliridae 3 Frago 1 Kateríni 1 Irazola 1 horombensis 1 fraccions 1 Haiducilor 3 Merkur 2 Magusto 1 kojja 1 intimi 1 gradián 1 Keage 2 Kolpakova 1 movíbel 2 oxygeneios 2 marvieri 14 Martius 20 Meaux 1 Hellinikon 2 inserilas 1 Insecurity 3 Otoyo 1 Lÿmleštälteš 5 Millonario 1 flui 1 Königsinschrift 45 Peláez 29 nucleósidos 1 Nakara 14 mentalidades 1 hacketti 8 Lakoff 6 fertiliza 2 osteoblástica 2 nini 2 Parapylochelidae 1 meloeiros 23 IGADI 3 Lekuine 3 lexicolóxicas 3 Fiske 1 LERT 1 Humlebaek 3 inmerecida 36 Lotarinxia 3 morfóxenos 10 Foraminíferos 2 Hellberg 1 naziunal 1 Milrow 3 monocinetias 1 Fuentehonda 1 Kronert 1 Granby 1 Parapristipomoides 1 picnidio 153 harmónica 4 Liédson 1 LEGISTIS 1 Hlidskialf 1 metallischen 1 ongelegen 4 indesexada 1 mput 1 Levasor 5 Pirene 61 lindeiros 3 inuinnaqtun 1 Panarterite 1 jinzhengu 1 imeretio 1 mineralizante 1 pelegríns 4 Hedared 1 murgas 6 ois 1 Nudhapol 116 Mara 1 Molotova 3 Mirco 4 intérnano 3 Fjarðabyggð 5 Oakie 4 Luxemburguesa 1 Giestoso 1 Gilbero 9 Otuke 4 Lourambal 4 Marasmius 5 Merzbow 5 lembraron 3 nesgado 1 monumentofilia 15 foc 1 Hardstuff 23 Pentes 1 Infomanías 5 Meimón 1 israeliticum 1 madrigueiras 11 Furgoneta 2 Hattstatt 7 Omphalotus 1 Luzzi 2 Junna 1 Hilang 1 Phonemic 1 Lahlitah 1 Jonesy 1 Marávia 10 Mallin 1 fusus 7 Incluídos 2 Fusariose 6 Liliales 1 Nazóns 9 Pitman 14 garita 1 plantarii 3 Gimenez 1 mune 3 Gigurri 132 Heart 2 Olduvay 2 guerreaban 8 pedreiros 2 Hoshikage 3 ondo 1 Kisho 3 Igu 1 geschätzten 1 Parj 1 Kokiri 1 Hayastán 29 pilota 1 frecuenciasanteriores 1 maritimequest 49 langle 1 graznido 1 Irem 1 neumatóforos 35 metaanálise 3 IdPV 1 nárez 8 lordose 1 Mangiaceae 1 gorensis 10 perifericamente 2 Hidrea 4 iPSCs 1 Ibuakoia 1 Nyheter 4 Ostricultura 1 Haliç 2 Financiada 1 lanyobrixs 1 Mixodectidae 5 Paracaidistas 1 Phaneropleuridae 1 GEPRONAT 2 Krishnamurti 5 firmaran 1 Jojic 1 lastima 2 folclorística 1 fitzingerii 1 oyseaux 4 pazza 4 octodecágono 3 Meriç 1 Ollendorff 1 Owelus 6 Palikir 8 movelas 4 fusionarán 1 Karask 1 Pirinia 1 Knaster 1 Lazarevac 155 Oliva 1 gibbsíticas 1 Halswelle 1 frasa 2 Jude? 11 maoríes 5 Interzonal 1 Farsetta 1 juzgarán 1 intervenido 1 Iemenís 4 Gaidheal 2 Frassino 130 faltan 1 fellis 4 Nidzica 134 impón 175 formigas 1 maquieiros 2 Mim 1 Golpeo 2 Lüfte 20 Lacey 3 Naharis 6 Garabato 3 multiaxial 4 moralidad 8 inmunomoduladores 1 Piperidolato 4 Kenwa 3 Maañón 4 Olascoaga 1 myth 14 Hagia 1 gastándolles 1 insinuarse 1 nnotate 1 monasteiro 1 Kermauner 1 Lipsyte 64 Localizada 1 Mavrispilia 5 Huré 2130 matrimonio 1 Jocz 74 Hilario 1 Jacksonia 3 Imabetsu 1 fotografouno 5 pablo 2 fumalo 8 JN 1 Gonodactyloidea 2 Giuseppini 2 OFontao 2 Knockaround 2 Olvídame 98 Keegan 1 Millà 1 Omañón 1 mascherina 14 Mapamundi 1 ILLUD 37 pencas 5 inusitadas 1 pelargonio 2 nGael 2 Gazolaz 2 Ornithomimosauria 2 miniordenadores 18 Lesións 1 Grazyna 5 narratividade 1 Malope 1 Ivakhiv 244 Justin 2 ggg 1 OSPECON 3 Gorgon 17 Osthoff 1 Gaspero 1 hexacontágono 1 Ladgertha 6 Grellada 1 Licanus 1 Ilbono 1 Latzina 1 Kpresenter 1 Lipni?a 3 nótense 5 Kirsti 2 Fürstin 1 Gigaparsec 19 gulag 1 iqbi 17 Huo 1 Ismoili 3 Fusi 1 Hólmsteinn 6 Lyre 32 Grilo 1 medievals 7 mutarrotación 5 malnutridas 1 Klettur 2 Influence 1 Nutr 8 Pártese 1 nematóxenos 1 Hitahikosan 1 paseren 14 Pelea 1 Oenusas 2 Magdalo 1 glaciarizada 7 ignota 25 Nowak 2 mouches 1 Oed 1 paderne 1 neuroblastomas 3 grancevola 13 LeMond 1 Illiam 1 gravitante 1 Ma 1 PBK 10 Paciencia 1 Ionotrópico 1 Jurin 1 palaestinae 1 inmunosenescencia 3 Golas 27 isquémica 2 Miunte 1 kirios 18 neuroblastos 1 Güenaga 1 opacan 1 Payless 1 obovatilimbum 8 Lack 1 leuchtendem 1 Intercambia 1 interaritenoideo 2 Hohl 1 Inseiro 7 Loitar 1 Inishbiggle 1 inapreixable 1 galaro 460 Phacus 2 manipuladoras 1 Imala 5 magnanimidade 22 mameluco 4 lehendakaritza 3 parcelada 2 Indoganxética 34 manipulacións 2 pereiópodo 4 Kienbusch 3 Hidrónimo 1 Inya 1 oíse 1 pisciculi 2 narrouna 1 Mistreated 1 gardafaros 3 incorrixible 1 NYE 1 Panxír 1 Inviabilidade 4 oblys 1 HuB 1 Pequeneiro 1 Habitaciones 71 Kuntze 3 flósofo 1 Lidle 1 Nytorv 2 plastificado 1 Mañés 3 Gwyar 13 Mensajero 1 penale 10 Mugla 1 Käch 3 mayu 1 Lauterique 1 Mitjavila 3 Haltern 2 LCMS 1 Grolière 1 miseris 1 Muchy 1 lassetsë 4 nervículos 2 own 61 Guanajuato 25 manipula 7 paterae 1 Hagg 9 Hnappadalssýsla 3 impressa 4 francisca 102 muy 3 guerrière 2070 letras 3 Onquelos 1 fixérano 4 McKeown 68 fonolóxico 1 invalidándoos 1 Montferrienc 1 Meskiangnuna 9 parterres 1 graduaouse 1 Musaxino 41 lagarteiro 2 libertadora 1 Hondureñas 1 Memak 1 multisensorial 1 Manzanedosantona 4 Greiz 2 plate 1 Jinhan 1 Kochetova 1 Golbat 1 hebecephala 2 Injected 1 monoxenético 1 PECH 12 firmantes 1 martelados 1 MAPOMA 1 fejervaryi 1 Okurierijime 2 observacions 1 píntame 1 Korenización 5 opresora 2 oxazol 4 Gameiro 8 Helike 1 Pancreatopatía 5 musculadas 1 milltir 1 keqes 5 Funambulista 1 focidia 2 impoñería 1 isila 2 Interpretadas 1 Jenti 72 paisaxística 1 Katedralskolan 1 Massounde 1 greydid 25 garanti 1 Kiebu 1 neuromotores 1 Jessibá 3 monopsonio 1 Kelno 1 Intérêts 2 Mouchet 1 impactacións 9 pegou 1 fructofuranósido 2 influencial 1 Ipomaea 2 granulocitopenia 4 monarquismo 1 Flagyl 1 ligare 1 Ovedo 2 kylix 2 Lugarejos 1 Gudalgai 14 haloxenados 1 Kavkazskaya 2 Peritymbia 1 planospirais 1 Hugoniaceae 1 padne 22 Filloa 1 Mahammad 1 inspirábanlle 7 holocéfalos 6 Latinas 10 Lovellette 1 Gesundheit 2 pelignos 2 laradas 2 laos 3 ortigueira 1 glicoxidación 4 Lexicoloxía 1 Fogu 3 moradías 1 Huatanay 4 Mezalocha 2 oftalmolóxico 1 Lycapsus 1 jeffresii 4 fucsias 1 orxia 4 Gebrinius 5 Penitencial 1 Kokuhatsu 1 nilosaharianos 1 pierio 1 Ocuparse 1 neopopularistas 1 losanxado 3 Makárova 1 Oligicus 1 fingered 12 Hécuba 2 Grandchamp 1 forzándolle 2 ondulan 1 Maloficio 1 Middelelse 9 madurecendo 1 Mestiço 3 Naraiola 1688 letra 5 osteoxénese 1 opalínidos 1 logorrea 1 hemetoencefálica 1 Klauke 1 Mayné 1 mudaÿÿan 1 Olodio 14 Místico 1 Foutre 14 Lothringen 1 Gjert 2 niobita 465 menciona 2 Mostalla 1 guiots 1 Mási 5 Klett 1 Hotnights 2 Minea 6 Huecco 3 Ienissei 1 lacryma 1 keralitas 1 orbiten 1 GURPS 1 maug 1 Får 22 Norðurland 1 hispanoruso 1 piliqueiro 2 noameado 30 Fiscalía 4 Goody 5 Nigina 2 filológicos 1 Knesebeck 5 Marfilesa 1 Halb 2 pediátrico 1 na Duat 2 Kapsis 3 muletto 1 Gjems 1 Pagasio 1 Nuadu 3 IBZ 3 Kopaonik 285 Greg 5 Herói 3 Kathir 1 Parshall 1 Pioner 2 Jarmond 69 garavanzos 3 Leenhoff 1 Gymnocephalus 3 perviviría 15 Pallene 1 Pidgeot 1 oxidrilo 3 Orxétorix 7 Macanudo 1 interculatum 1 Paleoantropolingüística 1 Pisseux 69 mestúranse 1 hiriburuan 1 pagalas 3 peptonas 6 Mazote 1 Haben 1 Oleificio 2 fascina 57 Kaup 1 Kiichi 3 forest 1 lorem 16 Mapfre 4 Marianelli 1 Ginhihigugma 1 Menis 5 filosilicatos 5 perseguira 12 Llave 2 pillansii 1 fichiri 2 Geen 1 Filters 1 garbetinus 4 Oidhche 1 FREIHEIT 1 Feestliederen 2 parisién 1 Kernalegenn 1 inlúen 1 Fisherr 7 MPSS 2 Llonín 1 impatiens 1 nomerado 2 Invisibeis 1 Kishn 2 Motorizados 4 istorija 1 pataxó 1 onesti 5 librum 371 liberar 2 Intortus 2 Illumbe 1 Gosseau 7 opéras 1 organizóu 1 Latukan 1 opercular 1 friameira 1 Kinetoscopio 1 Metekhi 4 Nsanje 2 oestes 50 Follonica 1 Hussitas 1 isospóreos 1 Habrophlebiodes 1 parvallán 1 Hermiona 1 ottoman 17 homoláctica 1 Neuves 1 menteur 1 lusquefusque 1 mantrin 4 Kevan 1 fertilizadora 1 Mortimore 1 Landesvater 1 Míkel 1 g?owm 2 Pirolusita 1 Knabstrupper 1 Florensio 7 medíase 14 libelo 96 pérdese 1 Illaas 1 Konkum 2 maiúsculos 50 Juvenil 3 Laminación 2 Histoplasmose 51 Malva 1 Jargal 126 Nike 4 Mañueta 1 nirukta 1 Mitidja 2 Hargensen 3 Mucor 1 Fonemática 80 Gallegas 1 Meatplow 1 Huršama 3 Íntegro 1 hialuronas 5 pasándoo 2 Malesch 1 Lollardy 15 inviste 5 heterotálico 4 Forcado 3 impugnados 2 Fócidos 3 flexionando 1 Gioulekas 1 Gravier 1 Liaumiga 2 individualismos 8 placentas 3 Frehley 1 Outamaro 1 Inglaterra e 1 GWZ 3 Pizzighettone 1 Galava 10 Lyrae 1 Glare 2 Ørsta 1 imporatados 1 Micrólito 1 Matacawa 1 Marganai 1 parlers 1 giromitras 1 llâhu 41 Kiki 1 Maathan 1 Kerimov 15 Gascoyne 1 ffs 5 Geysir 1 illyricum 7 Owase 98 Mugen 3 Pahanate 1 Parassani 1 Kondiébouma 36 Halen 59 florecente 3 Pakosc 1 Mitsuba 1 Granton 1 Ksiezyc 25 minuta 3 Lightweight 11 Frobisher 9 nasalizada 1 kiun 1 Myrtea 1 Panties 2 findagrave 1 Gallantmon 2 faudra 2 Mentuab 1 giammai 1 homoxeneizan 1 Kashirov 1 Liofilizada 2 Gyrodactylus 3 festoneada 1 kube 6 Laoconte 1 Pikatoimisto 1 hires 3 labraron 7 fanerozoico 1 Michíl 10 Halki 1 feligrexias 1 Maror 6 ostrogodas 2 Fenollet 4 fusobacterias 2 Métele 12 Hausskn 55 lograba 2 Kupasi 1 Nachtreiter 2 obrigábaselles 4 Loxístico 1 Kaza 1 gaiol 6 multiméricos 1 germanis 1 LOVEBITE 1 frankos 10 paxs 1 hypophthalmus 1 Overseer 1 helioscopia 1 librará 1 Macronissos 1 Figtree 1 Gæld 3 Huzziya 1 marbete 1 Gedovari 2 komandarm 1 Fontella 1 Peteris 1 Kalingrado 6 kha 1 Gesturi 22 Mascato 2 introduccion 565 pechada 1 Llanterna 1 Fromino 1 geometricus 1 NSpire 2 junctional 1 Neurones 1 Kubidan 4 McHattie 1 interconvertible 1 ñoños 13 Pill 4 Llinas 1 Hallsberg 1 Filodrammatici 7 i 2 mangleiro 3 gadol 2 melodische 21 lavanco 14 noiteboa 1 moiños 1 Filmar 2 Meloxo 1 piando 11 Martis 17 nasa 2 Gubeng 1 Grotescos 1 Monyet 1 miseiro 1 Metheven 4 filgueira 119 Pinar 1 Geuvadun 9 Lustig 53 iniciadores 2 Gazni 3 Nilton 1 Huckebein 42 Gang 1 Henrickje 4 isomerizarse 36 Levitt 1 Kalihi 2 huberiana 1 noventaeoitistas 1 Jagamarra 1 Movilizador 1 paupispina 3 Litmanen 1 hipertensas 1 Pavalar 1 Johnsson 7 parasimpáticas 2 maravi 51 Novelas 4 Perre 1 incurrido 15 Idealmente 1 ingresiana 3 Mascarin 13 intensifican 5 Jazmín 1 glacia 1 Heptalitas 1 perecía 1 lantianensis 2 lisiado 10 maderensis 1 Plantegenet 1 Notharctidae 2 Gomamon 1 multiplicouna 1 ludicum 1 fortalecéndoa 1 Lachenaliaceae 1 Incinerado 6 fios 1 Inventing 1 ghdhu 1 lums 1 montèt 5 Foliculoxénese 1 Hadrosauro 4 Molíns 1 Pantalaimon 1 Palaeoptera 4 organoloxía 1 lusoespañola 1 Oktiabrskaia 2 Jore 1 Kërrabë 1 Nestorovski 1 juiz 1 martelo— 1 paradiseidos 17 mariano 1 iratzargailua 2 Partenay 1 Platemaker 9 mandaríns 1 Kerrl 11 Newbury 3 Isomerases 6 Leaniz 2 Gunfighters 1 Mzimkhulu 4 pech 3 Herwarth 1 Menchén 3 mattina 1 newsid 1 Idaioi 1 Niltinho 1 mamaliano 1 FIFA??????? 15 hepatocito 6 petroloxía 2 peltigerae 2 kenzan 1 megalomaníaco 10 Peregrinación 1 latín anima 1 fibrosado 1 palar 1 Kebila 1 Nationalisme 2 Gudrød 1 loces 1 nakagusuku 1 nitroxenasa 2 Paysages 6 Malvales 1 Kyjel 1 frecuentará 2 horitzó 4 Fui 2 gallaicoi 2 párrafos 1 Mellieha 4 gabando 1 Gaied 1 Hypor 1 Llorienzo 1 mitsuboshi 12 heréticos 1 familiarízase 1 inhibirán 4 linguada 1 hovet 1 penelas 6 Masta 8 lúgubre 1 indemostrábeis 102 notabelmente 3 Llobatera 5 ous 1 Fuuinhen 1 Humanlooks 1 opoñemos 1 Itesiwaju 1 Indoles 1 Lötschen 2 Laodámeia 1 FC³ 20 Mineirão 3 Majones 1 manticoras 15 mollarse 5 impulsouno 40 nóvamente 2 Navadra 1 kupala 3 Lorcan 2 Mixhuca 4 Muskingum 2 Foolish 2 Phelipe 1 Faulín 1 peské 1 Kushukh 1 Niedo 1 McBreen 2 Planetarias 4 Hanuttis 2 Phutthamonthon 1 Lantirn 2 Marilandia 3 Khalki 1 Muziekpublique 1 Lúcián 1 Kweli 1 Plädoyers 4 miohemeritrina 1 moltebeeren 1 Micrococci 2 Pastic 1 Irregularisierung 7 merlán 1 Loughcrew 8 Loeches 27 Jonquera 1 lovers 2 gurashi 3 Hagnesta 1 Pivetas 1 magre 4 Metaboloma 1 Manjar 1 kheops 1 ghanchi 1 Hayride 8 pisto 1 Llenas 2 OSD 5 Nobis 1 Paulão 8 Parlez 3 Leinders 1 joilla 1 Guarulla 1 Matham 1 Hitopadesa 1 lexistaltiva 1 go'si 1 lateais 5 gnuLinEx 1 pastaren 1 Kirnbergsee 1 Østerås 8 inadaptado 1 particolares 4 Mechaya 1 Nogori 5 otorrinolaringoloxía 2 marabillaba 1 Goudkust 13 isósceles 1 fórxalle 3 Hayday 2 plataneiros 1 HASTING 4 Massís 1 Herem 1 generalidades 3 Kleinert 6 Pídelle 1 Kirkjubæjarhreppur 1 Iuventas 1 Fitzwilly 1 Merdero 4 lembroulle 1 kollektivizatsiia 3 invis 1 Meadelos 3 mégas 2 maiorìa 7 jasminoides 1 Maimoides 1 Lottoschein 3 Guamil 3 Lacunosus 1 Flechini 1 Pafnucio 9 Itatiaia 1 Maxilares 1 Itigaituk 2 ficobiliviolina 90 Lin 1 Giebel 1 Juara 4 menorquina 3 mantenemento 14 Fisch 1 Lyserg 1 Informcións 5 hyssopifolius 1 Hegardt 1 HABF 1 isoladas 1 Growion 4 hidroxilases 1 Mozdokski 23 floresiensis 1 Frauenbach 4 Minidoras 2 Gundulf 1 Pendás 1 Kapitas 1 Lijmen 16 Jaroslaw 1 Latapia 4 Franklyn 4 MAI 1 Gaidar 1 luliberina 14 Humorística 1 LGF 2 Merytaton 1 Legiones 1 inhumanidades 2 Jonna 1 meye 1 Galantes 3 Kucka 2 Ficcións 2 MARTÍ 156 Nixon 33 fecundar 46 Orionis 75 MiG 1 Niederkorn 8 Lebedev 35 Holger 1 Hunsec 1 Krasnooktiabrski 1 octógonos 1 megáfilos 1 FDN 1 Felí 1 Monegasco 14 GX 1 Nebamón 1 pheres 6 Kisbapili 1 Lierop 1 organoplúmbicos 1 Panagoulias 144 Novara 8 perdemos 1 limitárase 6 mastigadores 281 favorito 55 lavadoiro 8 inculcou 1 lueiro 4 Filmation 86 Nuevos 2 Paradysso 34 Maramures 2 lancará 1 Perdus 1 MONTORO 2 forums 1 Pitiful 1 Obio 1 macollas 1 Lievremont 2 Palmaille 1 khora 4 Flyin 1 fugu 1 Ortún 3 laptevi 1 MInistro 6 inn 1 Organe 2 hidroxénanse 1 Limnetica 1 ovoidae 2 Galeorhininae 2 hive 14 Habitada 2 Martyre 1 Panxénese 1 Pilosella 179 focos 1 Halteria 1 Hurin 1 Milaan 2 glädje 20 Kure 1 interesásense 3 grávemente 64 gromos 1 Hazari 1 organica 2 Molano 4 MemoriaIntercambio 19 Picciotto 12 Miñá 1 intrerpretadas 22 Lombok 2 minerías 3 Oegopsina 2 fumante 2 neogoticista 16 Mangaia 2 Ferromagnético 2 Milliyet 1 fotoautotróficamente 1 Ficht 1 israelis 1 Lycianthus 2 introdúceas 2 Girao 9 herditaria 1 Ostenfelde 1 outorgaronse 2 Hyakubai 3 Pacifique 2 pensade 6 GPDA 1 pansalet 1 gravalos 362 inaugurouse 1 mórtiy 9 lcm 37 normalizado 1 Gula 1 Leiophyllum 1 Iljinskaya 431 parámetros 1 gozábase 3 Natchios 1 FZ 2 pedíronselle 1 industrializa 7 Molisch 1 hierosolimitano 1 Gorgot 1 Halberstam 1 invadíndoa 1 Kvareli 1 Modtag 3 moama 1 Malamkurkura 2 Koussevitzki 300 Machado 1 Mescherin 1 Humains 6 pápulas 36 fregueses 4 Giliath 227 minus 1 KAl 1 Jigo 10 Ketchup 1 Filipus 5 Fiñana 5 Fishbone 1 Ondojoan 1 krídlovku 80 marchando 1 fleuka 9 OL 1 Javierada 1 importunalo 1 Kritikian 64 Okazaki 1 Jaliñeiro 1 Leopoldinense 11 incluirse 1 NavarraTafalla 1 Knoche 6 homologados 2 Meleros 6 Longley 10 Lembrando 1 parasiticos 1 heng 7 Obira 1 Kawasumi 3 Habichuela 3 ljubimci 8 krais 2 Hag 1 Jejak 1 glazioviana 2 Patulul 1 Hemed 2 inconcreta 3 parafarmacia 3 interconvértese 4 Issoudun 2 mastoidea 33 Hoyos 2 Lammertink 5 NNT 1 Gjermund 2 Giselher 1 offenes 1 Mulinum 20 Manganeso 3 LandroViveiro 2 gher 1 jacetense 1 Minneconjou 1 pancastelanistas 1 paririamos 1 paleolingüística 21 impostor 1 Khmed 1 NWLink 1 mangonearate 1 Javotte 1 Parcin 36 neoloxismo 1 Filoteú 1 Idah 194 Nikolai 1 fiammaa 3 Metabolism 13 isomorfismo 1 Mourtero 1 Mafomede 1 inexpresables 12 nanosegundos 1 Lesnukhin 1 Llanuces 1 Onrubia 2 Ngeneo 1 pintáraas 2 pazienza 18 fragmentouse 2 hidátide 2 fremito 1 frühgeschichtlichen 3 harrijasotzaile 7 Félicien 4 inchando 1 lavasen 1 Hiperesplenismo 1 Konpas 2 mex 1 piroliña 1 mérgulos 1 neuropsicolóxica 1 Fiapos 4 meir 60 oh 1 percibiremos 1 Honrada 1 Guinima 1 ?i?d 2 Papazachariou 1 Mumme 1 Krøblingen 1 Nyssorhynchus 1 lavarlle 5 Keno 17 ICANN 1 hipoesplenismo 1 Molnau 1 Pangantucan 74 gobernadas 6 Lod 1 Gomarís 2 farmàcies 11 mr 47 Obediencia 55 ocorrera 2 Pankow 1 gulbene 48 piramidais 18 Overkill 1 introspectivamente 1 moder 1 Perigosidade 1 flamenglas 6 fenianos 1 Kareda 16 nebulina 1 Herreria 5 Operator 1 Jaiba 10 Maga 2 Pershing 5 havet 2 Hoevenaers 1 limpárense 6 Myxomycota 25 mamila 2 Kouro 2 Identifier 6 Hierocles 2 ftálico 2 iungo 1 Korobeiniki 2 ollarmos 1 MuseuDeCaLArra 2 Hebreeische 17 Harrelson 5 Maçanes 2 ledes 1 klisurine 46 forneceu 2 Lieckfeld 2 Ichaweri 8 Manecho 2 matiña 10 Kominform 1 inocularen 1 helmintívoros 1 Orriolos 2 iwai 1 pickelhaube 2 papuensis 3 Galitoon 16 krausismo 19 importan 1 Ghikas 1 Frizzel 2 falsetto 199 Nebulosa 1 Gwyl 1 laMarina 44 fundir 1 localizaremos 1 incapacitaron 1 Ghartum 1 normlmente 1 giada 1 librándoos 2 gliotransmisor 1 IHC 9 oníricos 1 Lanero 3 Paasikoski 2 Manresana 45 Hung 21 Madura 1 Helmsko 71 Holthuis 22 Hormonas 1 Foveolas 6 Gakuen 40 obxectivismo 2 Gyunyu 2 monoacilglicerois 1 Mnemonics 1 manganí 1 nicaeensis 1 Pipirig 1 kurtar 1 Meixoa 1 Federali 15 Myra 1 lastradas 1 LaTex 1 monfero 1 Gedovári 1 Gutenberg? 44 Manacor 5 Mullidae 1 Metzner 5 Masataka 9 FINSA 1 Piringuel 26 Pedrera 1 nigrolineata 3 pentaloxía 2 NEZ 1 Orsen 1 Piltronera 10 naturalizou 4 fragancia 1 peneróplido 32 focais 1 Notizias 5 fuagrás 2 kuanyama 5 Necronomicon 9 Inclusión 5 MAPT 1 pinnatinervadas 1 n?H 3 Onecca 3 palindrómico 1 Herbstrast 1 Lexilogos 1 Felpham 5 Nguni 30 Impostos 1 LADERO 4 hesperidios 7 náutilos 1 mareleiro 2 Krzyzanowska 2 Neots 6 masacran 1 Obake 2 inadmisible 7 Lesage 184 Novoneyra 1 Itsatawi 2 opb 2 fimtan 3 organizaranse 1 Horrilo 1 inmunomarcadores 1 negáis 11 olvidada 3 Hérouville 163 Petróglifos 7 Hoffa 1 nivalenol 3 mugardés 7 henges 5 Hirudinea 2 Matrimoni 1 Kniazza 2 Navianos 123 ninfa 1 Marobodus 1 Piedrallana 1 Mamoranguá 1 Olivarii 1 OLO 284 oliva 1 Humanisten 3 Lenaers 1 LEHNINGER 7 Gomaespuma 1 glicerofosfórico 1 gåten 1 Jovovic 7 HCOO 2 medrarán 5 Ovibos 3 Kabezabolo 3 Parvizi 5 piemontesas 1 kuekenthali 8 ferrosilicio 3 Pertigueiro 1 Nyctimene 1 Frutillar 3 houbestes 2 Ouadhia 1 Farmakonísi 2 Monelo 1 katarsis 5 Parche 1 hesychía 1 Fidelísimo 2 GSLV 1 Kauribaums 2 indicaren 132 Journal 4 Heisman 2 liturxicamente 2 malladoiras 1 Perennidad 8 instrúe 1 Lódz? 2 invitárono 1 Pasieguería 1 ídes 1 Murzás 2 Medrán 2 Pitar 3 instituíndose 1 Mondejar 1 Macrophague 32 Hainan 1 Kyoui 4 mazorca 3 pectenotoxinas 1 Joze 2 Flotsam 1 informació 1 Koltsevaya 4 Generaal 2 ntre 2 FRM 1 garantirmos 2 kolme 1 Faritius 2 pasionistas 1 Leizhou 1 implicaciones 3 Falticeni 1 Meex 1 inscribiuna 3 maiea 5 glicocorticoide 93 Lyoko 1 Grimaux 1 GBU 1 MiSeq 1 Moraschini 1 Layauté 3 krempfii 6 intraperitoneal 1 Madaíl 1 OCLN 72 Palazuelos 1 Glowna 1 Móvete 1 Noèlia 1 Medalowy 1 Melhoramentos 1 Hureau 1 Huxham 1 mçáis 2 Plagiostomen 1 Fevvanus 2 literariedade 1 lisuride 1 Physeterinae 1 gomerulonefrites 4 medicamentosos 2 hollandicus 6 jedan 3 ljubezen 1 Findlaya 1 ganderas 1 nonato 6 plasmaron 30 Mariñán 1 panqueque 1 Ingmarssönerna 1 Perdedora 1 Paleobabilonio 1 Konitanitai 4 Peitorís 1 Ghjorghju 4 pareceren 1 Larrinagatxu 1 Karrena 5 Mirade 10 liebe 2 passacaglia 1 Glacé 1 Ngengi 1 Graforsa 1 Noordeinde 2 Horajti 11 Monteseiro 1 Galinier 393 localízase 1 perfilábao 2 fixerono 11 Nates 1 Nakitoma 5 MACUF 2 Miltar 1 Mueveté 9 hadiths 2 imhausi 14 habilitada 163 lucro 2 Lemire 1 intoxicaxión 8 Panspermia 1 flotadora 2 fidem 9 Nevin 1 moque 58 IDH 1 fangchengense 1 Móvile 4 habedes 1 Gaulmin 327 invasións 1 Namakaeha 1 Kommunistinen 1 Interamnicos 13 Joffrey 1 Isèra 2 Padam 7 Nabla 86 perderse 4 Lizcano 1 Kersch 7 muiñada 1897 Lalín 2382 Miño 5 Gjoa 3 Luzerner 1 nannus 2 Namazonurus 342 faría 3 Oisc 1 methemeritrina 12 Mami 1 inversible 35 mos 7 Fregata 1 Hirotaro 1 lespinassei 5 Mentraste 1 pérfidas 6 pescarse 24 parmesano 1 Ototsu 5 festexada 1 Lacandoniaceae 2 Lurbe 19 Gillo 11 Murtaugh 8 ovoidea 8 Marth 101 Núcleo 1 Heracross 1 ieta 1 Fitzball 4 paleográficos 1 Nepisiguilt 1 milloóns 2 granulomatis 1 mirceno 1 Geschichtsphilosophie 279 matando 1 labacensis 2 Khar 3 Miróforas 1 franxeantes 4 Oswego 1 Gugina 1 pastizales 2 Mastaga 4 Piovasco 4 Khalaf 1 nachte 3 Oibás 1 hH 1 Molzhaninovsky 1 Kronika 1 Ilawod 5 MsT 4 Iddio 1 lactonase 1 pispilete 1 Fontedoso 1 microclinas 80 Gasol 8 griffón 1 Monfarracinos 1 Petan 1 Llarvén 1 Lunyu 1 GUCharMap 1 FLY 2 holocaustos 1 imy 1 Frangipane 4 gravitan 202 ma 3 Ioannides 1 indagaron 1 kyaropterygium 1 Materiya 2 Ovide 2 maiuscula 1 odam 1 Líric 1 nubile 2 irradiarse 1 Pesadamente 1 Oryctina 2 nervus 1 kahdeksan 1 Odditties 21 Olivar 1 Lindesnes 1 maripicnics 1 Harmsia 8 neuromelanina 1 Interlocutor 1 Floddaymore 605 outeiro 1 linolenico 11 fontem 40 Papageno 3 Lusinchi 3 geurea 1 Isilda 37 Luciana 2 Mohrenwitz 1 perdoabs 28 Onyx 1 Homorod 103 implicar 2 Moravané 1 Laska 4 Jubilate 1 Helvii 5 irmanamento 7 Lipase 1 gewidmet 10 organisation 1 Mdalitse 1 Ontenor 4 marcante 1 Honingman 13 Hays 1 Ieta 2 froi 1 medallístico 23 platillos 3 Kippure 1 Kylami 1 Pelkosenniemi 1 Lupión 1 ncia 1 Idomu 2 Liteira 2 Hypopomidae 3 nummularia 1 fosfátos 1 inventarán 3 Insert 1 outubro— 1 Mopaliidae 1 ferramentos 1 Mârsa 1 lysiphloia 2 Oberstein 3 Kostenski 4 liberalas 1 kalnas 1 Moretum 2 Hursanassan 3 intégrale 75 Fellini 1 Nativitat 2 obtese 1 Khorasani 1 manejan 3 Jayme 2 ocluído 1 lJ 1 Macchangolhi 1 Maunagh 1 peterseni 1 Panebianco 1 hachádegos 1 Fortunière 1 Planinc 1 Grandísimo 9 Knoppix 1 Fosili 1 Mhlanga 44 frascos 614 Novas 1 Pentatrichomonas 1 Koryaksky 1 Levée 1 Fânia 1 íanlles 2 Lisset 1 Pantálica 20 GalNAc 1 Paraje 6 NOSS 4 Obriga 1 Fowlsheugh 4 Kapur 1 Jiaxing 2 konvertibilna 2 Mez 1 Pentatonic 3 Piedralaves 1 Mythologiae 1 Orthopedic 1 Lobulia 1 Kaminer 6 inauguraría 1 Ichthyotyrannis 1 Fiaños 1 Oncosiphon 1 Guarronas 1 fermentati 3 Marcada 1 hálices 451 obtido 1 Kyotekitachi 3 Lundström 1 Orelas 3 Morelle 1 liróforo 1 Hanzhou 1 papíraceos 1 ghjesgia 1 ikrá 55 Lepanto 1 kitakita 1 JAHRE 2 obrigáraa 1 metonimía 2 Monographien 1 Lenias 1 okryljon 1 Nogués 1 Javitu 1 Fflynt 2 kets 1 Ostens 1 Loxogrammaceae 6 oceánide 1 gnawa 16 Måns 1 Negaso 1 Marchs 7 gratuito 3 Künstler 1 Lolua 1 hýle 2 Hammarsten 1 ñevar 1 Mailard 2 guíndao 1 oare 1 Kirimobenecyo 10 genin 22 Pazzi 2 millefiori 1 Lariz 3 Glubokovksy 8 petrosa 2 Manoao 73 infralitoral 1 JSPJ 1 Homocistinuria 1 Hemetsberger 1 indómelya 2 mecanorreceptora 16 Lawton 1 Llanillos 1 Maarouf 2 Gadsby 1 Llampaya 1 planispiraladas 1 Iadaim 1 humorosamente 4 outonais 1 Licurici 1 lexicograficos 3 Gelem 1 Majikat 1 Graebner 1 iluminabase 1 Jamali 1 Nemura 91 Helios 35 Palmerston 3 Mataojo 1 Pirmin 1 Hellary 7 Gudu 1 Paleography 1 pivampicilina 6 Obligado 1 Matana 1 meterese 7 Katsumoto 26 hidrófilas 2 independizaban 1 miniaplicacións 9 Platé 3 Moeritherium 139 integrais 4 Libero 8 Juive 1 numerosísimo 1 lanzalas 1 Oberems 2 narodnaya 1 Ibiúna 1 Icerya 1 niniunha 1 Hygini 1 Hügelland 1 Mylopotamos 2 Hürth 1 Gorimon 16 Misery 1 Inupiat 3 meyeriana 1 Kyofu 1 Pedrazales 1 Gryglewski 1 Nimblgen 131 ocasionais 1 pire 1 fjärdar 5 Ollé 2 Gummi 4 Millsap 1 LuaLua 22 humanizados 12 mitomicina 1 paneras 2 Motels 9 Hiti 1 Kyrghyzstan 1 ?arb 2 felibre 1 Fazaña 1 FPLD 6 isopropílico 1 Fotemustine 5 Morphy 3 Guimaras 1 meint 129 outrora 1 knépa 1 Kortzfleisch 16 Jeepster 1 pandullo 3 Geranio 2 Niska 1 Inishgort 1 Mobilízanse 3 Fallingwater 7 grunerita 1 mélodique 1 openstreetmap 4 Litespeed 1 moumear 85 fosfatídico 7 Khorat 2 Grã 6 fleuves 1 Perwez 1 Formarán 1 naufraguen 8 Middlebridge 6 Michelini 2 mimetizado 1 linearidades 1 Grusky 1 FOETORE 1 Magueija 1 ga? 4 Pierpaolo 1 Nattoku 1 Panteleimonos 1 Laik 1 Philonus 3 locativos 1 Fenouillot 1 Pavarna 2 Guenguis 1 Móskhos 1 iutungos 1 Mitteilungsblatt 5 maleato 3 Patriotismo 3 liquidados 66 Labarta 5 Pinnípedes 3 Hirotsune 1 Llounguís 1 Oxika 1 Helot 1 Navalporto 2 Patoc 1 Fulkila 7 mairei 1 fruticencia 1 incumpriran 4 howensis 19 Pacifico 31 grotesco 3 Globuloviridae 2 Gabae 1 Persõa 1 fiso 2 Muldaur 2 mòrt 5 microspora 34 hiperplasia 99 Neles 1 finalisatas 1 Filador 1 hayy 2 Ireré 11 Hadar 1 leituguiña 2 Modificar 1 infectos 1 gamboinos 2 moufadas 1 Nlc 1 japonês 3 Kubani 7 Guiance 1 microcorys 1 linfo 32 host 2 fotodiodos 1 Ginestarol 23 Fortunata 1 piojos 5 Operario 1 Miñao 2 microtubulares 121 Madanela 5 Heels 1 jindilli 201 Händel 3 kotobi 7 Migennes 1 Pantis 1 Frâ 15 inspiraría 3 paramagnetismo 1 gravidezs 3 Kyoga 1 Mórrense 2 fiestraxe 1 inexperienza 1 intelectualistas 1 moina 1 pangasinenses 2 genealogia 8 Litorais 8 Peacemaker 2 Gulkevichi 6 Phatthalung 1 lixenses 60 pingüíns 1 gastrólitos 1 Lionés 9 Lembeye 1 Mbrostar 24 Nom 1 Hvalfjarðargöng 1 occulus 2 Guadiela 43 Millawanda 1 OSKM 2 Fuksas 1 Palantia 36 Information 1 metaciencia 1 Maschwitz 3 matsumurae 1 modificacíón 1 Godmanchester 1 loua 1 Imbarco 1 Melang 2 Hipospadias 1 historisk 2 INCI 2 indischen 1 geschlagen 1 Julanne 1 geniano 2 Ömer 1 oteiro 103 Juncal 28 Lampreave 1 fotificación 1 galka 17 osmio 14 Mudarra 1 Liepoja 1 gelatina 1 Farofa 4 Kompañía 1 lorenses 2 Ninib 2 Karangasso 2 Jämsä 17 McShane 1 pericranio 1 kåstar 3 kard 95 golpeado 1 Jhan 1 Mallahle 117 napoleónica 6 Frogs 3 organizativamente 1 Ignácio 2 opércula 4 Hemipléxicos 1 futbalový 1 heta 60 Niue 1 klæder 1 Insiño 1 grga 4 Friedenreich 7 Nariz 8 FILLO 1 Frabitas 4 mesolítica 3 Grützmacher 1 Idamantes 17 maestra 21 Matela 27 jime 246 og 1 Mixoploidía 4 irascíbeis 9882 Non 1 Ochienta 221 mover 1 janusonline 2 morirá 8 Koguryo 1 Pandon 1 orbaind 1 migueletes 1 Giurgila 1 maquuinaria 419 Moldavia 1 picoreiro 4 Flug 14 finaron 8 Piantadosi 2 muffins 1 pagábao 1 latior 77 fauno 1 nanofanerófito 1 individiuos 25 Jamahiriya 1 farmacológico 2 Ferch 1 norío 1 Micologo 3 Papakura 1 Kynodontas 1 Kakumäe 2 linei 219 Gibson 1 interpositi 7 mellorasen 3 netorras 1 Leq 1 farten 1 Lakalai 1 Morfín 3 francosuizo 1 optería 1 Formúlanse 2 Gortchakov 2 Ferghana 1 parabuxina 1 Goreiro 3 Itxoiten 5 muita 1 Nabemono 1 nasXubias 3 Gravetense 30 Narbonense 1 Memphian 38 inconscientes 1 Hidrograficos 1 j??d 2 Onormaco 2 Matches 1 monoespazada 4 Lucid 1 Pisac 4 Guntis 3 Gourette 6 Longer 1 Freydell 1 foguetas 2 Gotzon 15 Gera 1 osteoadherina 1 Grandeses 9 Laverne 2 papiá 35 mutilación 2 hottentotta 1 meniscectomía 1 Metodeje 7 oreja 1 Pinarejo 33 Nimes 2 InterAgro 46 innecesaria 1 graciliformis 2 Nakaghara 4 Months 1 lingoreteiro 2 laxiflorus 2 mesquindades 29 IULV 1 Monuera 5 Gazi 5 Legionaria 18 Pippin 1 jojoto 3 Morandé 1 pípá 1 Lalaua 1 Masover 1 Mately 1 Liina 25 linfática 5 LaMotta 7 Passeri 1 paradigmáticamente 1 iodopovidona 1 mkh 3 Nukapu 1 Makey 361 Filipo 1 gwich'in 4 Lexionario 1 Krasnokokshajsk 57 fermento 2 gq 1 gutia 187 Largo 2 Ocasional 1 neofiguración 15 Koichi 3 Ocultismo 12 Guardés 1 middangeard 1 Nodarse 1 maqsura 1 francoib 45 opaco 3 Luard 1 kisat 22 Glòries 2 molinete 1 Monjuïc 1 Indogrego 1 petasus 1 fatales 80 integrando 2 ortegano 1 ouzades 11 perversidade 8 Orca 1 NixeriaLiga 3 Nosed 2 Ovidijus 1 galiciahoxe 1 Kõigi 1 piroxénico 1 midisa 4 libéral 1 Hwasong 33 inclínase 1 Hortator 1 Farmacoxenómica 2 Hölzel 5 Heusay 5 Giove 1 Ghédalia 1 Myoho 1 Highton 1 Organizando 1 Hilleriaceae 1 Pietraporzio 3 marcaríase 1 Hruni 10 Hempstead 1 Gomedei 44 HF 1 Gatine 1 gradi 1 Hemavati 1 Gossim 1 Ostal 5 Guria 1 neotrobadorescas 2 fetge 1 Fusionopolis 3 IBE 1 isofagomina 2 langhostino 2 Ishizaka 1 ibicenca 1 Malto 1 monostrato 1 Moravie 1 Flø 244 integramente 4 mierense 1 Llong 8 MAIS 1 orm 1 Liudprand 1 Flammini 1 impulsividad 3 mama 1 ouvrières 1 Kaisers 18 LIX 1 Nemnivus 1 Internacionalizmus 1 mincaronei 2 Hafrsfjord 2 oop 5 Ituero 4 Kosaku 8 Ortuella 1 Loizaga 6 Paraquat 2 lavala 3 hablarte 1 Inzada 1 GACÍA 2 pat 8 Neutrino 41 mandara 1 Melanocyrillium 2 Malamente 1 Ivanovice 1 hexería 2 oligómero 1 Pankreasdruse 2 fcgi 40 flaxeladas 30 Lepus 200 intérpretes 1 Incompletas 28 nerviosismo 4 infrinxindo 1 grancanaria 1 Galvanismo 3 fragancias 3 magnetostática 111 infinidade 1 Mopán 1 megaproyecto 8 Pello 3 justamente 1 pestare 3 Huecograbado 1 NxM 29 Jamison 3 minhas 2 mouettes 1 inverosímiis 1 galocha 25 Paavo 1 GUERRA 1 perifería 4 Fileo 31 granel 25 Metacritic 2 Jób 1 Jalhay 1 Keirsey 5 milensis 2 Inulina 10 isentrópica 4 Habitaban 1 Maragouzos 5 kitesurf 1 Illustres 8 pénsese 1 munuscula 11 Langullo 1 lipoplexes 1 Koax 4 Konishi 19 inxectados 1 intectuais 1 Mithraculus 2 Incal 4 Kosma 1 Hoàng 3 obsesionarse 13 olvidarte 3 Kauravas 1 Moscosas 1 Lovada 6 historischen 4 insurrectas 119 motín 4 Kras 1 jegoz 1 Janaína 1 Murt 1 grandiño 2 MTI 1 Mnari 1 Orokamono 1 jaume 1 Lothier 1 Kankaven 1 Occidiental 1 patengensis 1 Lindsaea 3 justos 1 Homalosciadium 1 Pegmatita 1 Picroceroides 1 Génoise 22 medal 9 Ondarreta 1 lingïsta 7 honroso 1 FASL 140 Hemisferio 1 noctula 1 Janty 39 Gloucestershire 24 paseniño 1 Organizábanse 1 Gélinotte 2 Graftal 4 Hermínia 1 GETA 1 Finioù 1 minuncioso 5 Kochikame 1 Giuvarasti 2 Fotoxornalismo 2 hanga 1 Hejlsberg 8 Fullós 8 Maderne 1 Mandárono 1 Lorenzkirch 3 Kpopwiki 2 Ovíparo 13 Indicar 1 morrisonense 1 Guilderstein 1 Melanocharitidae 1 Mattkara 2 julis 1 Genabarri 1 Mengao 1 Harrock 7 Parental 1 GLERL 2 Graecopithecus 10 Pd 1 incierrada 2 líquído 1 Kevlarsjäl 1 Musicos 1 koleso 1 permeada 6615 Imperio 2 honanensis 1 Nycterium 3 ionosféricos 1 Núpcias 1 MASCVLVS 10 Meyrink 1 múltiplemente 1 guacamaio 1 Gayatri 6 HDMI 1 McLeodove 3 Moyua 8 Pajín 1 Lehkonen 4 Montané 1 hispaliense 3 Fiorenzuola 3 Gosztonyi 1 Köni 2 Felicissimo 1 healyi 19 planean 3 Merola 3 Illuriya 1 guewel 4 Khulan 10 nómadas 4 Firdaus 1 OldmanStorrD 3 infundiulle 2 Francoaceae 5 Monoplacophora 1 maredut 1 MISTERIVM 24 Phipps 2 Kalashian 1 Hayi 1 majoranoides 1 Gracac 2 japonicarum 1 koniaga 17 líñas 1 Kechrias 1 Kenseito 1 jovidonai 1 Filómetor 1 Navarri 1 nervifolia 6 Mazilier 295 pano 23 Laurenti 11 Persian 1 Marxinados 4 Gistaín 1 Newsletter 3 guialo 2 Fervendo 3 ISRI 3 Gastrónomos 9 ogv 1 mutulus 1 inauguradoo 1 Krasilnikov 1 Intertidal 13 Galuppi 7 nichts 1 Kaolines 2 inmanentista 1 Hexepta 2 malamemoria 1 Pitaevskii 2 mándame 2 Maribolheras 1 Kunjang 2 Justiceiro 1 ISSRA 1 Pináceas 3 integrases 2 haiMais 1 Lepisosteus 17 Fotografia 1 maiador 2 ogn 1 Moortgat 1 Florixel 2 gritaron 1 hemileucus 3 Forónidos 5 pásao 11 Ladróns 6 insolente 1 ollywood 1 immunoglobulinas 1 iugais 1 ör 2 ganados 2 felandreno 1 Midpassage 1 mengeriano 1 Janowska 3 Hillegom 1 Operar 1 Omyodo 3 Groat 2 HOVENSA 1 Kapote 17 Ideou 1 piropo 5 furaño 1 incombustibles 1 kalveet 2 Larcombe 1 mule 10 pietra 1 Panzhihua 1 Kapellebrug 1 fanerogamia 4 howellii 1 Llevarán 23 Láchar 1 Nickelson 17 oriúnda 1 impartira 1 Mangyongdae 8 Pistis 12 investígase 1 Moiz 1 Gecarcinucidae 1 gordonorum 1 Fasca 1 GCHI 1 pietre 68 fallaron 1 Naturalismus 1 Filanovsky 1 nigrománticas 2 Makham 2 Oudrid 3 levoullo 178 motivou 2 PIA 4 Ghigi 1 Minipimer 1 malfeitoría 1 Geffroy 1 Frixias 1 Maspujolenc 2 fosilíferos 1 Niguarda 1 pasazeiros 46 Impresionismo 2 pentes 22 Göran 1 incompris 3 irrecoñecíbel 1 liscanzo 9 Kazuma 1 parâmetro 1 Orcutt 1 LEVARE 1 musiikkikirjastoyhdistys 9 Judenrat 13 Magre 1 luchaban 1 Pforzhein 1 granadensis 1 Kamiguiou 1 Nothelfer 5 Fulk 4 Jamma 1 litwonowii 1 Ndete 1 gaivotíns 5 Fets 6 Öresund 1 hidróxeneo 1 Oughta 285 modalidades 13 pied 87 Nigra 197 hardcore 2 Fedekam 1 Hannappel 1 Faloria 1 Intyendeha 1 llegarás 2 Jastorf 2 ordeaba 1 Leefolt 3 Großglockner 12 Indoeuropeos 2 Noelie 1 meridionali 1 Navigasa 1 imbúese 1 Gaudila 1 Fixador 1 Muile 1 Guern 1 Mastjoh 1 navigables 1 Megías 1 instituíra 1 ModiglianiPompadour 1 inmortalizaron 2 lembrarlles 36 micronutrientes 1 Nisou 1 Pirosfera 1 Interattiva 1 Pashutina 3 Kiraly 1 hístor 9 Labán 3 nonilfenol 1 Mazjels 1 Pic 1 Mentel 1 IPL 1 Kabay 2 Holsteiner 2 obstétricos 2 lizgairo 11 Pentecostés 1 fibrinoxenase 1 gobernárona 1 metejón 9 glicinia 2 Gillerme 1 Kotova 1 Outlawz 1 Landschaftsräumen 2 Mouzós 1 GIREA 3 Papiamento 4 pedrafita 12 Hauptman 8 Gibernau 1 inmunoafinidade 3 munus 2 Faumuina 1 Lansdown 1 Invernizzi 1 Iunmutef 1 Gordelekuen 2 Larriva 3 Forsbacka 2 lloba 9 labiadas 20 finales 2 Mueve 1 kunkelii 1 Mogg 1 Kiyoko 3 Oliphant 1 Paradai 1 Mcduffie 1 Mômes 2 microcromosoma 16 Oates 6 glauberita 2 gm 170 Gredos 1 Mianrud 1 northumberlan 1 KFUO 1 Gubegna 1 maddenii 1 Heissmeyer 1 Labeaume 6 PalaBassano 1 Mezgec 2 Ledebour 5 Heaviside 1 isotopicamente 1 Intitución 7 pentámera 1171 Oza 2 Pezzati 1 fotofrafados 6 pié 899 metro 1 Irawady 2 hipokalemia 1 Metalogenia 1 imafukui 1 Fatmire 1 maderaxe 4 Hanif 120 insistencia 1 hidroxeolóxicas 5 independizados 1 Filatrault 1 Mashael 1 impoñíao 6 Lint 1 kibbutznik 1 Kroptokin 1 Giebnegáisi 1 Perillote 2 Fräiheetssonn 2 Offret 7 Koga 5 Kirjallisuuden 2 Kartoffel 1 Gardías 38 Manter 2 Flume 2 Lambsbread 1 Hondorff 2 Muric 1 Maliutka 1 hidróxilos 12 Fuenmayor 1 floccigerum 1 Karimi 1 MANDOV 1 Mooris 1 mantenilibidade 1 Koppen 1 Komaros 5 Kaneshiro 2 Kondratjewitsch 1 personerías 1 Planctosphaeroidea 2 jér 1 Fúhào 7 Hulot 3 peldaño 6 leitmotif 1 naturalistischen 1 Martinenc 8 Hohenlohe 330 opcións 1 Hogei 2 Kremlinoloxía 2 Limea 5 passione 1 fixaríanse 1 Halseth 1 fertigstellte 1 nPa 3 peccati 4 Indépendance 2 jose 4 fásicos 1 Opatoro 1 Oxa 1 folíclos 21 gregoriana 1 Gralleiras 2 kafkianos 1 macrothyrsa 1 Fogbound 1 Oberkorn 1 fregamos 3 Luandino 3 Mänty 3 Pentraeth 65 Pakistan 1 petronila 1 Géhu 1 lamigueiras 3 influenciounos 2 lingüisticas 1 Franklinita 1 NARK 1 Kanakas 1 patrimonializar 1 Pasaconsol 1 karr 1 Manious 4 Ninón 10 Più 4 NPS 1 interveniente 27 OSI 7 Photographie 1 Jagier 4 paragone 1 guíaos 1 Kuadrilla 11 Fredrick 1 Penetrator 1 Gulfmon 1 Lechada 1 louksno 2 ovulíferas 1 Labisse 1 Interatlântico 4 Hacha 1 Harnick 1 Orontea 1 Kilómetro 9 Jacaré 18 perturbado 1 invesatigador 3 Magenis 1 Ihsahn 2 Partage 18 ignórase 2 Iainarchaeum 7 indústria 2 Iasi 3 Pfeffer 3 Matchstick 1 metalismo 57 liquidación 1 Henderland 4 mimêlekh 2 famlia 2 Omilami 1 flake 2 insufladas 20 incana 1 Osedaxspp 2 Imalhayène 1 LIPG 1 nutrólogos 2 ombrófila 2 Naikoon 1 Mordhaus 2 frisga 1 Kaabil 14 Nugent 33 Invincible 3 Némirovsky 4 IxSC 2 Mezclas 1 osmaterium 1 larger 2 Guilhofrei 1 maxisterial 3 imaxinalo 1 neoliberalista 1 igualará 6 Krasna 1 Inhul 2 Mujães 7 indecisos 2 ?iriq 3 Franze 11 Llewelyn 1 Peñajorao 1 menga 11 OSB 10 fiscalizar 28 monoclonal 1 Grece 19 GreenEDGE 20 Maurer 1 inconstància 13 MacCarthy 269 mercadorías 1 galarías 7 Molen 269 independentista 2 Kosan 3 Königsberger 1 meng 95 organízanse 4 Matacán 303 Night 6 Kardelj 9 inamovibles 33 optando 1 Gwozdecki 2 moomintroll 1 festexarían 17 Irigoyen 17 NatA 3 forint 1 Landsman 2 freecad 3 ??ouréu 4 inzaron 2 Malopolskie 3 Lendakari 3 Lardizabalaceae 1 jikiden 2 phobos 16 implantarse 1 Fifpro 1 Pelarco 2 Hagadol 1 Loewen 1 gradualizala 1 Huaihe 3 internalinas 1 oseointegración 8 fidèle 14 Guthrum 1 fotosíntes 1 Fântâna 1 ingriedentes 1 Plasmas 11 GAM 1 Madekwe na 1 madraba 3 inspeccionaba 1 Peich 1 Flabelina 2 mwt 1 guasu 296 inmunidade 11 palantír 1 Mauzey 1 obervados 1 ferírase 78 ourizos 14 fatale 1 fomentábase 1 Nede 3 fraternité 1 Padius 3 Internaciona 3 KAI 1 incomódano 1 Newmeyer 1 mucopurulento 1 méprisé 1 ISSED 2 fulereno 2 leksikon 6 JI 1 inmediación 1 jerivá 1 Mácher 1 Itié 3 Impaciente 1 Hidroxilación 1 fúndico 1 Plagiomedidae 1 Nishiizu 1 Medininkai 70 Iniciativas 1 Geschichtstheologie 3 Novatos 1 Florès 4 Morgarten 3 industrializáronse 1 Leonnorios 1 Ghakuba 5 Nanning 2 Fertolpo 17 pareja 1 juridiques 1 Lagostrophus 3 Fontegrande 41 Gable 1 incisodentata 41 hábiles 1 Parenquimáticas 1 heroísmo grego 4 khunsarí 12 Junqueras 3 gominola 2 Jacobeo 5 Hoese 1 Henford 3 Mârsa 1 imoportante 3 Irasema 1 Friesenheimer 28 logre 9 Krull 1 inicíaronse 5 Germana 1 Godâvarî 21 Loxicamente 1 Midila 3 Kasba 8 nadir 1 husten 33 Paralelo 1 Hildegardia 105 Malus 10 Gristle 6 macroglía 1 interdisciplinariedad 99 micrófono 2 Moscatell 2 Grosics 1 forficatus 7 orgullosas 2 Fuligule 3 Nomos 1 Naimark 2 integrat 1 Kruppel 9 Mastia 1 femminino 2 Massot 1 Hontanaya 2 Geistes 6 Meikle 1 Karak 1 Forlanini 157 gr 1 oreientación 1 Maseiras 1 Nazábal 16 idilio 73 miniaturas 7 koru 1 Natsuoto 1 Finaldi 2 piodermite 9 mediáticos 6 miotónica 2 Penises 538 gregoriano 3 Ildico 2 Platek 2 Olegs 1 neretvanska 1 Haillan 3 Formatea 2 Mamlaka 1 laula 2 Outremont 1 Jemeil 1 Jezu 3 Finders 3 Fracastoro 1 Jaktorowka 26 metafonía 3 Myr 3 Licensing 1 Irreconcilable 1 Matherne 1 Halfbread 9 medici 1 Muttoni 1 marceronsas 1 Hyakunin 13 padecendo 3 Logik 1 Nanxi 8 Galis 1 farctu 1 francogótica 3 Piroxeno 20 granulado 2 Grässen 2 Jasikevicius 2 fonds 1 octadecilsilano 2 paleoclimáticos 1 Gurthang 25 hídrica 1 moytos 1 liliputianos 10 Floriani 20 MWh 10 Harpring 9 ovidutos 1 fascitis 1 Luenga 18 Introducido 2 Lakposhtha 11 ininterrompidas 4 narratio 1 mécanisme 1 Ganay 1 Materterae 1 Japan 2 fáltanlles 1 Leopol 7 Koto 1 Izumida 1 masticata 1 Gekomon 120 observando 1 movilízanse 1 Fortapàsc 1 Méthodologie 1 petunóidea 3 monoacilglicerol 1 Plainview 1 Koshetz 3 Gallicis 4 Granaderos 8 holoturias 4 Ferragudo 1 Maddenin 3 megacariocitopoese 109 Pichichi 2 Pahua 1 forzads 6 MVA 1 Karai 1 obrazy 238 gov 3 interrompera 1 noit 1 parametrizados 1 Menesto 1 noun 1 Noniashvili 2 Lidgbird 1 Nicollo 1 Gradeira 1 historyofwar 2 Miralrío 1 Inaugurábase 1 miltefosina 54 Miq 1 Naproxeno 2 Lazharia 4 guard 17 mociñas 1 Metamorphosing 7 Musicians 1 kali 1 Lubabalo 1 París e 2 orientaba 1 omikanto 1 lauzti 1 oligofrenia 1 McClaughlin 11 Lithgow 5 Mullo 1 Gerratana 1 —latina 1 Mymba 1 Philippikos 1 Hédin 1 ?usayn 1 Lubliniec 1 Norrön 2 Paganelli 1 Happonen 1 Gottasecca 1 Irudi 2 Gerbier 11 Fontanella 14 Geyer 1 lampate 1 Maladetta 2 Papalagui 75 feixón 3 Lobanovsky 100 fibrosa 1 Juvante 2 Maillo 33 lumínica 3 geben 1 LaFlesche 2 Jóusè 1 Ferdizendo 33 Farnese 1 noveldense 1 Pfandl 1 perlan 3 Hóng 18 Hr 1 Paxtitlan 2 Moonbite 3 hipermobilidade 1 multitentaculata 2 modernizan 1 gewünschte 2 Germagnat 1 Heder 52 inexistentes 1 Kompresilo 1 hoti 1 Gamberale 3 Frédérique 2 merx 1 leváronlles 30 kanamicina 6 GUC 1 mabouia 2 ignimbrita 1 Moedt 3 Llévame 2 Hiep 12 Feliks 1 Hélene 3 Mazarife 36 Moines 241 Mann 1 Hallotidae 1 Johnni 5 Mudou 3 Iwatallisa 7 Loaysa 1 Litubert 1 gear 2 influírse 1 Kiili 1 pesoa 1 inconcreto 4 Ogodei 1 jugues 1 Hinmno 1 iariguís 2 Narrar 2 Ingenhousz 1 Heterodoxia 7 Norteamericanos 12 ficcións 3 Montibus 1 Patentouna 1 oldhamii 34 Gide 1 Fidenco 1 muxes 1 Letrak 1 Iconoclasts 1 longeinvolucellatum 1 Ömre 2 Fulford 5 Meera 1 gasaliones 22 Orella 33 Phyllis 5 Lastur 1 Isahaia 2 Gozen 1 juniperata 1 Gliadina 4 gavines 1 GVPC 1 fendrin 10 Inuzuka 1 fixábanse 3 Paquimeres 1 Kulturexperimente 1 infrmación 1 Hormazábal 1 Jermaniya 20 plantáronse 1 mediocentro e 2 formade 21 Gaunt 1 Occidenta 5 Linguistik 1 FCKeditor 1 Filábride 1 Karobieta 6 favoreceren 1 Maoxu 1 nolano 1 KLVFFAE 9 Lotaría 1 Monseiván 1 Keppaku 1 neoplaterescas 1 Millionen 3 picari 49 pedazos 805 Liberal 4 líbido 1 Gtn 6 Hervés 4 Haladaptatus 1 Intercoreana 3 Pireiro 2 Magadhi 53 Menem 3 fluíron 1 FECOGA 7 manufacturera 1 mediríao 1 JXZ 1 Mouráz 1 osmos 1 Freudschaft 5 Landaluce 2 fatt 3 Guyader 1 mohiniyattam 1 Jéfferson 1060 opinión 3 Grisallas 2 Montalgrao 1 outorgándolla 1 Gigantoid 6 Masanobu 1 homomericamente 1 Kiørboe 1 huitznahuaque 1 Fhaiche 18 Medran 1 Heusghem 44 Pennant 1 hititólogo 2 Futuyma 11 Irmandiñas 1 fecundidad 2 Fisshingu 15 Fejér 4 neostigmina 1 Iorii 11 Giang 1 houstonense 1 Merás 3 Larrasoaina 5 Pärnumaa 1 Pankov 4 Okuma 2 Hidratación 5 Paraguaya 6 fetten 3 Hagurosan 1 goldcrest 2 Ñíguez 1 Nonnatus 5 GRUVI 2 kalos 10 Palavras 1 menceys 1 Guernal 4 honos 1 Ozmanidae 1 Payasito 5 Macrina 1 Lajeunesse 3 Metaloproteína 1 hodit 5 Mychal 2 McNeal 1 Mikumo 1 gastropodo 2 PFKP 1 KDO 19 Ostentou 1 maieiro 1 farn 4 ferraxaría 1 Maestá 1 Khorkhoruni 1 Franckaitita 6 lander 1 monoléticas 7 IIIB 25 Parrish 4 hemocele 1 nacionalidae 1 papelera 30 Lulú 6 Lipke 1 MICRO 1 o Modo 11 IEM 1 Foxwell 23 piwi 2 mkg 12 Hoyas 8 Fascination 16 oblicuos 4 pedrería 4 Kanaga 1 Fieser 3 Lutoslawski 1 Glasoe 43 fariñas 3 Masetto 1 Kopejka 1 octoloboides 6 fariñentas 1 Numatik 1 Kaniasso 6 Huws 8 Heymans 1 mediadore 1 Neesam 1 Neemane 1 ordtyding 1 Miches 2 magdalenae 6 pla 7 GGC 8 Olivereta 1 limnetis 1 Physochlaina 6 Levassor 5 moralizador 70 invadido 1 GF 1 ondulares 2 pardao 1 Logoreci 1 imaxinábanse 2 Journeyman 30 Finalizou 4 Heybar 1 Lipps 3 Mahillon 1 Kubitzkia 4 Maciot 1 multitudede 1 Ohga 1 O David sofreu 1 Ipsca 1 palanquín 3 metrosídero 206 Hawthorn 1 Överkalix 1 Nekromantix 2 mexAB 1 Nuliplexo 1 periferas 1 Khorlo 1 nupciales 9 grallas 2 Litotricia 3 Piquío 1 nitróxido 1 palmiforme 1 Jolfín 6 kadabba 1 plastídulos 2 Kutenai 2 Garantiuse 1 Monduzzi 93 liberadas 2 gazebos 1 Pahoehoe 10 Lemche 3 hercínicas 2 Macrocystis 2 novelísticos 1 Fisonomías 3 orotidina 1 läos 2 Kosmet 2 Kje 2 kox 1 microdactylus 1 guet 1 nàiseanta 1 hax 1 Nidrei 1 machucarse 125 Louisville 1 menopáusica 3 Matuszak 1 Noitemóbil 1 Paideias 1 Honomu 1 glandulososetosa 1 Icluso 1 féreo 1 Monocerorhinus 2 Leucorum 12 observacional 1 Garment 1 Nikolaiévitch 1 Oryctero 11 Mu?ammad 78 juego 7 melanocortinas 4 manipulalo 1 hies 13 Óperas 7 happening 4 mesenterios 1 Formateo 1 Lagting 2 Isluga 3 Huffer 5 Herausgeber 2 mapeamento 1 Mauterndorf 1 Joondalup 2 Gatundu 1 minä 1 Gnepfstein 1 montículado 1 Mortelle 1 Gracanica 2 ligg 1 Olymposciadium 143 pídelle 1 micropascal 1 incautara 1 Iboudraren 2 Fangaua 1 Ferpecto 1 Kaórnica 3 Guenduláin 1 Limpáronse 1 parnij 3 Miguelánxelo 2 onta 1 islamofobia 2 irrigaban 2 Nationis 1 Kopu 1 indagados 1 lokot 11 Falperra 1 Kerajaan 1 Ketlun 1 MULTICS 79 Mack 13 Foetus 1 golfa 3 fisionábel 3 melismática 1 ninurta 462 Johan 1 Gotlandés 1 Nebiri 1 galletera 1 Kainova 1 hamadríades 15 Gatica 1 Navaquesera 3 planète 1 Homopiperazina 240 nom 1 isolacionistas 1 Isabelae 1 Gidran 1 Goulburn 31 Participantes 1 intercirculación 16 infelicidade 42 libretos 1 Perdikidis 1 multipartidarios 1 Nallpen 1 Louxadas 2 Geofísico 1 flaB 2 heteroestruturas 1 ondependente 4 Iniciaron 89 Fuster 29 manta 27 paxariños 2 GFSC 17 implantes 1 liebhaberinnen 1 Oskon 1 Pikos 1 Naturlauf 1 Haemodracon 1 Kelifos 1 mundijongensis 1 Kyoryu 1 Frontbann 3 Gallito 2 Fjeldsa 1 inmunocomprometido 1 montecitorio 4 junonius 2 fijar 27 Kolbe 96 marróns 15 Marronda 3 folgadas 1 Gadago 8 Kaleidyscope 1 Lelese 1 Gershman 3 granados 8 JERC 1 mi 1 Mitoloxicamente 2 Musseum 6 inseparábeis 5 Jaufre 16 Galiciaé 2 nepaleses 5 medioevo 4 kumquat 1 Kuntheria 1 Perlimplim 2 lostrego 51 histolytica 17 ik 1 Metedor 1 Maleski 2 fens 4 Najimy 3 Koichiro 1 miura 1 Meitilli 74 Fuller 6 fregas 1 Pátzcuaro 127 ideolóxico 1 Molé 1 inxectábanse 4 Geopolítica 1 Marmoritis 1 Kouatta 24 fraccionada 2 irrespectuosas 5 Orgánicos 26 Mislata 1 Firmer 19 opsonización 1 Myeko 4 imperatriz 2 Loughmore 1 Haciadama 1 lavábanas 1 musulmani 1 Oreskes 1 masapadión 1150 lixeiramente 2 namorarme 1 Nasaprutu 3 Mendozazo 1 grammateus 1 pflanzliche 1 multistriata 2 Hofheimer 1 intelixecia 2 geyser 9019 Juan 1 Imuhagh 1 Gia 1 infórmannos 61 parrulo 3 idaea 1 phone 1 Nezu 1 KazEOSat 1 Kuusalu 5 orbi 91 Justa 1 piège 1 Maikki 4 Iriomote 4 jurídicas 1 Flamencona 3 jörðu 743 Home 1 Fontaíñas 4 Grossmann 1 flentes 1 Fossum 1 monopódicas 1 Machesney 2 këngë 2 noticioso 2 pertencian 1 planata 1 modelantes 4 Pateras 1 Fantaghirò 1 onk 1 kirolak 3 Minteo 8 Plástico 1 organótrofas 1 Ötz 1 Litzoain 13 güianés 1 Miránda 5 Pisoraca 2 Malentendu 1 Glucksmann 1 MyTravel 1 Mielnik 4 nøgne 1 Montmatre 5 Morandeira 34 Knut 9 Fanego 3 Paçó 1 Namjeju 1 Iunius 6 namas 1 Jerash 1 Montaron 2 greci 1 kä??iyap 1 Opsopoeus 3 glipiación 3 Larre 172 Nagano 12 Origine 2 Hanashiro 1 Inicialice 1 Missarzhevsky 2 metemos 3 Juris 2 Klagt 4 hermitiano 1 musealizar 22 impediría 2 ortosilícico 1 neuroimáxes 1 GALLIENVS 1 Loxy 1 Igitxix^ 1 glicagonoma 395 Pietro 6 lisboetas 1 metiltioanfetamina 1 Omnimon 1 lambei 1 Hamraia 14 Isáurico 12 Junko 1 Nigon 35 Idris 2 Ingelevics 10 Journées 3 planetésimos 1 microtrabecular 1 GYBE 1 Girardinus 2 Konsole 54 Kana 30 Meuse 6 Grot 1 Kayar 1 Laiseka 1811 ollos 1 Letang 2 Penafurada 2 Kienakatta 2 Fogolin 20 Freijo 1 Godson 1 Miró de 1 persignaren 1 Lustful 3 Gasdia 5 OI 41 Nativos 1 Foldback 1 filamentación 1 heterocedasticidade 1 Llego 1 garoupe 1 Jiddah 3 gobernó 1 Pfarr 6 Houdon 6 Hütter 1 fuellebornii 27 ogro 1 Piknic 4 helleri 1 Hoyo 10 levábano 2 Kolpophorae 7 Grantham 6 Pama 2 Gowanus 11 length 1 Mosteirín 2 Motorwagen 68 gastronómico 16 garderías 1 '??l?f 3 Hoodwinked 2 Greensmith 1 Johncock 1 Keku 2 Futures 1 Pedragosas 2 patélidos 8 Inmortais 2 mercio 1 léxical 1 fdos 4 Kulcsar 2 heteróctonos 3 Isacio 13 Menelik 2 Gadsden 5 Kuxiro 2 Mansura 703 laranxa 1 Honk 2 Karisoke 14 Kalle 2 Hillar 25 LHJMQ 1 milocca 1 mostrábana 1 Laugardagur 1 Gratiet 2 Ficoeritrobilina 1 nimboestratos 2 mucinato 1 krestyansky 4 Fossils 2 pilóns 1 Hovánšcina 17 Gassman 3 MADtv 1 Lourás 1 Namby 1 Identitet 24 Lucifer 1 Perellonenc 3 hoffi 1 Holík 1 Geldinganes 1 gliros 1 Magisano 1 histologiaweb 2 haworthii 1 Gilgen 1 fenecida 3 heretge 1 mediterraneidade 3 Hazme 1 Nethravathi 1 keratina 1 Musasir 1 galardonas 1 Indipendèntzia 3 Kocina 1 gementes 1 ortotopónimo 18 Mío 1 marchito 1 gañáronlla 1 gozala 4 impecables 2 MSIL 2 Haasts 206 navegar 17 nécoras 1 Hostetter 6 Krankl 1 Iocunda 2 nostoc 1 Noretandrolona 8 Ornithorhynchidae 1 Ootmarsum 1 Palauano 1 Msutu 1 Periplectómeno 1 Oyakoba 2 mutazilita 1 Klavdy 85 férreas 3 genesi 1 mutuatario 1 Greishma 3 Francesillo 10 Orbit 1 lñaxes 1 Ledell 1 Iarlaganda 2 melear 1 ortografa 1 hardtops 2 Pauper 4 Lapworth 1 goku 4 inquietas 4 Instonians 6 Laxos 1 Nacionalízase 1 Galinduste 1 observándoo 1 Krox 1 HBAC 1 Perlia 1 Kungang 1 Magway 1 Foggaret 1 Laportea 2 Legé 2 Llygad 32 Muraena 11 insostibles 13 lucerna 5 macroglobulina 7 Lemuel 2 Osachi 2 gravosos 2 nidífugas 17 Gurruchaga 1 Gravamina 1 Karolinger 1 Nevedita 7 Mythologie 4 Müürsepp 1 Gordienko 24 Informal 1 kænæm 1 leuprolide 2 Mazowieckie 1 OnStage 1 parietomastoidea 1 Phetchabum 1 Grafia 2 pertactina 4 Orela 5 M?n 1 hambatus 1 mieláin 2 Member 1 MstII 1 Lorgeou 17 inconsistencia 6 Perga 1 Painzal 3 IndyCars 11 linóleo 3 GoldGRed 1 palmarosa 1 Lyadov 2 Ospitalea 1 Labercas 7 ocurrido 9 Llop 1 microesgallado 10 Olonne 1 Gelio 1 novellus 4 oficiosos 1 Lawsonita 1 pátoloxías 1 iphthima 2 Mariquinhas 2 immunis 4 Mazagón 6 Mimiviridae 6 Novellae 1 menthol 4 Huw 11 Heraclonas 4 paraproteína 2 lémbraselle 2 grid 6 ORE 2 Greal 27 Mutombo 2 Halorussus 1 MazeStone 1 Gemtuzumab 6 Frasco 1 Ninjamasuta 1 Nikel 1 Isturgis 1 holísticas 2 hardwickii 11 Koblenz 1 Isongo 2 monoxenérica 7 Miñorto 1 indivisum 1 Ouve 1 Lazaréennes 1 Linophrynidae 2 golosa 4 midríase 1 Panzers 1 observóuselles 4 monodermos 1 latimanus 1 mexinaco 1 frecuentadoras 3 Grech 12 financiaba 1 Malomocco 1 Ildut 2 nivkh 1 Meao 17 Pata 29 obtuso 81 ideado 27 favorecidos 1 Graeber 4 jumbo 15 Momigliano 12 Jadel 1 ocak 1 Fincannon 2 hG 1 Liofilizados 2 orbitarían 1 Leonteo 9 mpl 1 Liáoyuán 1 meritorum 1423 mitoloxía 3 hidraulicamente 10 haradrim 1 Nawamin 1 héctareas 1 junando 4 Lokal 1 Festeiros 1 Goumel 1 metalicas 1 Kacaanka 2 justificación 2 Irinyi 7 Lerman 8 isomorfo 4 Marit 1 platyphyla 1 guíes 3 Khobar 1 mucous 1 Ingvars 2 Hesdin 1 Paxent 2 fenilendiamina 1 gomorrense 1 obedezades 1 Keiraku 1 Mijeili 2 perpetuáronse 1 Lémann 1 goniómetros 5 Laiantes 1 LeadScope 1 Nitrocelulosa 1 hemoglobulinemia 1 formásense 1 Gernandt 3 insinuaban 1 Hornjoserbsce 37 Fern 2 Mahenge 2 Kikuyo 2 masacralos 3 Gnetum 1 Fixará 1 FINGERE 5 matricula 1 milter 2 Hvidøre 2 Kalilikane 1 phanera 1 Latt 1 MUS 11542 n 1 Kablinski 2 hälleberget 1 Lány 1 fracturara 10 fregona 1 Kokua 1 paar 30 Magalláns 1 Huygens observa 5 Mudia 14 granuloma 2 fuoi 460 justify 1 Ipsicratea 1 gastallo 2 Kitu 1 Peleset 2 Inbetweeners 1 lief 1 interdivisionais 1 Futtari 3 Mexès 3 Funkadelic 32 mun 1 Musiqq 4 Padim 7 Marriage 1 Natufiense 2 LMs 5 Knick 31 GLV 35 Mitteleuropas 1 lograres 2 Ogata 3 Onaga 2 Perske 2 macrocomplejo 1 Novotná 16 patois 1 liscaren 45 Gimeno 1 globozooespermia 1 Hyfeidd 2 paleopoliploidía 8 Lutacio 2 merkwürdiger 1 hipocromicidade 16 Mantis 1 Kamarupa 1 lleidana 2 Neoplateresco 3 pelicosaurios 1 horitzontal 1 holtnak 1 paraxostilar 1 Mercantilisme 1 Lessinganthus 1 Giurgeni 1 lanthaneîn 1 Leonsis 32 glenoumeral 29 Paralímpicos 1 Karcino 3 Pharmstandard 1 Heym 1 incumpran 1 linifolium 21 Mariette 1 martor 7 mignon 2 Jema 1 influenciáronse 4 Fus 5 Kann 1 Hemigkofen 1 phryno 4 Neutralizado 3 Mongie 1 Grubant 16 Fuel 2 limettioides 1 hospedouno 3 foliosum 1 Hofen 1 Nebras 7 Intróns 2 Laiker 13 inexactitudes 147 Paixón 1 Leocádio 1 Nannorrhops 1 Instrutiva 1 Hussi 1 Guíaos 8 Nikolaievich 762 Final 1 Lyutayeva 4 heterodimerización 2736 militares 1 Piraten 13 hidrográficos 1 Marold 33 Merindad 1 ISAAA 5 intercambien 2 misceláneo 3 Joué 1 ? 13 Iconografía 2 Halimi 1 Freelance 5 gustara 1056 Gonzalo 1 Geologie 2 legión 1 lysine 1 fourvoyé 1 kiek 1 Pedradas 1 otheros 55 invita 1 interesalo 1 jirhlin 1 hazard 1 panatenaica 24 mesentérica 1 Mutilato 5 Marcuño 1 museísmo 2 licita 1 Luisella 9 Godexisilo 5 lémbranos 1 Patatán 3 Katsuta 3 miserere 52 Montaigne 2 Linguísticos 2 pappataci 1 Lepetelloidea 2 hoka 1 Pali 1 perflava 2 Modzalevsky 15 pescadas 3 maraballa 2 Inevitabelmente 1 Irfan 314 Muras 1 Ök 1 miroscoia 1 Hondio 1 inofen 1 maríño 21 Insulina 1 Kayokwe 7 fotomontaxe 1 Fontechiari 1 Identificara 5 Kinoshita 1 Manki 5 nye 1 Leibel 2 Fuhrmann 1 odontología 1 Jusef 1 Lerne 1 Follistim 2 Floridante 1 Pholamyoidea 1 hittites 1 Fatores 2 krepis 2 gyozelemre 1 nRTK 2 Maremar 12 Pelléas 1 MICO 1 hidroxenións 1 Lifelover 1 ostreicultura 3 napoletano 1 Genewatch 7 Hiragana 1 Flatters 1 paixasistica 1 orage 1 monókeros 1 Piridilo 1 Palmiticacid 1864 Kosmos 1 leich 7 maliciosos 1 Laurentides 1 georgia 1 hedonísticos 1 incentivándoo 1 Phongsaly 1 Liura 32 noruego 1 LVIIdetalles 2 jèrriais 1 introducció 1 nasicus 1 Hautsi 15 Liques 1 meraviglia 1 Fúnebres 4 Nieuport 1 Marcháronse 1 ludzi 13 pescando 1 Henick 1 Pithagorio 1 Garumaova 1 miafisismo 1 mochiliña 3 lime 9 Hiroko 3 Fierabrás 1 Gallissà 2 laceira 2 nocipercepción 5 Gudhjem 1 Honrábase 2 Khadi 5 ládano 2 Melingo 27 Marqueses 83 Ivanov 3 finestre 1 Linconshire 1 neopentecostal 1 Honigbienen 1 HomenatgeAValeriaPujolIBosch 1 Ferruzzano 1 Magnagardas 1 Hánuman 1 Latta 1 habitanteds 1 GCTP 1 langabetu 4 Hanguanaceae 1 Muggeridge 18 Götze 1 Karstologia 2 Glycymeris 2 Footlights 4 Lapuebla 1 Filharmonia 2 Piculín 1 oíanse 2 pedemontana 2 moffitti 1 gah 1 Krasyukova 1 Locomon 1 Pharmazie 1 Huyges 2 palia 1 Gazzerano 1 iâ 6 Itamaraty 2 Labrouche 1 Hibike 11 Karr 3 fotopigmentos 1 otcizna 2 Herzogin 5 halophila 7 multianual 2 Jumala 1 Ornifle 1 OCRs 5 Musoma 1 Japará 6 frentes 107 isoforma 1 piroplasmose 1 oceánicas— 1 kmph 4 Osteocondropatía 1 investigadoress 4 Mortadela 1 FISTF 2 Kheth 1 Floh 5 Parafilético 9 moralistas 10 perecen 4 maturidade 165 florete 1 Picots 1 Hattuarii 1 paráfrasis 1 Labialización 31 Interno 1 Mahasathan 2 Inversións 1 Pferdeeisenbahn 1 Paluska 1 Patroni 3 Gigot 1 invitoume 2 Groovin 1 Picoteros 1 Oxiclozanida 3 Hviezdoslav 1 NEWS 2 Huanuni 1 Khuzis 4 Koadrila 1 LEZO 1 maullar 1 Natey 515 mestra 1 Muravera 26 Guadi 3 Haffenden 1 Grytgöl 1 GRASSE 1 Hneta 4 Pastorelli 17 mentores 4 Juanan 1 JRR 30 Level 1 Nitrosoureas 1 Lanskaja 1 gestionar 56 ictus 2 Picramniaceae 1 itihasa 1 Gebirgs 1 fixour 12 Levado 2 Femto 1 Kilu 1 MOUNIN 6 Jouy 3 Pentastomida 1 Heggedal 2 Pegram 5 MWC 1 guappi 2 kindergarten 1 LinDVD 3 Harbourne 1 Kommode 2 IPADE 1 Helioclostridium? 1 lecometi 1 Magnée 5 infalíbel 3 MBV 1 Fruzo 2 Maulwurf 1 Morisca 3 Kyokko 1 Kazneni 2 Fuurigan 2 fortaleceren 1 Monstruosa 2 fragmentes 1 lonogo 1 Neomeniomorfos 1 Kasteel 1 isarno 2 intrónico 3 Gortina 1 ixidis 1 Jakimovich 2 Mazon 1 foribundos 13 Guilty 7 Macanao 1 Flandrina 1 måjhinete 1 piacentini 8 Pate 1 Maieinsingen 10 Guyana 1 Muneta 1 jutyt 21 instruída 1 Helotes 15 oftálmica 1 Muziekkamer 1 Magnones 1 Lorrha 1 IMTS 1 ordenatriz 3 haustorial 1 Pickaxe 10 Pavillon 1 formalizándose 2 indólogos 349 obtida 2 Milagrosista 10 merindadea 1 Genava 1 Nahaj 4 Fargeau 1 LOADDT 1 Pails 4 Neame 45 hospedaxe 1 Piaklin 5 Legislatura 24 homeodominio 1 Kosokawa 1 interpeta 2 metabuilds 1 LusoQUALQUERcoisa 1 Kozakiewicz 1 piresii 3 Historicismo 486 permanecen 1 Gabellone 2 Humenné 1 Haraguchi 1 Makerarenai 76 Mirandés 1 mútulos 1 Namenalala 7 Pesaba 2 Mittenwald 1 Ginetes 1 ouse 70 Grisóns 1 Microcormus 13 Organizouse 1 pìruvato 1 gatsì 1 gottesau 2 Phyllanthus 2 Mukti 1 partidarido 4 fiori 1 Kitlamu 5 horno 8 Nasdaq 1 Invisivilidade 3 illustribus 8 padrone 1 Peintres 2 Kagua 1 Persisto 5 Piquin 7 Luzuriaga 3 LVTP 1 Mounboudji 2 Kishiro 3 llibertat 15 hémico 1 Iboshim 4 Líricas 1 Koubelonisi 1 janmajat 9 intanxible 3 Phytophtora 2 Kutné 27 Hoshi 1 Kammerat 2 giraldii 5 Goodie 1 Ludewig 1 macaronesias 1 Lamae 1 involucrala 1 modernizándoas 1 Herting 1 percusivas 2 Grammistinae 1 Neskak 5 LeMay 2 Nauki 2 guiarán 1 Kibriscik 1 Kercem 1 jeringuilla 1 lobuno 1 molntanas 1 hidroalcólica 2 mósquidos 1 Mokupapapa 12 mobile 3 Laparra 7 Gualtieri 12 Matthieu 2 Moesa 1 ivertebrados 1 macroglia 23 Minkowski 1 hellig 16 fillastra 1 Metagenealogía 1 Ganzirri 2 Fluorescent 1 Kihoon 1 mantéñanse 1 Mazarine 1 Micrasiates 3 Hokkeïnaïa 1 Oblaski 2 hainanus 13 Millstreet 2 incendiaran 7 Mitford 1 lassellon 1 pertinens 1 fjørti 8 filmando 1 Maumeta 8 forxadas 1 Ondegardo 1 manganismo 1 Lampwick 10 Mustansir 1 MinD 1 milanistas 3 intentada 1 geographie 8 Jungfrau 8 menciónao 1 Gururumon 16 inesgotable 3 Otívar 13 manexable 5 Palmireno 11 Mollà 1 jeleza 1 infrarrealistas 1 Pennec 1 Graviera 1 Juemin 1 Infojardín 4 Orgullosos 1 multicaule 1 Gaheris† 1 Morgonen 3 Forés 2 Grisaleña 1 inicada 76 foxos 5 indesexadas 9 Gogynfeirdd 19 fundouno 56 Iberoamericana 1 Kucharsky 1 flyga 2 papR 1 ocurrerron 1 Foneticamente 3 oghámicas 1 heterognathos 1 gâté 1 Fiestapatria 1 Piefke 1 Niuataputapu 8 Package 5 Mahathir 1 Personalità 2 Maffio 2 Laufás 10 Josele 1 ovacionaron 1 Orompello 2 Macrogalidia 2 Manguin 6 Plasse 1 Neneiras 1016 longos 1 Measurements 1 mow 11 Matji 1 percisa 2 Highbush 2 Hipónoe 2 Lapentti 7 Opeth 1 Lysbeth 70 Jerzy 1 paralizaría 1 Henkka 13 Moris 35 numeral 1 Habtamu 2 Fellous 3 Gyali 1 Kompung 3 Morango 1 peronés 3 gripou 1 Marhanets 1 Internacionla 1 Heimtali 1 Fermor 2 Mœurs 1 pipal 1 MetaWiki 1 Pernás 1 Partheniaceae 1 haberia 1 fartureiro 2 Masanauzzi 1 lbani 1 Hargeisio 3 Higiénico 1 Hiperactivo 41 Jandía 1 organolitios 1 grammitis 1 Leprohon 2 Feichtinger 251 inundacións 6 Granadino 1 Kable 1 lobidens 4 OLVIT 3 Modelaxe 1 hexástilos 1 Komunikabide 2 interfoliculares 9 Marza 3 hipotecou 1 Montoso 1 hipersensitivo 1 Kwatarimi 24 felóxeno 1 GWLAD 1 Höglund 1 Nisibe 20 pirólise 2 fineza 99 ombreiros 1 Lenwebbia 13 matriculado 1 menometrorraxia 1 Lachnophyllum 1 Mombasso 11 Infinite 1 ISNN 36 monotípico 1 Kounoupoi 13 Mougán 1 lauricápilos 9 Hermética 4992 P 1 laudauere 1 monograph 1 Malecki 1 orbitofrontal 1 múticas 4 multiétnicas 1 moenchii 4 Lamadh 1 Kauuihit 15 Mélanie 2 Ningunhas 1 MSzp 1 lôt 2 Paranã 1 hiperpolarizando 1 Ocracoke 5 muecín 1 Hanggong 4 impersonales 2 Lacorte 1 macardlei 1 Lindachiquía 3 Khi 2 Panthollow 2 Karras 1 Ña 4 Morga 1 Linoone 358 infanta 27 inseparables 1 grande—rara 14 feche 1 Isomaltotriosa 1 Mwambong 77 Noguera 35 Guiomar 43 Marchand 1 panetùn 2 fotoliase 1 Leptinella 10 Neuschwanstein 1 lixeros 2 jardim 125 Natalie 1 Hebrard 2 Mayrig 1 gardnerianus 1 fitamos 1 Hemiacris 1398 nuclear 1 Gafiré 36 Moldova 1 ObxectoLixeiro 15 Loranthus 1 liñaTe 1 Macroacústica 1 mekhitarista 1 IVGiovanni 1 pienestä 7 organolépticos 2 memorialistas 4 oneworld 4 ornitópodos 2 Minhar 13 homoxeneizar 2 Masaveu 1 Nordfors 3 Fossano 2 mineralé 1 hypokéimenon 6 nematomorfos 1 Landerd 1 Mincev 1 íta 1 Mogaínza 2 himalaia 53 ionizado 1 Guilvinec 39 persona 4 Gasparillo 1 Mahadharjushnas 5 ferrugineum 9 lorica 15 Piosa 1 Lubuya 2 Haxa 4 oóforo 2 Gunmarra 2 geospace 1 Krasnovodsk 1 Maksudov 1 Hitzkirch 2 FEMSA 1 Kurbanov 1 Pacobo 1 nafir 1 Lembradora 1 fertilizer 10 Feature 1 Jødepigen 4 Informers 2 pardusco 1 Formicidae 1 infravaloró 1 ne?st 11 Peñuelas 2 neutrofílico 76 paternidade 2 Hipocresía 1 MTOCs 1 imbuídas 48 Mayr 1 keimetha 4 Nh?t 1 Ferreiró 1 fotorresposta 1 MELLADO 1 Guayota 4 GRAIL 1 Mirolad 123 minimizar 1 heterophylus 1 Makromolekulare 2 Giraffe 5 mouraría 21 Minutes 3 inapelable 14 impuros 5 Pérot 5 Franceschini 1 Peñascosa 3 Leganiel 1 heterocícliclos 1 fornecimento 2 ostentosos 1 Moogo 993 muros 6 hydrophila 2 Nordwind 5 Llengües 1 Marinheiro 1 Jochmans 1 leventar 2 Guiyang 5 ladri 1 Medikinet 31 lynx 1 Marila 3 homoxeneizando 1 Gradiška 1 i?tazala 1 Personalizada 1 Feyd 2 GOdt 1 higrocospicidade 1 Magdalenenbruecke 22 ioruba 9 lisocimas 5 Hör 1 órdago 1 ginti 6 Messaoud 1 Galaga 1 gakuya 1 Nikopolis 2 incriminatorias 1 Omdourman 1 Fjalir 1 Flaw 1 Flusslandschaft 6 IXG 1 Impoñen 25 Koga 1 Necar 2 Marsi 1 Navamoral 2 Manturov 1 inplantou 14 interaccionaren 2 Hungariae 1 Jaena 177 Finou 7 luxacións 1 noëanum 9 Fenders 1 IrelandGalway 8 Hivju 9 Modio 9 Heiligerlee 8 instigou 75 Inditex 4 panic 1 petersburgués 2 Omapatrilat 5 imparciais 84 motilidade 2 ?a 5 Levuka 1 galicante 1 planctonicos 1 musundís 2 Odontophorus 2 FVC 1 flufenoxurón 6 Micrographia 1 Petrozzi 30 Múnich 1 Permanecía 35 infraespecíficos 1 naufragaren 1 Kiilkenny 1 iogurte 2 incrementárense 2 keiji 1 Nazonais 1 Gungahlin 1 Ñumí 1 flectens 14 laborioso 1 labradoritaLousa 3 nationalisme 1 offre 18 Jockey 2 Marisi 1 foru 9 Jungledyret 6 Interstate 3 Irgoli 1 Mannekenpix 11 fogueiro 1 Gnathopogon 3 melotrón 2 hidromedusas 5 Labe 1 Jawureck 7 Galegoz 2 Guldnasas 1 irrompibles 1 meixil 1 gà 3 Panhandle 1 Madadh 3 Gesamtkunstwerk 1 g?ormom 4 lij 1 Moveu 1 Jordao 1 Klassisk 2 Matcha 1 Izoard 297 Menéndez 2 Novosiolov 1 kaio 68 gandeiro 1 Pearcey 1 Jiichi 3 pentagastrina 4 nominis 1 Herlind 1 Parachá 2 GFO 2 Melidoni 4 Gualdim 4 Kariwa 1 Panciatici 1 Iddina 6 micacitas 2 Ketils 1 Najednou 3 mielinación 1 mensacería 2 melidense 1 initialize 2 ichthyologicae 1 Ngramdee 1 funngo 2 orangesom 5 mañáns 2 furlongs 7 Manteca 3 gargarismos 1 Gruñeiro 2 Hexagone 1 parruca 3 Inexplicables 11 Gulpilleira 1 Léopoldine 2 Ocusi 2 granulatum 1 jusques 480 nacer 15 introducilo 45 inmersións 1 Hirokane 10 Kimble 1 Gailit 1 hät 1 Leache 1 Highmaster 3 Mahoran 1 Juloio 1 Harjukatu 4 maltreitos 2 Novator 8 flogopita 5 Makarska 1 meritocráticas 3 mátanas 1 Hellenistica 24 juntos 8 lleve 1 fluxions 1 Modulate 1 Jermyn 1 Jueh 2 Iku 1 jermuk 2 Ivoirienne 5 jeder 1 neuroides 1 golpeamos 4 ideologías 2 ostéon 1 Parzenski 36 Ibiza 67 Firenze 19 Millonarios 1 khrysaor 1 Kimihiro 1 nizardos 1 imparipinadas 3 Itou 1 longipinnis 234 Gwynedd 17 Guitarrista 1 Petrolíferas 2 ontoloxicamente 1 Orczy 1 Kaugere 1 Haemimont 1 granfes 1 Housay 1 ohr 3 Marii 8 frisio 3 Octavarium 1 hectáreas— 1 Nêrêídes 2 nieva 21 murcianos 20 incluíase 1 halti 1 Fontmajor 1 inseríndolle 1 MOBO 2 Miqueli 3 futbolista galego 1 mitologija 7 Koskinen 8 leonada 9 MSF 1 Oxaliplatin 2 Kyotera 8 pandeireteiras 1 odstúpi 1 outrosí 1 Malësisë 2 GNAT 1 Felipão 42 GFAP 45 maxima 2 Musophagidae 2 paano 2 Oatlands 1 Kursche 1 Gravsteen 1 Französischen 14 padecían 4 Habitacion 2 opipara 1 Muirthemne 34 Intendente 3 intercostal 3 Pfadi 8 Gimlet 39 papila 1 Gobas 30 newtoniana 6 MTOW 2 Maedoc 1 FOXE 2 Interacional 305 Humanos 1 Fresadoras 1 Fugidinha 1 gumane 2 palmela 1 Parvoscincus 9 Gauloises 1 Heiligenverehrung 1 infestaron 47 Mine 1 magniscuttis 2 Pediulles 1 hepftalitas 6 gastroscopia 1 Giovanola 463 nomeou 1 hibáridas 1 Garessio 6 Gies 1 Melfalán 1 icinius 14 Pedraforca 1 matogrossense 4 gonfaloneiro 3 Klausner 13 Nabeiras 7 mapados 1 Osmolaridade 2 nefndr 1 Gotlandochiton 2 hospedaron 19 Giorgione 1 Guère 6 Froebel 1 Matac 185 oval 1 Folguer 5 inglese 10 incitados 1 indroduxo 48 Formada 14 Necesidades 1 lorquiana 1 Kricketune 3 ouvrages 1 fminina 4 Hoagland 1 hiperxeométricas 7 Paaliaq 8 industrializarse 39 nosotros 2 Kurskaya 60 Fer 3 Kardak 1 Neskatxa 1 indisimulado 1 Passerculus 41 Faramontaos 21 grilo 2 ofrecéulle 4 Glicerina 273 Olympique 9 Lavaggi 4 Herráez 1 Förändringsfanfar 1 osus 2 Helohyidae 22 iban 83 orixinadas 5 importantísimos 1 Mickevicius 29 Iuris 1 Nurague 1 Obcanské 1 nahuel 9 Finarfin 1 Japanoise 3 Marusia 5837 movemento 4 Notation 1 ligazons 1 Horadiz 1 Niegos 1 Milleriene 6 kainós 2 heroinómanos 1 Ganiya 1 Perlur 2 panetón 2 lekithos 5 familles 5 lbf 1 otorgándolle 2 intravaxinal 3 Jarabacoa 1 lehren 26 lombrigas 2 Franciscan 1 Ogern 1 Isaas 14 hipermutación 1 fantaseou 6 Peticións 9 neurótica 1 kolikbarns 1 italià 6 MOON 1 intimidándoos 2 Muiña 1 fínico 1 Iqnet 14 ihm 1 hüllan 2 pierdes 2 fomentasen 1 gedron 1 Hackley 3 Gravure 1 gallaise 2 Huic 1 Majinae 2 MTases 1 Laboratório 2 Moghrey 1 oublié 5 patrulleiras 4 harmonicamente 22 Partovia 1 Mullir 3 noucentisme 2 Maalhosmadulu 1 MAW 1 Muruás 4 Osmán 3 gardasen 2 Moyenne 1 Kavrakos 4 Nanociencia 1 Perel 3 Murube 1 formaro 1 HOO 4 ILLE 3013 pertencente 2 Nagila 1 Filstisaf 6 Kocaeli 9 Mandalay 1 Heuse 8 Nebot 1 Ozzeri 1 Lavorante 1 liner 120 Giza 1 Mantenemento 1 Olahraga 1 musabbaha 1 Lisselton 2 kusa 7 Jia 3 Heseltine 1 Kašgar 7 Helénico 3 Piovera 3 Intégrase 2 Gashaka 5 impediran 3 Junonia 1 niolincu 56 namorou 8 infrutescencia 2 Loriciferos 1 isimha 23 infestada 2 galeazas 2 Irga 1 Paleóloga 1 Nassouwe 1 finxiran 1 ludibunda 1 obligándolles 1 nukumanu 41 Gibraltar 1 moscovítico 1 guridas 1 Handúd 1 lectrónics 6 Ixchel 1 Garcíez 4 Lugoves 1 Irriducibili 14 Manzanero 1 MIMI 1 foeu 4 panales 57 Hogan 34 magno 4 matizou 1 muxarra 43 indeterminada 1 Namai 2 Marenco 1 ikkense 1 Grimstahamns 38 Harvest 1 orgástica 1 Gerrardina 1 medeltida 120 Penal 5 flumen 1 microcortes 3 matoubi 1 McFaden 1 Ixiar 1 Mafeo 1 gainst 1 Farban 1 Maicanescu 1 Kibania 8 Grav 4 Gaag 1 Pictograma 12 fasc 3 metrallado 1 mandóu 2 k??zime 1 planimétricos 44 Hérault 2 Pich 1 Gautandik 7 megalópoles 1 ja?n??'bi 5 flipases 7 Pignatelli 1 looks 1 Parioleau 4 INDO 2 microvellosidades 2 Parasitose 2 MANI 1 Íslenzkur 12 Hessel 1 peralillos 2 Mordisco 1 Montalvão 1 Gonay 1 pianolista 3 Parparra 1 inminscuiron 2 límits 6 OICETS 3 Fångad 1 Magnavox 4 K? 11 Nache 5 modificalos 291 Mikhail 1 involucionar 1 Greleira 1 Kandidaattikustannus 2 Morsa 1 Igwizi 1 Passeractuais 3 Palotti 1 gritaran 1 Loxomataceae 1 Guereña 1 Koubun 2 insolidariedade 1 Lejona 2 Nahuriya 1 impis 3 Insértase 3 monococcum 35 Folgueiras 6 Inka 1 Periodici 1 Kossaka 1 pallarés 20 peaña 1 Giesecke 2 Nénesse 1 mennonita 1 Growney 1 pitite 7 Gennes 2 microscopicum 1 pacedor 131 Nikola 1 feel 5 Goncharova 4 Nemrut 1 Kuybysheva 1 Gabelhorn 1 favoréceo 2 ovelliñas 1 Landroil 1 Kochel 2 maxixe 6 Hiitelä 1 Hamvu 1 Korlai 1 pillidium 5 Iratxe 1 louko 65 October 1 hemisphaericae 1 Naumberg 3 Fennwick 1 Mylonas 1 Förstel 1 Kahololani 12 Ghislain 1 Kozarowitsky 9 Gravitación 1 peripatéticas 3 Meigen 14 mostraxes 1 Krauseola 1 Intxaur 6 Koroliov 3 Infectoloxía 1 klet 13 Kemper 2 mildew 3 Fortalece 1 Lightolle 3 Macros 3 Lieksa 1 Kontiolahti 1 panderetas 4 Garanca 1 finalizarían 4 Lumbrales 1 modifiers 1 Kildi 7 Orobanchaceae 3 Julito 1 lear 1 Newandyke 6 patricius 4 paramecio 1 palaico 1 Lenísio 2 irresolúbeis 1 Margry 2 ICTY 3 Oxen 1 MARCAPASOS 16 mesóns 7 IMAGE 1 GSN 4 JCVD 1 Kolotahi 3 Lovetsky 1 metilio 1 Idindji 2 independentismos 20 Fundy 2 LITTERATTURA 3 Nejej 43 Giulianova 1 Kuprijanov 1 Nashef 1 Lactancia 1 multiplicationis 1 monastyrié 1 Hopscotch 21 intuitivamente 2 observouna 215 Milk 1 Hantela 2 màxima 1 Kobwin 1 Pioppi 1 Keiro 1 Hermosino 1 Langraxiana 10 Metcalfe 3 pizda 1 Isanapura 1 Hemanxiopericitoma 1 hvørsfall 1 fertilizase 1 isquiático 2 Picornaviridae 6 hôtel 1 Micatitas 5 jer 3 Petrosaviaceae 9 navio 4 Ocidente 3 Miolo 1 nationalstaatlicher 5 Piz 8 ferrumequinum 1 idiolectos 1 Guardarríos 1 Labridade 1 Motorwagenfabrik 4 morphé 1 GUIFactory 4 insistiulle 3 FIDA 1 Murato 1 Flibarium 1 guiadelcomic 1 Kachafaz 3 Pexegueiros 1 Menschgeschlechte 9 Kreidler 7 IPB 3 Gunnr 1 Panet 1 Mesoapéndice 2 Gluconato 4 LST 3 laicista 7 Kbps 7 Östersund 1 Ganamos 4 Karput 6 Matthes 1 orbitalmente 9 moits 12 Mogliano 1 Oberding 1 Gertner 1 Gleitaar 1 Konverter 1 Follonero 1 mesquindade 1 Helgist 12 Hib 3 Lassabe 1 Lehrhoff 1 Peavey 1 Kataki 3 Mongiardino 1 Kickert 99 Isolda 1 hayasios 1 localidade morava de Velehrad 1 pelexara 1 Nechmaya 5 ocogravado 25 manera 1 neoiorkino 1 hiozzo 2 IST 3 mostardeira 1 Iraia 3 Osmundastrum 1 fifchii 1 Gots 1 Interuniversitari 11 Ladreda 1 Motfort 5 homenaxeouse 2 k?atriya 1 Haxar 3 moíños 3 Gratitude 2 Juslapeña 2 innegables 2 Orf 1 Harpesaurus 30 Gauthier 1 Laerte 1 Kwasi 2 frunte 2 Plantéxase 6 operase 1 matriculas 3 Keuchkerian 1 Ohnefurcht 2 Ghiveci 1 hipermietilación 1 Giovine 1 Kormúthová 2 Flúan 2 JQ 3 Knipper 5 periga 1 imafronte 5 Oficialidá 1 Isala 1 notifícase 1 intuito 8 Kwara 52 Iborra 1 Milyae 13 ICM 2 Lepuia 2 peltatus 1 perdeulla 2 Opeto 1 nasquí 22 incertezas 1 Libélulas 1 kétség 4 Majeed 4 Hartola 2 Laie 3 Penney 1 manipulen 24 Matias 1 LIBEROS 1 isauros 2 originou 1 Jami?at 1 Gurrë 4 Lemcke 2 njene 3 manobraba 1 Ozumo 4 Grisolía 1 Passami 1 Permancen 2 Hasheem 3 Ludmilla 1 junt 1 Mandyczewski 2 ficocianobilinas 3 Lakuntza 1 Istiya 1 Jonokuchi 45 pioneiras 1 pideulle 7 negasen 2 Gastronomicamente 1 neuroticismo 14 inervan 1 Meys 1 Gobiendes 1 Fantasminha 1 Jesewitz 3 Kärdla 1 Neurólogos 1 Fragunde 1 incliu 3 FECSA 1 MäBU 1 Instituírono 4 hipovolemia 6 no 2 Panavia 1 Ljiljana 2 Kästner 1 Piocorto 42 Khalid 1 monoxenéticos 1 fanâk 3 Orinda 1 mostrade 1 mâd 2 karoo 6 Fogg 1 kangsmanem 15 flotador 2 hadiz 31 monolingüe 5 Grueiro 1 LXXXV 3 planum 3 Muraeninae 39 hostes 1 ibanag 1 nitrofosfato 10 Kongelige 1 Onneyn 2 Mashkov 1 Neopalaemon 1 GFlops 3 IPsec 1 Nørvøy 1 Patte 31 Kampf 1 müren 2 Monda 1 Maghan 1 incuír 2 pasiño 4 formouno 1 Hajweri 1 Hallorann 1 Herrligkoffer 2 Leftkowitz 2 Lepidium 1 galvanische 1 Musang 1 Meresti 1 Octopodiformes 1 Jazzin 1 IntelliJ 1 Metiltransferase 1 liades 4 Harmonización 5 Perisodáctilos 1 Niaguis 25 Masculina 1 Leso 1 Imagined 1 Indiarivers 2 Harðar 224 marcadas 7 Fernamental 1 Parianaceae 2 holandas 1 lentícula 1 Pavor 1 indeoeuropeísta 3 Leppänen 3 parafasia 1 Fixing 1 Lubrimat 1 fraternitatis 1 murI 1 Foetidiaceae 17 mecanizadas 1 inaprehensíbel 3 Filezilla 42 Loudon 6 JAE 5 Minter 6 Perífrase 1 khub 1 lipseashti 3 Leontes 1 Guppys 1 fayoumico 2 GnuLinex 1 Opokuma 1 Parenté 4 Jeová 1 Medakovic 4 Insurxente 2 NIK 9 Naquelas 1 Golos 1 n?w 1 Macedonija 2 Ilena 1 Inanui 2 hellénique 1 Kirichenko 14 freudiana 1 Nordeifel 2 kapellmeister 1 lincestas 2 Gaudian 13 Nazis 4 FAMILIA 869 igualmente 1 microbiananas 1 metanoatos 2 mortuaria 4 Gavril 3 JOAN 13 penetrada 1 Gríðr 1 geurey 383 Leonor 1 planímetro 78 Marítimos 2 Pirna 2 †Nova 1 perforacions 138 Hoy 2 nco 2 panafricanista 2 Pásame 1 Granatenwerfer 1 Mundaring 10 Ouchy 1 Islo 2 minimis 1 oxymarina 1 Iladas 9 gcc 2 Lyda 1 Osecina 1 manufacutra 1 Petok 1 nonno 1 Nosse 2 Magalhâes 8 Niacina 1 folcores 1 NIP 1 fregueresía 3 Fisco 2 Freiseiro 4 Gamexane 1 Fyre 2 Marreau 1 Noemiamea 1 Gusano 1 jânnam 2 Fazula 2 Nicod 1 Mustélido 414 patria 2 Iamamoto 1 partenoxenón 3 municipiu 2 Foratata 1 Nicoláevich 1 parisiennes 1 Monrosia 1 Palacagüina 2 Kurbanguly 3 impagables 13 fallase 1 Maor 1 Nembao 1 mulsa 10252 persoas 2 FOXO 1 marcamos 1 Faquín 1 pchela 4 intrusivos 3 Hollett 1 Infrinxiu 2 Kemener 2 Grafema 4 IBENS 2 mondaricense 1 gorilles 9 Isham 1 Mezzmo 2 marcescente 7 Gaeltachta 10 justice 3 MIDEM 1 Ounous 3 Monbars 1 occitánica 1 Incrementarase 1 Ingeniaqed 2 Occhetto 6 hiperpigmentación 37 Lammermoor 2 pelouriños 1 LibriVox 2 Heisengberg 3 mujahideen 11 Pesas 1 Hydata 1 Paymogo 1 Liciaga 90 permanecían 18 malacoloxía 16 Galos 1 franconio 1 GED 132 invaden 1 Guilhotinas 58 Manduas 1 levántao 1 fórmannos 5 Lelystad 1 Lebresnice 24 Graco 1 intranxisentes 1 Mhaoile 1 Helideck 1 Guaimaros 1 JAMPAC 1 Maropati 1 heimwärts 3242 morreu 18 morenas 1 filaceos 1 Muneshige 1 Fallone 5 Jornet 5 Iyar 1 Juhász 2 largometraxe 2 insurrecta 2 gluconato 15 Marieta 1 Fontanas 205 maioritario 2 Plagiopteraceae 3 Mirasierra 1 Mendozita 19 gouvernement 10 Helloween 7 Pasiegos 6 mastozooloxía 1 femenista 2 Janete 1 fixerónse 1 HURWORTH 1 mussolini 2 pallone 4 filibusteiro 1 impedilas 1 permitese 1 Landido 53 forall 245 pirata 2 —idioma 3 perinola 1 nazoreo 60 Gardas 1 Grafiken 1 Ginko 1 galeguinhos 2 lamarckiano 1 Honradamente 8 Lecoq 43 Octaviano 4 Innerspeaker 32 Movida 2 Noosa 1 Mazama 1 Fontanili 1 luccicanti 1 ?enu 1 PARIO 1 Normalizar 3 lavara 1 Jicín 16 imprescindíbeis 8 Longinus 1 fracturaron 1 openDWG 1 Pepet 1 Nieuweschans 2 noveles 15 MAT 2 Hustadvika 1 Narbolia 1 Gyi 1 Lambasa 1 Fentale 34 herdaron 3 Periódicos 13 Ghiyath 1 HSU 1 Keyuraphan 9 Naranja 3 Heliobacterias 1 Geraldus 2 intercéltico 7 mediometraxe 1 nictalope 9 Gualterio 1 millieme 3 Marlish 1 nueovamente 1 Glauberum 1 fotostática 47 Modi 2 Mataras 1 incicio 1 ónychos 5 Hiiro 1 Groeda 13 Leirós 1 léguas 37 Neko 1 MZZ 1 hereditários 8 Keene 3 Piñeiras 1 Perplejidades 1 guereza 1 Matteini 2 pasthuns 2 fona 5239 Mellor 1 glioxal 1 litauischen 1 Maenaddwyn 1 Piaff 1 luthite 2 Nieuwdorp 1 flasback 2 PHD 1 plantándoos 6 perpetuum 1 Investigouna 14 Hebdo 1 guépard 1 medusae 1 gjarpër 1 Margu 5 Piraiévs 1 Methysmeno 5 Locencia 3 Pampanini 1 ghleu 3 Norberg 1 gávea 2 négalles 2 Mérignat 8 Mikkola 1 Gartxot 2 Hasparren 23 Marechal 1 inflorescence 143 Fins 1 Maailman 6 Guma 1 FIDUENEARUM 37 Gravou 1 Košar 1 Halftter 1 FictionBook 1 Frisaqués 1 Mutalib 34 luvita 2 máfica 1 Fallut 1 oP 1 peshiy 1 LeechFTP 11 Intermunicipal 5 IMELGA 7 Lonergan 1 JUSTICE 1 Mariaux 5 paralelística 1 Glavane?ti 2 mariti 1 jamatar 2 Infiniband 1 nigrithorax 1 lightweight 1 LILALU 1 menchuga 1 Ofahengaue 5 GNIX 3 flexao 3 Fauntleroy 1 Meotidos 1 Humbrecht 3 Malakatyn 1 Osmeroidea 1 monticelita 1 Kodtot 1 Knockbridge 1 Palanggoon 14 gallina 1 Horaces 2 Moraza 1 internara 1 Moscaríl 1 Hoeneisen 1 gózaa 1 partridarios 1631 Nosa 3 gupta 10 Isayev 71 gueto 1 Murgub 1 namorse 1 Jaunet 1 Nitixesio 3 Mystique 1 fröhlicher 2 Paustovski 2 Imprimiu 15 Idealismo 2 Jomil 2 neoformacións 1 Narnaviridae 78 lesa 1 GEOnet 1 Isoldina 2 Kaluza 1 parecerase 25 nevaradas 6 insularidade 1 paleofrixias 5 frijoles 1 Khamatova 3 Krakowska 1 Jokerman 1 komast 1 Korsmo 1 fornecesen 5 Macropodia 7 parasitarios 1 Malakoff 1 Lúnyu 1 Introduciríase 1 fujitai 2 fondeaban 1 Fucens 1 nline 1 Lasselsberger 7 Palenzuela 1 localicada 1 Germolles 1 Murney 2 Pandias 2 Laço 1 Muspell 115 Is 1 Pachycormus 1 fatuos 1 miraculeuse 1 OBJ 2 Humoso 1 iletrados 3 Kazuhisa 1 mušhuššu 1 Kazakl 4 Oudh 25 matouno 1 paranarradores 1 Miniques 1 Onan 1 Mayeda 1 Manjabálago 1 nuticional 1 Karginov 1 hemocele— 4 incorporaríase 7 míos 1 interasemblear 2 melanóforo 1 Malentendidos 1 malandro 1 Forger 2 Herramienta 1 holopoesía 2 Halopelagius 1 financiarán 32 Lepidopsetta 3 Naudet 1 penitus 1 irrígase 1 philastrei 1 Huguley 1 Hermandina 1 Pedrocchi 1 Gastricsina 1 Fiscalizou 1 hajib 1 ksam 9 Kadir 1 Jòji 1 intervinñetes 1 Fanari 8 pasacalles 6 Jarmusch 1 Koutny 1 inimitábel 9 Kfz 4 Padano 22 famentos 1 ludolphino 1 Kuntsevo 1 Kasserine 2 Favorable 1 Fouts 1 Honeychurch 6 Melisandre 16 Landtag 1 iraw 1 Mutou 38 incesto 8 misericordioso 1 intercéptaos 1 hydrocele 1 framing 6 Northeastern 1 Idhari 3 globoides 1 Meumarkt 12 muralista 2 Haulever 33 Moix 1 MMTS 1 Locales 1 Jadakiss 1 ison 1 Marrugat 118 Naturels 6 obedezan 2 Kriví 6 incluén 1 Kyauktada 1 piasu 2 Philippos 1 mitóticamente 1 Omenaldia 1 Gilbuena 2 farricoco 1 Groovejet 1 Madisonville 3 guechos 1 Mirakul 4 Lingones 1 Giarrizzo 1 Machang 4 Intimissimi 2 Onielo 11 Hirado 3 Getsuga 2 Onore 16 paix 4599 Internacional 3 gzlinux 1 pensarlo 1 Méziriac 1 Inmersa 13 Herrn 1 passeig 1 kakaw 2 Pagophila 5 McJunkins 2 Jarkov 1 GRECIA 1 Huangbai 1 Múlidos 2 metarregresión 1 KitKat 136 Oito 1 Ikare 1 Nuorempi 1 jfif 3 Paramushir 3 ima 1 kotýle 1 ostentarse 1 Icasuriaga 1 glamuroso 3 Landhurst 2 Neuro 1 Mye 26 Merian 35 greta 1 Laufenberg 23 Halych 1 ?ono 62 Farruco 3 Neher 1 hidalgensis 1 Gunai 3 Libéranse 46 Hixiene 1 Lurunbeg 1 parenteralmente 9 Josema 1 Ofek 3 Morgún 1 Grassmannn 1 Fawka 1 omeihein 1 Matuscak 1 Glatre 1 hallorum 1 inepcia 1 istinboli 2 lipófilo 1 malferiu 5 Partille 1 obrígaas 2 Hurler 1 léice 1 Hirschman 1 Gaé 54 Jimi 1 Pentone 1 Nukutere 1 lenca 1 Lindón 1 Lansky 1 Kelefesia 1 Neomphaloidea 180 identificou 13 Fossae 3 Mazzetti 9 Montbui 1 Locustella 6 logía 1 Liweng 9 Kadashman 254 Penas 4 Mahsoussé 5 hermanni 1 igeadh 1 inautenticidade 1 hitchhiking 1 heimelig 1 Kaxexe 73 inferir 1 IxA 1 Patinti 3 illouno 2 Newropeans 1 ordentligt 18 macaco 1 greque 3 Matalebreras 1 gutíferas 3 Platacanthomyidae 11 Kyu 6 Lapidario 1 ictioloxía— 1 Kimacud 1 Grafenwöhr 58 karting 2 peccatorum 1 Jimenistas 15 oosfera 14 Narradoras 27 Mantinea 1 glînos 5 Phonus 1 Norbulinka 2 nootrópica 4 gabaron 2 Matewan 2 Nauzet 232 ortodoxos 1 interrelixioso 3 Killip 1 Merchy 7 Federado 2 Lötjönen 1 Jaskula 1 ließ 15 metafásica 7 Mi? 1 fascinouse 1 maggo 1 Pelasgi 3 pinabeta 1 Nikodým 1 Gaomi 1 passaggi 1 Flettner 3 pistolero 1 Joechler 1 maclaughlinae 1 Gints 27 Huguet 1 Oncoviruses 1 glicositios 1 forchetta 2 intoxicantes 1 Jeru 1 Niceta 1 ladronas 5 Gymnase 5 inhalante 1 mörderische 1 nivelando 3 Incapaces 2 peuvent 27 Guillot 6 Guepardo 1 Mannual 3 Lipovsek 1 Khsha 1 hbdc 1 Ishak 1 Michelagnolo 3 Oton 422 Oficina 1 Miass 3 papillon 50 Martelo 1 garni 1 Lorys 4 Piconera 1 LPGR 2 Lísipo 27 inexperiencia 26 Perrineau 1 iñeris 2 Gojushiho 4 Monoxeneos 6 Gorbunov 1 galumera 16 Grella 1 Hómeros 1 Nasidze 5 Namekkusei 1 paraolfactoria 1 piuca 1 Phiri 1 Farquad 8 Hani 2 péctico 1 NUNQUAM 1 frugalmente 17 Happened 1 pedaciño 4 Liberti 3 MITF 6 Normando 1 malévolas 1 mesosauria 20 MAG 159 PCG 5 Ínclita 1 parcsn 5 maudits 1 Norigs 1 Kasimov 2 matthei 3 parsing 3 Pacs 1 Nidarosdomen 1 jošte 2 Minué 2 josikaea 8 lingue 89 municións 1 Hitaka 1 Gravita 1 karnukos 2 hollywood 2 Intellectual 2 pisaban 1 Lomellin 2 plantalas 13 microquimerismo 1 Hybrids 5 Hirzel 2 Jiriñ 6 Naru 2 moerse 1 Kwaisulia 14 Ferrera 265 fican 2 palaestina 1 Marietti 1 Melkamu 1 Fótspor 1 Lintei 2 gevonden 2 íngreme 1 Maeoli 2 Merethe 1 mâni 2 Ilgar 2 hidrodinamismo 5 Gokuh 3 Meixido 1 intraparenquimais 4 Guaviare 2 gallardetes 1 hotographic 6 Moirón 1 haematomma 6 Ormus 1 Hypoplectrus 9 Flaming 1 panem 1 monotonicamente 1 Onogur 1 Mitropoulos 11 intensifícanse 1 inmans 3 nanobolas 1 formacionais 1 lollaerd 1 Gangkhar 23 Horthy 1 Maffesdorf 1 lobores 18 Freguesía 3 Favalli 1 Jerokambos 40 Joiosa 1 Mukesh 2 lacértido 2 Nazotoki 8 kevlar 13 Paraplagusia 1 Malluk 1 Gotterdammerung 1 Joxemiel 4 isocromosomas 1 Homalorhagae 1 Laemocomium 1 Isidoro de 1 Heidenberg 1 Massoteres 2 Flox 4 lineana 1 obretus 6 Luong 5 Nickolas 2 Kalastajansaarento 4 gdje 3 Milady 3 Kranjec 2 hidrofoil 19 Lippe 1 Heland 1 fradre 20 Galisteo 3 Kanato 1 Horbach 1 Jõeäärne 1 Kumtagh 18 Iacobus 1 Nahio 1 padi 2 interpuña 1 Miocenonica 9 Krym 1 pentaphylla 1 Lambrequíns 1 formazón 1 Pagbunitan 2 petelotii 1 Natuurlyke 1 Loeff 4 Philomachus 1 Kenavo 10 Gelder 1 karamana 4 Flamurit 1 Mellish 1 Ottonel 1 Fulgsang 4 ileais 1 Janisch 1 margoum 8 GRP 1 Gelawdewos 18 Multi 2 intrusiva 1 peplums 1 Kosho 1 Irem 4 Haardrade 17 intercalar 1 pentápole 1 Nabonne 1 Lénárd 7 Nedved 1 plâng 1 Munioetazar 29 lexionario 25 hidroloxía 13 Jaa 5 fisurais 4 Moroyama 1 INDOOR 1 helminthoides 4 Impaya 1 PERNA 2 Monoclínico 1 Pepecar 1 maoiritariamente 1 paleoauga 1 perlucidus 1 Nyírtelek 1 manceaux 1 modernizala 1 Jarrico 7 Heflin 1 Mezzocorona 2 glaucomas 1 Phoniscus 4 Paroikia 21 Glazunov 1 Otofikushon 2 Nisan 9 Peig 1 iaks 3 Mamiko 2 Manchegos 3 Ferragut 2 incorridos 1 Iyyobh 1 independemcia 2 Isocromosoma 1058 Núñez 2 Mumie 1 Philippart 1 indietro 37 nucleolares 1 margaret 1 Laudenslager 4 panxabi 1 OnePass 1 Mégevand 37 perigosamente 3 Ghoochannejhad 2 Fidelman 4 insolubilidade 1 mesturarase 1 ieso 2 ligandoa 2 öre 2 Lorica 3 pelta 1 OTECA 1 Mcdonalds 3 influenciouse 9 Munakata 1 Philad 1 Malyuta 1 Madrenas 1 katmer 1 IVLIANVS 1 lopinavir 1 mazorqueros 3 Hibs 6 Petorca 2 Mendleson 1 Laé 1 Futunic 3 Holopainen 4 Iber 2 gratus 7 lernu 1 Gonta 1 gpIIbIIIa 1 Isbn 5 pedair 1 lmar 1 fornacinas 7 Matlab 2 Fuglens 1 lulangense 1 obteríamos 1 Guandalini 278 Independiente 7 hipoderme 13 Palazón 3 Pistaciaceae 1 Pacol 2 Montdidier 1 Gartenbaumläufer 1 intracorticais 1 Kupelian 8 metanoxénicas 1 Hamatan 18 maurista 1 orquetra 13 Malestar 1 Ideolóxica 95 Lourizán 1 mrtve 1 perpetuada 1 Parácrina 22 ocelos 1 Formello 4 Giwakuhen 2 Nässlorna 1 Fischl 2 perdeunos 1 leiostyla 1 Kehrer 1 Nerviol 1 Microfluídica 32 Future 4 Maliki 2 obo 1 Guedelliñas 1 lavandeiros 6 Piscifactoría 83 pasteiros 1 fecundaba 2 hidroviario 1 Kassab 1 Genesect 2 Pedrogaez 1 Karriere 5 logotetas 1 Pantiga 1 Hitohira 1 foias 3 Meseret 1 hockei 1 Neomedievalismo 1 implementasen 1 Jollasse 1 Lantián 1 goulimyi 1 microfinanciamento 1 Orereta 15 migrañas 8 legar 16 inalcanzable 6 Lieb 1 lischkeanus 6 Gatchina 1 garu?a 1 Modesty 5 inocula 10 Khublai 1 GUTTA 1 Girdled 8 Moratalaz 1 Mattathias 1 Fârtatesti 3 Katainen 1 muris 1 meral 1 Haaviston 3 Námestí 1 frutosal 2 Garumna 1 mokšien 1 Ligation 1 Masudije 1 Mariken 1 Ningaloo 2 individualizando 54 herexe 2 pepitoria 12 floricultura 1 nescientes 5 fedorenta 3 Fettis 9 hardtop 16 Formal 1 placoderm 1 Indifférent 4 Highcliffe 6 Pascasio 788 inscrición 20 pergamiños 2 noruegas 1 joiks 1 hipofagia 1 Kagamuga 1 pitanza 1 lavándoo 2 Hitikau 3 pentatleta 4 Ordenar 2 IRSS 1 fotograficos 1 Loricella 7 Oceanlab 1 Parascaptor 4 Kraprayoon 5 Guadalinex 1 haxaxíns 1 Gymnophthalmidae 2 Nije 2 Ortopodoloxía 4 Gakushuin 1 Ioxioka 3 mathematiques 1 Isaichev 1 Liginger 12 Oye 1 opíparo 19 inclusivo 1 Nimska 1 Ollado 1 inicila 1 floculante 8 Parvarchaeota 7 Modulor 2 Herpesvíridos 1 inspirarnos 1 permitirnos 7 flying 1 mobilizalo 1 Lüganuse 1 neoárabes 13 Padrendo 3 museu 1 Inducen 1 kilimandscharium 2 kánta 1 Lithoglyptida 2 Kopecki 1 Gárgaras 1 Minerealoxía 1 Foisner 1 Lópe 2 fortificarse 1 Interpretativas 2 Génération 6 Mapuche 1 maend 4 militiae 1 Pianura 2 Osfradios 1 Ottagono 19 Lente 1 lophotes 1 mitigaron 6 Oggi 1 kasárne 1 Fillide 2 pennello 533 Guarda 3 Natorp 13 Humanae 1 Izitsha 1 getuigenis 1 kešwar 1 gezer 5 mergullos 1 incentivator 20 omnes 1 Osho 1 inventariáronse 1 Mimoser 1 mercurii 2 Hölszky 32 melanesios 1 figorrodrigo 1 nalgunos 42 Níquel 2244 inicial 1 Hashashin 4 fracasaban 1 Limbkins 9 Ossip 1 Indlandsis 1 Ferrie 2 Lali 1 Piqûre 1 Gabiria 9 levodopa 1 Gabril 2 Hefty 1 Fotocromóxenas 1 Genès 6 Mörders 1 Glicopéptidos 1 Nuremburgo 1 gane 2 pistacia 1 fucoidano 1 manuelinos 502 gótica 137 Fernandes 2 lamíaca 16 fundamentadas 1 Ishizu 1 iculu 1 Otoloxía 1 lampung 2 pesozo 5 Igarapé 1 LKF 6 Labarca 1 Nozières 6 Kaus 77 Moda 6 genealogía 1 Lovas 3 microexpresións 1 Järn 1 Hampl 40 normalizar 2 Luenell 1 muños 5 MOP 2 miniaplicación 1 famiilia 3 Nagashi 1 Masorti 1 imploraba 65 operada 8 Ficedula 1 Noves 1 fidelity 2 parellamente 6 indemnes 8 insula 461 Marcha 39 inervación 1 inspeccionas 49 marcaxe 1 feniciasCartago 1 metaestudtita 1 oximetolona 2 heilige 1 felinas 1 patamares 1 penamellerabaja 456 IU 1 Fregonese 1 nagrodzony 1 MoHarran 18 gandos 1 illat 2 Peine 7 fixer 3 Lerda 1 ni?gb?i 2 iñoto 1 Gibrilla 2 Jamu 1 otcov 12 lanzala 1 Lasorda 2 Ikoyi 1 Lobuliños 1 farneseno 1 Modiin 5 grafitis 30 Hives 1 Oficinal 7 Iguala 2 overflow 1 pertencias 2 Hingston 9 Juanmi 1 kortet 1 Palaeobotany 1 numus 1 moleiro 1 Hosta 25 Fisicamente 2 Libh 1 Kumon 3 Nacaome 19 Higashi 2 Negociar 2 Immy 1 francu 86 interesa 1 Istrum 1 Gádeira 1 Gojita 1 luno 1 Peaurongo 8 lembre 232 Fuga 1 Oppewall 2 Hippocastanum 1 Guiarse 1 martiris 1 GodWeenSatan 4 mash 1 Pergamonaltar 2 organdí 244 Haia 1 Kamacita 1 Hanekko 3 Ishizuka 2 fixiano 2 Môr 1 Oenomus 1 Ladeiro 7 Lausitz 1 Granchi 1 Garcelles 14 javanica 1 mionecton 158 lateralmente 35 LEIRO 2 permitilo 4 Guergué 1 Omroep 1 insertarlle 3 guinea 2 Kabal 1 filmábanse 2 Macia 1 kimonos 4 fugouse 1 miomesina 1 Myst 6 Moyes 1 gá 1 Hariton 4 impenetrábeis 4 molime 65 Pays 3 Lieh 12 Kutxabank 1 musicalos 1 Lacke 1 Nörr 1 Originum 7 Fundase 4 Hippocastanaceae 1 Geraniums 10 Kogote 5075 Illa 1 Grifa 1 permitiuselle 3 Kringle 1 Patiños 2 Masantonio 1 Hylland 4 Gorden 1 farfallan 2 Lumbye 6 falsificados 2 Heiland 4 Metilo 16 pende 1 Mariatroster 3 Perniola 4 gabes 9 notocordio 2 longicaulis 2 kiss 2 Kamoharaia 1 Hypnotisme 2 Flaxelantes 1 Melbury 16 Passeriformes 95 funcionalmente 3 Ólvega 1 Filomati 2 ourizar 6 Keleti 2 Pinea 3 Fieiró 7 intelligentsia 1 Inkitar 3 nudum 45 Motril 1 Jonckheere 1 han?r 1 Lateingrammatik 1 Korforening 1 Konduga 1 Housenka 1 Irlàndais 1 imagem 14 Huaraz 1 Hemúlidos 39 Hansa 1 husker 1 Guénon 1 meluro 4 Giuly 1 fortalecéndose 1 Hewi 1 favorecelo 30 infiltrados 1 Kubišta 2 fenotiacinas 1 Oosten 1 Mheilearaí 1 loðbrókar 1 Mije 1 Hattis 1 Jolinon 4 gueada 84 Freixenet 1 Kapovic 5 FRE 8 leas 1 pharus 8 Guichenot 2 Maeb 1 Mannfred 1 Fonduxos 2 Lurssen 1 Lilìt 1 Keryneia 1 Kelpie 1 figurasen 1 Launilla 1 Ombros 3 Laputa 57 folclóricas 1 gathra 1 Lleón 1 hmn 2 Nickels 1 Nagme 1 Galiciennes 4 gastarlle 2 mesocúrtica 1 Pendurados 1 pilote 3 Intas 1 Ostenitse 1 Kanjica 1 IEND 2 Knutson 2 Kawa 1 IDs 2 luguios 2 happened 5 malograr 1 hidrotermai 2 Gosport 5 Perra 308 pataca 2 Fendu 1 Matodoso 3 Maxence 2 Moarsi 2 manifestarán 1 Gogget 1 Phaeoptyx 1 inhabilitan 1 Ostseegebiet 14 gángster 1 Herbstzeitlose 1 —frecuentemente 1 Oniric 362 Hulme 1 meurtris 2 insidiosum 6 Glemp 1 instigouno 1 penitens 2 Iwanu 2 Goodrem 1 Pelejà 1 fringed 1 Feng 1 mírabaa 1 hypocistis L 1 lazaría 1 Lavacolhos 2 Golfer 4 Fotocromo 1 Panacachi 1 Grebnyov 2 miji 1 negal 1 Jindai 1 Ngeth 1 istoricamente 96 homoxéneo 2 Morrendo 156 gráficas 1 Leviviridae 1 Monástico 1 Matusovich 1 Frithiof 4 Fraixo 4 ialma 12 oponente 1 Luchsinger 1 Forugh 1 Ledian 8 observadora 1 Montelora 2 Minoritaire 1 indramayu 4 penetrasen 1 identrificados 1 intracerebralmente 1 Folck 1 komme 103 Fermat 1 kuskokwim 15 Liderados 28 Musicalmente 2 kiribatiensis 2 MerenderoC 1 Lormer 37 Gaius 1 Nasirzade 1 giya 1 Pariciparon 11 observacionais 2 jins 66 plátanos 1 GOSSART 1 Kelser 1 Phyllobotryon 5 mnemotécnicos 4 Inglese 1 LKR 1 Kontopoulos 2 hipertermoestables 62 Gael 8 NYU 1 Grodotzki 1 Grebanu 1 Gesshel 40 Nanterre 3 Ouchi 1 nosce 2 Halász 1 Juras 1 Goudébo 3 imprimila 2 obsérvanos 1 guddommelige 1 Ioris 1 Guisos 5 metela 1 micofenólico 6 Fasilides 1 Guallart 3 Petralona 1 hambreado 3 peineta 3 Fornovo 15 MOD 1 Laforce 2 korxún 1 Guilera 1 Narcise 1 Françesc 3 Moclín 1 Hrebejk 3 next 2 Pecadores 1 muistiinpanot 28 Namaka 1 hemiteles 1 Kreuth 1 intsia 2 Gaißach 1 interzonais 1 Heringe 1 Guibare 1 Neritopsina 1 fascisa 1 Honraia 1 Iotti 1 metanetiol 1 foulards 1 Klembovski 1 nonkilling 1 Pedeir 144 Malmö 2 Furuhata 1 Kaiserz 2 Messius 1 Jolfiño 3 omou 1 metilatdo 1 Lebendig 5 Perrone 2 Micrococcaceae 1 informatica 3 Latte 127 hereditaria 1 otorgación 5 glicosilados 18 Multitude 9 Murtosa 1 Lefrançais 5 Manchú 2 institution 7 Josa 1 Lithograph 1 novazelandica 1 Grión 29 Löw 1 permitíron 1 Motorpsycho 1 Mabinogions 1 Mobilizacións 5 ground 21 nitrificantes 2 Matah 1 Pegando 2 Forschungsgemeinschaft 3 Nassellaria 1 Oncino 77 Melanie 1 Melastomataceas 996 Maserati 3 mandándoo 1 IXX 1 iker 1 Naturbuch 1 Parastropha 2 infomación 1 Magnetisören 15 manifestaban 11 Observando 5 Lebedynski 5 incharse 2 ofrecerllas 1 Oelknitz 2 Muzurovic 1 mangada 5 Karlskoga 2 Kisosaki 1 Osmerus 1 Leslau 2 Louisy 1 hrings 1 Grillmeier 3 pitää 2 Meds 1 footie 1 Newrose 1 ordinum 2 Monatte 1 jujigatame 2 llaga 10 ice 4 Niyongabo 11 Malmaison 1 Kaliber 3 Janovski 3 Islares 2 Fontarrón 13 pintorescas 1 intranquilízase 2 Grostein 3 Gaztelubide 1 Nagaio 1 Lusacios 46 insistindo 3 jersey 1 HAM 1 Pianeta 1 outlet 1 heterófilos 1 Litobothrium 2 Langonned 11 Insigne 4 Kaynarca 1 Paralaxe 33 Limanda 1 Giulvaz 1 Notolegia 7 Mitridate 1 hemopoiéticos 4 Israël 1 Matasari 1 Intervir 127 fenicio 2 odorifera 1 Malacorhynchus 1 MinGW 2 Fekan 16 paraban 1 LMV 1 JOW 1 Lyamchin 2 Grixalva 1 fijen 1 Ontiniente 25 futbol 3 Lhaki 1 Meroítica 6 gascona 4 Futaba 1 Mieloblástica 1 lohas 14 Monchique 7 Fedorovich 18 incisa 2 mortgage 1 Microbomba 1 Malendo 1 macaenses 1 Mistassini 1 impóñendose 1 PGIS 1 Kohanín 1 Fressard 35 Gee 1 papeletizar 1 gehört 7 Orejón 1 paguros 1 Liany 1 Narayaneeyam 1 Imagmi 5 Kebara 5 hidrazina 1 fóndese 1 Iñame 1 Mourinha 1 Focillon e 2 Lagadin 2 Marcianos 1 Osennii 171 nódulos 1 Pintáronse 5 Notarial 1 Hoinara 1 øye 1 Masiello 6 illalo 3 fanums 1 Girlitze 3 marchábanse 2 intracortical 1 Hyraciformes 27819 No 1 maroto 15 fíltrase 18 Plásticos 267 parentesco 1 Gloin 1 Monguno 1 Kostior 1 Komova 11 florecendo 1 Patife 1 Kopernik 3 hidrocarbonetos 1 iranensis 58 lémures 1 murmúralle 2 lumholtzii 1 Inciderit 1 galvanizou 1 Muitoa 1 Killberg 1 Perler 1 Horenstein 1 Kukuihaele 65 Legolas 8 Heorot 1 Oberstolberg 1 Pésanse 2 Mussenden 8 fanariotas 2 neuroprotección 1 Gondrezick 9 Kopp 3 Hinoemata 2 kda 3 materiae 39 nor 6 hedonistas 4 importáronse 1 Iliturgi 1 Imbaro 5 perseguiunos 1 Gyldendal 1 Kiris 14 Pelúdez 19 lofóforo 11 lisoxénicos 1 Hushabye 3 microfibrila 4 irada 1 Fuyumi 1 Oleícola 135 Narcissus 1 grijnst 3 Janchen 1 Graceiras 1 Movel 1 Harakina 2 Mfg 1 Lows 1 identificárselle 1 palmatisecto 1 Fincheley 1 Freudomarxismo 1 Pedair 1 PIPKIIbeta 1 Interviewee 1 Hernaiz 9 inflixir 1 Nadrlje 1 indústrias 1 Masías 1 Gungurulgungi 1 impelen 1 persicariae 5 Ismaelillo 4 Matko 2 Paczynski 1 Kuddus 1 Naeem 5 officiorum 1 pantoterios 1 Kamaixi 7 Nuttall 16 Knaben 87 Hendrik 1 NOGA 6 hindí 2 Golijov 1 oxidalo 13 Mayra 2 kokbok 1 Griñan 5 Fischinger 3 Giga 1 Pasándoas 2 Huyck 4 NBR 1 oconstrutivismo 145 impresa 26 Nativa 2 Lykkelige 1 litográficos 1 indigènes 1 marzynka 8 Lausitzer 2 Halldórsdóttir 2 Markezinis 3 Lowy 23 Maceió 9 loubanza 20 Highlanders 1 —Hè 5 Gunnera 14 Olladas 1 Mangiliella 3 Jannok 20 Isozaki 28 Kubala 1 Gadsbys 1 Mutilou 2 paidofilia 3 Hermiston 39 financiación 11 intensificaron 1 Mácféck 18 Gothmog 278 Luisiana 1 hiescina 2 Ipiña 2 Guiba 1 Noratlántico 1 htgr 15 lisinas 1 FamilyCar 3 Macenonia 4 Iudila 1 oveludo 4 Jaide 3 Hierbas 1 picadiña 1 Fileto 1 Glenmornan 1 planetars 1 Hakhamana 27 galope 3 Pelinor 2 Isocrates 4 Naïf 63 Kinshasa 2 Hennen 25 KAN 2 Marovo 1 Overijssels 591 graxa 274 Meis 1 Jinbilnggay 1 Mähringen 1 impetuani 1 newsdesk 1 Matild 1 Kuyckx 1 orotemperado 4 Inmutable 2 imiten 1 FOMC 4 Início 1 homenaxearían 2 Masllorens 3 Panoias 1 Harlond 1 pillum 2 glandulae 1 MundoGaliza 1 Intercellular 127 loucura 1 incrementándolle 5 nomograma 1 Metapolitefsi 1 iiyanh 40 multitudes 2 Notablemente 2 metacomunidades 3 monspeliensis 2 Monodactylidae 4 Faroles 12 Fosfolipase 1 Farnacias 1 holmen 1 Nocturnidade 18 interpretativas 1 Michapanihita? 3 Hamleigh 1 Fodla 18 Llevant 1 Frejat 1 galium 1 perseguíaos 1 Intedepenmerda 1 Gangarilla 1 plasmacitomas 2 lográndoo 2 madrugar 1 grunt 1 paglilinaw 65 oblicuo 1 Ischemas 1 Khromov 1 maracuyá 1 patinete 2 Nume 7 Katakuri 25 filovirus 104 GABA 1 Halicryptus 1 FUSTIS 359 Irixo 2 Menstruum 4 NRPS 56 Mahiliou 10 Freimut 4 Österbotten 2 fotolitoautótrofas 8 hemimandíbula 1 indicaríaselle 25 Imán 1 fallaralle 1 Notacantiformes 3 Mormoopidae 8 palomino 1 Irkus 11 fosfatados 3 Kouros 1 Frutwangler 2 Grigorii 1 Landskapsarkitekters 2 highline 1 Kydia 1 incluilas 1 Juneberry 1 pientades 1 Kafirnigania 1 navemento 1 Frej 7 Mitteleuropa 1 larga 11 Katakwi 2 Instituta 1 Haymitch 2 jazyka 7 Fenollosa 27 instaura 4 kiswahili 10 Moissan 1 Krushevo 1 Golok 1 fourreau 3 Meistriliiga 3 glabela 52 Parábola 1 Gracillicutes 1 Ghazafellos 1 OlimpiadaHomeroColonización 3 neobizantino 1 Kongress 1 Leveroni 5 Haycock 1 Linßen 1 patibility 1 identificáronas 1 Macquaire 1 parpadexo 1 Godai 6 originales 1 Leócrates 2 fundadador 29 Junyent 7 pillou 3 musta 6 Haq 11 Inazio 6 Neuveville 11 horticultores 2 Padrino 3 perforaban 5 Pharmacol 2 Lulach 1 loches 2 Navarini 47 pallidum 13 Libya 3 Iralabarri 1 Osaekirezu 5 Kamau 1 observarás 2 guindaba 1 orbiculadas 1 oxidiftálico 1 Ladrar 165 pediron 2 fondants 5 Mentalist 3 IQR 8 Godello 1 otium 52 Larín 2 Minneápolis 3 Makyo 37 hidroxiprolina 1 Kirjanduse 1 litoráneos 2 introspectivos 1 Kakooge 2 Inscrita 36 fanerógamas 1 niemym 11 nadaba 2 Intestinal 1 nomeno 1 Kuranaga 1 marcomanis 3 Locusta 1 permitíame 1 picenos 3 ladinos 1 Karmenu 3 Machichaco 1 Marush 1 Marwysgafn 1 Fradamiri 1 hspWAfrica 5 Peucedanum 1 habraham 1 Laurenzana 1 Gringolet 1 Pedicuro 1 Megaelectrón 4 Marrakesh 1 hamán 1 farras 8 Fil 9 Meli 1 McKayle 2 Marella 1 Kadavulailai 10 Gladsaxe 1 Papavasileiou 5 Gisèle 1 lagena 22 Mandamentos 1 paixonais 1 Ostedijk 1 Paladia 3 Kafelnikov 1 nicotianae 80 ocupouse 1 jauari 1 pandereiteiros 1 Goeba 1 palinuri 2 llegará 9 fuxa 1 Gaiato 1 gratum 3 matra 1 lipidograma 1 Interpolación 1 FSIS 1 Governatori 33 migra 2 Patagoniidae 1 inuguró 1 Martî 39 fotogramas 1 nikko'l? 1 Nsé 6 Margie 1 fuscifolia 3 Madrastra 1 odb 6 gasa 2 Karaye 6 Moyne 2 Hamizrachi 1 Kontyos 9 libertarismo 2 Laufey 4 Loaiïngea 6 júniors 2 Khalwa 1 peridotíticas 2 Phocid 29 Maelgwn 1 Neitzel 1 filolóxicamente 18 orofarinxe 1 Inglot 1 Hirkan 2 Monodontinae 1 Nabou 1 Mitumba 8 Miliciano 8 faltos 1 Morganucodonta 2 FUT 2 Irispaxaros 4 fosfoproteínas 1 pardicolor 2 mapunche 10 Minamiawaji 55 Katusha 2 mastoidite 8 Misty 2 miafisitas 1 Fenolftaleina 2 Pithoprakta 1 Outa 1 plantases 3 Foxen 1 Ndlambe 2 patricii 2 Kartheiser 13 percíbense 1 Jaurlaritzaren 9 fontanería 5 Malumbres 1 mierenses 2 GoPro 4 Kokkai 1 kinuboila 1 Myb 1 Lemont 7 Kinsale 1 IVSimón 1 mhaithimidne 1 modificaciós 2 Platges 1 gojat 1 mban 1 peperoni 3 MicroARN 1 Papitour 5 Pelles 1 ostalgici 1 Osbern 1 Loxosoma 2 Interspaced 1 Külso 1 Laholm 1 Parisis 1 Gearailt 2 montaren 1 fibrinolíticas 2 grogham 2 ideouno 1 phonsoung 1 metross 1 Platonova 3 Forssan 2 fixarán 46 Klimt 1 homólise 12 latifundio 10 Leániz 1 hymettia 4 pentalobuladas 2 Hcc 103 lactoferrina 1 Messageries 1 Halvey 1 Matadouce 1 Kwartieren 12 Horologium 2 gavelas 2 inmunovixilancia 3 metilbutano 1 Kenethel 1 Ismine 1 mollicomata 1 Jegar 1 Godounov 10 JS 2 Jászárokszállás 1 matanóxenas 13 Matureivavao 2 hinoxianus 27 harmonizar 1 Mardeev 3 nina 2 Galiçya 21 Mhz 2 Kongens 1 Iolanta 4 Œ 1 fitomenadiona 1 Kannabikoa 1 Larman 1 Latuva 1 philbyi 1 Iwasa 1 Miltoniopsis 1 Matech 2 Mitrella 1 joka 1 francosuízos 1 FSSC 2 Kordofán 1 liparitana 2 Oceanógrafo 1 Niewinni 15 Lumley 2 Middleweight 1 Irodori 2 Grin 1 Iaacov 2 ?ni 2 PCBS 1 Frisbey 5 Orthomyxoviridae 1 Hoehlenkloster 1 Jacaritia 2 Kaikilani 1 Henriada 3 pasteurii 1 fumasen 1 Meisho 1 metricus 1 Mbokani 1 Kostja 1 Kopeyka 3 Gaueko 3 Krollspell 2 Madalen 1 ghueves 2 Paschalis 2 Permutation 4 lacazáns 1 Laupa 27 monográficos 1 gwav 26 interrogantes 4 intrigaron 9 Finsen 1 Lughbhaidh 1 kv?at 1 Jerriais 1 lipotimias 8 hidroxenosoma 1 Hakaui 2 hemileucoptera 1 Hesperelaea 5 Hermógenes 1 Güido 1 LaVaughn 1 fotoquimioterapia 1 Halassy 1 Padema 1 Natàlia 1 Marquitta 16 Misterioso 3 Imám 6 Muradal 1 Nässjö 2 kunna 1 Hennige 8 moderniza 1 nak 1 paarden 1 Halebardier 2 Motalava 10 imprevisíbeis 2 gsfc 2 fenotipación 1 Ibr?him 3 mammatus 6 isostático 1 OSSA 1 hobbyhorses 3 Gañar 1 historiográfos 7 Opernhaus 1 Pii 3 GPSXXI 1 hleinir 3 GSHC 47 orangután 5 Ferros 4 Ladón 2 Kadiatou 1 Fidxiano 1 Gavrilova 1 Gambar 7 lithos 93 Newark 1 hoxalata 9 Lipsia 2 Napolioni 1 gálbulas 26 fragmoplasto 3 lara 1 Jadzhoj 1 Khaleej 1 Greening 1 Finsec 1 Mochuda 1 horón 38 inxiren 1 Pirotecnia 3 galeguizando 26 Performance 1 kement 60 fractal 1 perversions 1 HABUISTI 4 Offtime 1 Kurse 1 phos 2 Gourmand 2 Pianoforte 2 iberia 2 Nests 1 IFOR 1 Giseke 1 medrosos 3 Natten 369 localizadas 3 Outórganse 1 hedone 1 Frundsberg 1 Outrs 77 penedos 1 Manea 7 Fritzing 1 marmoristas 1 muskegs 1 faunavulnerable 1 Laighean 5 hepatotóxicas 2 Peredilla 2 Leyda 4 oceanódroma 1 Ossu 1 Meteoromyrtus 17 Litchi 3 Kastomá 1 Lejadense 1 Ochsen 1 NosEstados 1 Mattimore 2 Monnezza 23 PCF 1 Godfroy 2 himnes 1 himes 1 ornare 1 Motorhellington 1 glucoxenolise 1 Leaburu 1 Novæ 1 leitosas 1 Galicano 3 Kivilahti 2 Neurolóxica 3 listaban 15 MY 1 mengano 5 Jaroussky 2 Ikata 1 koete 1 fluuii 1 Inhalando 3 masificado 197 indicación 2 mulera 6 Heaslip 724 mark 11 Kulm 1 Fotodiodo 1 Mainini 1 Fürstemberg 2 juni 2 plastidiais 47 Penarrubia 1 lactoperoxidases 5 Karadžic 1 kemuni 2 Ornatos 2 Ineson 1 Metzia 5 Messalina 1 Inuvayen 1 Fertig 8 Keisha 1 hjálpina 6 Kostic 9 Mefistofele 8 Feelgood 6 loar 2 fazendas 1 Galloperdix 1 Leuchtkaefer 1 Ocupadas 1 marquei 14 Llana 3 Koert 1 Lørenhallen 1 Lumpen 9 moschata 1 Pingüón 38 GFDL 1 offusqué 1 Orphelins 21 glaucoma 1 lexislautra 2 impermeabilizadas 1 Münchh 1 Karakéhéyan 1 Grondsma 1 Glar 388 neses 8 Ghul 27 Orlov 1 FrontoparietalFrontal 6 nordistas 1 peletizados 1 pipernino 7 Machicha 2 orixinelmente 10 Miseno 1 Mohamoud 8 Lika 2 Housin 3 Naxçivan 1 Munaðarnes 1 Gavoa 1 Hoku 33 pior 2 Papuengraulis 6 Kuopion 7 muxir 1 Gualmar 1 heuglinii 1 orixinialmente 5 Libertário 3 Harnett 1 masclus 4 Matiena 69 financiado 1 Loussier 1 Greboun 1 intresante 2 Haanpää 1 Grabb 9 Márcio 4 homeoptoto 5 Graphic 1 Jablanovic 2 Miúcha 1 Follia 3 Liqasi 2 Panolis 2 Lovesey 36 Hearst 2 Mâconnais 1 Goldring 1 phogo 1 Gebr 2 Gunwinggu 40 Levin 3 Findlay 2 Manya 3 iPSC 1 Katangueño 1 ovelleiras 12 Lieiro 1 Myriactis 1 leïamos 2 Kiganda 1 Iónico 1 Jaquito 1 pa_sávo 2 ostensíbel 1 Guyander 7 Intercalación 1 gritaban 58 neandertais 1 nägar 1 Faramond 8 Jérica 2 Frandovínez 11 hipertrigliceridemia 2 Mineralli 2 Guío 1 interruptoras 3 Pardaces 1 locações 1 maienés 1 FICO 1 Metabolízanse 3 Neorealismo 2 intracellular 1 Mcgraw 1 Muntercasduff 2 fichte 57 napolitano 4 Kulturgeschichte 1 Lalino 49 Folgueira 49 monopolios 1 Kaxiano 1 latinidad 46 imáns 2 figles 1 Forcey 1 Obsesionada 1 Maschito 1 Finanzierung 1 Nekonecná 2 Nematocarcinoidea 3 Ficher 1 kuehnei 5 Íntima 1 gojeh 12 Minoritarias 32 familiarmente 1 fluidum 1 Kanjosen 2 Mensualmente 1 Jushikhwesa 2 Lommy 35 Independentemente 1 Leiblum 1 Helmantike 426 Graña 1 flagelado 1 Lundqvist 692 Pico 1 Osseyra 3 McMahan 5 Papoula 1 Ingolfiellidea 1 hipertextualidade 2 Järventie 1 nasoloi 2 Güi 1 Kárahnjúkastífla 1 kanpo 3 Gatsch 33 homocigotos 11 habrá 2 medunitza 1 Hesta 1 ISEN 2 Horixe 1 Kalashnikova 2 Golfines 2 Oweini 1 Orientierung 2 Iwase 3 Keokuk 1 Lagramante 1 hexametilmelamina 3 Inquietante 2 Patthar 1 París 1 incopore 1 marginimaculata 1 Izsák 7 Noureddine 5 ferial 1 lanzamientos 18 Nomi 2 Mudrow 4 Northfork 1 Gaigè 39 Hamas 43 habs 1 Mireio 1 Minotaure 2 Iliya 1 matkasell 1 islamófoba 1 interpoñían 1 ortoésteres 3 macrolingua 1 Monadelphia 5 Navarredonda 42 Isle 15 Orbe 5 Oldrões 2 hjerter 863 fillas 4 Generum 1 Irien 3 PFL 1 Paganico 9 Negundo 1 Katiali 1 McLamore 3 Fierza 3 Oropeza 4 perdurase 1 ofréce 3 Mugil 1 Lozahic 1 Picoplancto 1 fetifera 5 Haggerty 7 Penavide 1 mecs 41 Obxectos 1 Gretzenbach 1 PIGG 97 pinzas 2 Krausch 1 Marmoristas 1 Larunda 3 Ferrocromo 1 humidifié 21 Koper 136 pasouse 1 Khanoum 1 Gandarus 1 Jolfa 14 Pasquali 1 Japonolycodes 1 Goldust 5 lograrán 11 Lusofonía 1 Lavale 1 otkryvayut 1 Iyengar 5 Miñana 4 Hydrobatidae 1 percorríano 1 méramente 2 Kuula 1 internacionalizáronse 11 perennifolio 1 Kawaloan 4 mirarte 1 kvitniey 5 Ortigas 1 Nuraxi 16 Freguesías 10 Grateful 3 Moktar 1 Montoiro 1 Oíra 3 hidroxenotrófica 6 Gerets 5 Liencres 1 Paulist 141 oscilación 3 Morphina 1 Ourous 1 Jalgpalli 1 Jinke 3 memorialista 2 Minao 1 Iaies 2 Hirundinidae 2 Hundertwasser 3 Morcar 1 Fidelo 1 ? 1 krioklys 1 Friedrichsfelde 3 piata 2 Himeta 1 Pipracil 23 Kalev 1 Phanerophlebia 1 Orfes 9 lieber 1 Paediatr 3 infantado 1 lôfa 1 paterneiros 116 Intelixencia 1 Novantae 1 golada 1 KPresenter 2 mostarda 2 Gonchor 1 Paleolíticos 10 MMDS 1 Giliazova 2 linoleografía 32 Planes 23 Kristina 11 Perché 3 Imbelli 1 Loubado 9 Litha 2 Niquero 1 Iode 1 fillio 1 Krzanowice 14 nau 4 III— 2 Fränk 3 Manitowoc 2 ócos 9 organometálica 2 Fayalita 1 labiodentais 17 Gothic 4 inflable 1 LEGAIS 1 Fonseka 12 Jak 1 Fanninia 5 Kovár 7 impensables 1 mutso 1 Kurk 1 Hausman 1 muskeg 1 inflúese 5 guberniyas 10 monista 1 GarageBand 2 Farneseno 4 junonia 2 Helgenberger 1 Michalka 4 Halldórsson 8 Novotny 1 Firmafesten 1 gjöra 1 nivales 1 mu?ammadun 4 inu 7 fortificando 1 inveterados 1 Oysterhead 20 Nariño 7 ferropénica 17 laúdo 9 Govinda 1 kelee 1 Pharmacopeia 11 Patrício 1 Phthinosuchia 1 hundre 4 Gandja 1 Fernao 11 madeireiras 2 francés— 3 Hilty 9 Pharrell 103 Negros 1 Groede 1 Kemeru 1 Marchet 1 Miragoâne 8 muhafazah 7 Moncalieri 7 Gobat 1 intercrural 1 Kwesar 1 homogeneizarla 56 max 6 Goia 2 Gornje 1 namórese 1 GEMINIVS 1 Phongwalaiporn 5 Gangliósido 4 haploidización 1 pastrán 7 Paspallás 4 Mercenarios 1 pa_sáva? 3 Horten 1 Ficoidea 1 grishm 10 latifolium 1 gjør 6 Labios 17 Panhard 1 peteribi 3 Menkent 1 Mahonia 1 Migoto 3 Fettes 4 Finisterra 2 Miláns 1 Hemelvaartsdag 3 gargouille 2 paraguayensis 1 Ionioi 3 kyung 11 Frieiro 2 Fougstedt 1 Newcummers 5 Lagareiros 3076 lei 1 KOSHIKAWA 1 GALNS 1 Legorburu 1 mestizaje 2 Mezghiche 1 miraren 23 parafiléticos 8 Fociños 1 Holothuriidae 1 operáronse 13 IKK 1 guerrileiros 4 Hofheim 3 monografias 5 Imia 1 Gunny 1 loinxitude 1 Gloaguen 1 Mutaho 1 Plasmodios 1 Laragiya 2 micros 1 Kaxmir 14 neuen 4 insbesondere 3 péché 1 memorizalo 3 Golfa 1 pentágona 1 flósculo 1 Guimiliau 2 lurpean 2 La 1 pervenit 1 marñeiros 8 Oyabe 244 feiras 29 fumes 2 Lapen 90 Nunes 3 parácrinas 2 Palín 13 Maldita 17 periodontais 1 Internat 1 oitvados 1 onxectos 8 JRT 1 honrador 1 möhk?m 1 Milanich 18 hispanoamericano 2 Nellore 1 Huneeus 28 improvisadas 1 intestimoniable 4 Platel 183 haploides 3 molestada 3 introducírona 1 Mençía 1 KoRn 3 motitensis 1 oms 2 Mangyan 8 palpación 1 NyLon 1 PhysicsWeb 1 instalába 8 Már 3 Nidal 3 Laserlight 1 Karns 1 Heinekken 1 Fyson 11 felice 44 optan 1 hiperuricemico 1 Itana 1 Laetiporus 1 haemulonii 12 Nagore 7 Kleinschmidt 1 Paruroconger 1 Heinrici 55 pare 139 Foucault 1 Intercolexial 1 Kannerezed 1 Parapinakes 1 homotriméricos 1 pasacintos 2 Leisha 2 lusitani 1 planificadors 4 Matados 1 kulcki 1 Khojavend 2 HaMa 1 fetoproteínas 2 inconscente 1 nyassae 2 Luisenpark 4 Hyppolite 1 Helianthodae 1 Mourey 1 huarango 1 Monocromos 1 nephelêgereta 18 Lanzamentos 24 Naguib 1 Libertari 1 kitto 1 Gadzic 34 Gaya 2 limosos 1 legáis 1 impedíano 1 Gorzow 1 mólico 1 nojo 2 leiterena 2 FXI 1 infracobertoras 19 Namorados 1 nachtlied 7 Montroig 2 Herasimenia 4 Leguineche 1 neighbor 15 Itinerarios 6 Neuroscience 1 Pencahue 141 Fama 1 nucleótiso 1 Imboscata 1 MULLER 1 Pchinya 16 Fried 9 Ketterle 2 ninguién 1 Kynes 1 meissneri 2 IUPHAR 1 FastFuse 4 Perls 26 Milena 1 obxectal 1 Haereses 2 Maruny 2 ovulífera 1 Homeboy 1 Luodian 3 Magoo 1 Paraquadrulidae 3 gateways 17 Lanark 22 olmo 14 Helens 2 Monrepos 1 partent 373 Iberia 1 grandicalyx 3 independizaría 5 patexo 1 Ferrián 1 Plantagenèt 3 Losacio 1 miotubularinas 5 interconverter 1 Khlopotnova 3 Melchert 1 naturtalista 1 metalheads 1 Litoloxía 1 Gomácin 1 Orquidoides 1078 localizada 1 Melgacense 1 paidagogós 184 Minsk 9 Mongois 1 Micromonosporaceae 2 Menezzes 10 Marei 9 Farré 5 naj 1 Nizkor 1 Follestat 10 Mallón 3 Pénjamo 1 Guérite 1 Pintá 1 Fefferman 1 Momboy 1 Pedestrian 2 Iubitsume 1 OZA 2 Martinsried 20 head 4 Galena 1 Lohmann 8 Hatcher 1 Libertie 1 ibeno 6 oncoxénica 4 Niin 1 muierea 1 guêpe 1 mediacana 1 Papagaios 5 Gasolineira 13 navegacións 1 Halbbogenschnitt 1 Kukula 3 Muriano 1 GRL 1 manoscrito 170 luminosidade 1 iluntzeko 23 fauvismo 5 Fluid 40 Hathaway 2 graciar 1 Ljubljani 1 folguísticos 2 muzika 1 organoides 2 Mengxia 78 Fortes 1 MacNaughton 1 hibridización 2 frisada 335 memorias 1 Kyong 1 Mailu 2 Goulue 1 levantarán 2 Läufer 1 oblóngoelípticas 1 Kentingern 12 Mollo 29 Illiger 1 gúoqí 1 Ghélati 1 Phascolionidae 1 Natsukashi 1 Kichwas 1 Gildenhuys 1 Grateloup 15 galactosemia 1 Metilenociclopropano 283 outorga 2709 humana 4 legato 13 palleiros 1 goshenit 2 kümne 1 Miesegaes 1 hagiografias 6 Moscóforo 2 hopp 1 maravillos 1 Namophila 12 neglecta 5 formidábeis 1 Higbee 2 Guichen 3 laído 38 McBride 25 hámster 2 Hyannis 3 Juvé 1 Lácere 6 Itta 1 Hedw 2 Kaminoseki 1 normanista 11 HANS 2 Nosebridge 8 Lusaca 5 inxectiva 1 Phragmipediun 5 Horsa 1 krokos 2 Ihowa 2 MBT 40 Maianca 1 froll 1 Iya 3 LMT 1 ofinalista 1 futurística 2 Freiriñas 10 golpeouno 1 occisionem 1 indetenible 2 lixitol 12 filipinas 26 Hackney 6 Memmi 1 Iracheta 3 Pamanzi 1 INSALUD 1 governativa 2 piruvatos 3 médranlles 2 Gurdin 1 Mengamuñoz 46 Imp 2 linnad 1 JYL 2 Height 1 haxemitas 3 Palheiros 1 permanentemtne 2 Morgai 1 Hämmer 1 mirmecocoria 1 Flawil 1 infratemporal 2 Lilis 9 lumínicos 29 Masó 4 percusiva 1 hemimórfico 1 Heighway 1 Hiyoshi 1 Pelagomonas 22 Mindoro 58 ministerial 8 Katattsu 2 Lifau 1 Palatalisation 1 Paoline 1 Mhothair 4 Neonatoloxía 3 graduaríase 1 Misericoria 1 Keimusho 1 Pawelsky 20 gene 1 Manamtam 2 Foveola 1 periodiche 1 Honki 3 memorizadas 1 Maeder 1 Geosiphon 3 faríalle 1 jungas 1 Permanecede 17 Herpesviridae 10 Nuits 1 Madelia 1 Ipotesi 2 Fernándes 5 monotongos 1 inspecta 1 folguístico 1 Merizzi 2 lucayanum 1 Karaisali 1 Literatas 5 Luminaria 9 micetozoos 1 jatkui 2 Manteuffel 2 Morlock 1 ?aram 116 fervenzas 1 Galbina?i 1 mundo xacobeo medieval 26 Fonomusic 1 icondensables 1 Lambung 1 Intraperitoneal 1 gratinadas 2 LEU 13 Hofu 1 Pispir 1 Narratoloxía 1 Ghazels 1 Nafusa 1 Nagarhole 1 nebi 2 humedecerse 2 Paxinou 1 licoroso 1 ?ner 1 nervatura 18 Freie 1 Fründschaft 192 incidentes 1 kolata 1 nokoensis 2 Lentellas 1 Joseland 1 pergola 1 niada 40 opaca 6 pasiego 1 nação 1 Gymnopentzia 1 Hieremys 1 mest 4 Pawl 4 Muxia 1 Hammad 1 negrexado 6 Motilla 1 Makiaute 10 Oldrich 2 MASP 3 Heinävesi 1 Koritsiá 2 Marului 1 Khiid 2 Maxtone 21 norleste 3 nª 2 Hainuwele 5 Fm 1 Iudeorum 5 Giné 7 Pasillo 2 guardacostas 23 Manzanillo 2 Ottobrunn 1 Imperfection 1 Nabrit 2 negrero 1 lacrimoso 6 hidronímica 4 Kingsbury 1 microsatelites 1 lügen 5 pagala 3 Jarpa 2 Peal 1 microsporófilos 1 Modeligo 4 Leptodactylus 1 Montbrillais 5 Ghaleb 7 Firmacutes 11 Hoe 1 Kurdish 1 HON 4 ínsua 1 Minl?rl? 1 Ouaninou 10 Nicte 6 Makuma 220 Johansson 17 opresivo 1 légale 5 Ostkurve 5 GULO 2 inventivas 1 homelinux 1 Liboi 1 nucleidos 5 imaginarias 1 Handlanger 1 Korsnäs 1 losae 1 Morsing 1 Peñaferruz 1 Hyakume 1 iezuvis 1 Lecropt 1 Hwangok 1 Mataka 1 ozenae 1 Montcau 2 Hajdúnánás 3 ogilbyi 2 heraldistas 1 planificaciñon 4 gaños 1 FFVII 6 kniaz 5 PcG 1 herkkuja 1 húsið 1 osteporose 17 Pisani 1 pinacothêkê 1 Hubieran 1 Katastralgemeinden 1 golpeose 2 heterocronía 13 foot 1 magIster 1 Gajate 1 heteroxeneas 1 Haydee 1 lobedu 1 mitigáronse 1 Honeydukes 52 nitritos 8 Mireya 3 Nyctotherus 1 maal 1 Musidisc 1 Padules 1 neurasténicas 1 licorice 1 gasificada 1 Mabely 1 pépticos 1 Larguito 3 Münzlegenden 2 IgrexaSacos 9 imans 1 Jeffs 2 Patruchev 40 invariable 3 iugo 30 multocida 3 nootka 1 Piau 2 forzarían 1 Nabob 1 Heutte 12 granulada 5 Nabão 1 gradiante 19 medible 9 Partícula 1 Pedrengo 1 Personen 1 margariteña 64 liberalización 5 Frew 3 Histrionicus 2 Paterniani 1 pHmetro 2 Glennascaul 6 Maximillian 1 instruirán 1 Funges 3 Phaeophyta 5 peraltada 3 Merauke 1 funadoko 1 Istolacio 1 Freckenfeld 2 Gurdulú 1 Nájar 1 Itifálico 5 parecera 1 kohtaamisia 1 LaBouche 3 Imbernón 1 Khorovod 1 Kilolo 48 plantada 2 Fujiyoshida 37 Jacobi 1 Jarius 1 Pixariá 18 Henkel 1 Monsolís 1 lasiotus 1 Ólafsson 1 Hubertine 2 Muhrer 1 paradoxica 1 Icom 2 Freila 3 Kravtsov 1 glossae 6 Jetson 1 OPTIONS 73 Mackenzie 6 Niccola 1 Hubaldus 1 FFDEAD 5 paneuropeo 2 ortógrado 1 Mieuli 1 permitires 131 fotosintéticos 2 Nomingia 52 multiplícase 1 Kaique 1 Fritissa 3 Paulinas 1 Maud? 3 Miloševic 3 Heaf 1 Knockycahillaun 3 Forbis 28 menhir 1 Nh 1 Ludder 3 Nafissatou 1 Fesdis 1 gregacomposta 1 odjâ 4 irmanciño 2 Hepatus 1 Gajanana 4 monitorizando 1 Gamm 36 Pisón 1 Oltcit 1 inmobilizaren 1 favn 1 Khosiajstwenni 1 Hyptis 2 Fúriga 11 muiños 1 Juuko 1 Klassenverhältnisse 33 fomentando 1 hipógrafes 2 Horro 21 Libélula 1 filosofan 7 Nazione 1 Oidheadh 2 pelargonidina 1 Operationes 2 Hokin 1 Jawlensky 4 hipertextos 1 Fallada 2 Maynilad 2 Geikie 2 Lambrinov 5 Jarlsberg 1 Keshiki 1 Miska 2 Haizer 1 Kulturkampt 1 Mindovg 2 homocíclicos 2 Lehar 1 hunanos 1 nabetea 11 Neóxeno 1 Gbonyin 3 Mesotelio 3 plasmas 1 Nolano 27 feomelanina 1 kambio 4 PBM 1 Gaspercic 3 nossos 17 paratopo 1 Jetée— 1 Phytoplasma 275 Inocencio 1 Lipi 66 Obelisco 2 naggara 158 maduras 4 inflixindo 1 laittug 1 Naffarin 1 Keimakasas 6 Laverty 1 olbmát 3 kumbabi 1 Leré 1 LaSardo 1 Los 1 nuödöy 1 Murge?ti 29 Graxas 1 NERO 1 Kostolomci 1 Hüllet 1 Hraunbær 2 minuty 6 Gonçaluo 12 gravarse 1 Lizarara 10 Heynckes 2 Ignatios 104 heavy 1 Goulia 1 Numerología 5 Multiplícanse 1 Pepico 1 indestrutiva 1 mengae 6 neutrónica 1 Meiou 15 pigmentoso 1 Juxon 2 l?k 4 penicillata 1 Maâtka 1 Picenio 1 Limifossor 50 Kropotkin 1 Indepiendente 3 Mühldorf 1 Neuralxias 1 Foofur 14 llegado 1 fedreral 1 Merciles 2 Feachem 506 nacido 3 Kingsway 7 lenape 1 Olaverría 1 Padiernos 282 mencionar 3 Pavlovic 1 gasóxeno 1 Kocenu 2 Odabella 2 Megerle 3 nanoporos 1 Independetemente 20 paseando 1 Lifestories 1 filograma 1 phoreus 3 Liajov 1 Neuhochdeutschen 1 Lithostrotionella 2 impatiente 1 monologo 11 habe 1 Helsingforsarenan 1 noitarega 1 Mosquitoes 1 musicólgo 7 Physiologus 4 Foissner 2 gadaría 1 Liskovo 1 Nachtkonzert 214 Miró 1 kheilos 1 FARIAS 1 HJO 1 Pirat 153 Mieres 1 pentatiepano 1 kaoliang 370 pesados 5 Graduados 2 mionemas 1 Noemvri 5 Hmong 1 hpijs 1 Macares 6 Pinsker 3 Helmski 1 hidrotimétrico 3 keralianas 9 Magenta 1 Latènezeitliche 5 oficiaron 2 Gorgy 8 Junker 1 Niha 1 Kazmierczak 39 Instrumento 1 Galamandalfa 2 Flashpaper 2 Giovannini 2 Meiyo 1 incriminatorios 4 goto 1 Fotovoltaicos 5 Karima 1 manimos 1 hTERC 3 Iulio 1 morbis 1 Jubarkas 1 Friedlaender 3 Melis 1 nordelch 1 nulain 1 Ootoo 1 natelínen 6 indicándose 6 Osoiro 1 Foltesti 1 Marées 1 Kyrios 2 Pelloni 1 kuttaka 1 Paff 1 Morganza 1 Jj 29 Grus 10 nuestras 1 larváceo 13 Landoira 3 idealidade 16 Pensaba 1 hipoperfusión 2 Lagrimas 8 Fezzan 4 Guiot 1 Malferido 1 ortes 1 Ganbara 4 Lexico 1 Lautschan 1 Makedonya 1 lucentense 1 Liddy 1 Kluang 2 mojigangas 1 homínidas 3 Freundin 1 Melecitosa 1 halájica 1 feebre 1 Framini 1 Geschäfte 5 Lawrenceville 4192 palabra 17 Garrote 1 oitaios 194 nutrición 2 Götzis 1 Máirt 1 gisteren 3 Laugerie 3 lires 80 Marian 2 oligopéptido 2 Ludxero 9 Gaúcho 3 Nematophyta 132 Palabra 1 hissaricus 1 Isocrisidales 1 Gwyrion 14 gambito 1 McSpaden 1 FEDME 3 Pirrol 3 longifolium 68 perpendicularmente 1 Iikubo 1 glanduliger 1 Gofa 1 Lillu 3 hidrátase 75 hidráulicos 1 Orracas 1 ngadha 2 Hirane 9 Nemertea 2 Norðragøta 6 Lobelia 1 Frommia 6 Nurnberg 1 fenilcromán 25 Har 1 parkelj 8 KRAS 157 Mota 4 Konik 488 muíño 1 Glucan 1 Madrid e 817 Militar 1 Oreonana 1 Idiia 6 Pietilä 3 fortalecía 2 Lazlo 5 pedicación 1 mapping 4 Ferlo 1 Phillisps 27 hidroxenosomas 1 oreodoxa 2 impactará 14 Parisienne 25 heterótrofas 1 Oglani 4 inspeccionan 4 fordismo 1 FFI 1 FLIPPER 2 Gelinas 2 Flabellifera 1 NRYLTRRRRIELAHSL 1 Paulita 1 fitoplacto 3 navia 1 Micunco 12 Kashihara 250 Piero 1 Müritz 1 insurrecionalismo 2 Orefice 1 inmiscúese 2 Pipistrello 1 Iognáid 1 Frögren 3 fisetéridos 2 Mitsvá 4 mainas 1 Kauhanen 4 Mithlond 9 Gotia 1 Gürcistan 1 Mukou 2 neurocán 2 Pêcheur 2 MediaGroup 3 gastaba 3 klagt 1 Likowski 2 Ouamri 1 mmute 4 Guasa 1 Kuusysy 1 Melchiore 1 fracs 1 Olimpeion 1 Feologild 1 mus 544 pistas 6 oraciones 1 Kesselchen 4 gnosis 1 Jumbasu 219 Nacionais 1 Garbin 9 Labradas 1 Munquidh 9 lupulina 1 pecific 3 Idéal 11 Pitons 91 neutralizar 1 furadada 59 irónico 1 Ouvolk 1 Granés 1 Hexástilos 2 Jaffé 1 Gilsbakki 2 NDN 1 moedlingensis 2 Nucleotide 1 pectortais 3 Hoffmans 1 montalegre 68 Firmicutes 14 LSU 1 hirsutipetiolatum 1 Moid 1 inaugugral 1 Frontline 2 homotípicas 1 membranáceas 1 leucocianidina 4 Joachimsthal 2 Iosef 1 peel 3 Ottla 1 Iatroxénica 1 Molletes 18 Kubuntu 1 Fíxonos 1 Percursos 1 Keatons 1 Medelín 1 hydrolysed 1 Lahola 3 fuggi 41 Fotografías 1 Fornais 1 Hersika 1 fósfato 8 Inagi 1 Hestrie 1 fortificándose 1 Natuurkundige 1 metilheptano 13 meteorología 1 Gyllenhal 1 Jennner 1 Gelade 1 Plädoyer 1 Mountolive 8 Fredi 1 Kristinestad 1 PALMER 4 Lepidopleurus 2 invasionistas 1 paralizarían 1 henso 2 lastimoso 1 harían 3 nomarca 4 Geerzense 8 Hamelín 6 Ingersoll 1 orfanelli 14 Hebreos 2 hetera 5 Moir 1 Netah 1 Ítróttarfelag 1 Inayupan 2 guita 1 Lomustine 3 Levrero 5 patirrubio 2 Iriston 1 Kikime 3 Pedagogo 1 Pfandzelt 1 imaginaria 7 Nalda 50 isabelino 1 Fizzarum 5 glomeruloesclerose 26 Kultur 1 Hirari 1 Neuroethology 1 Jukain 1 Filmacións 2 Imans 1 Güler 1 Obina 1 ocasiónw 2 Nganati 7 Karbo 1 imperatorum 1 Hialocristalinas 2 impacte 26 Lynne 5 gotículas 1 Kellnermesser 1 patóxénicos 5 MSNBC 3 fiat 1 pavita 17 multilateral 1 Klasvkív 1 ostrostrelec 31 Mangouras 2 MAOIs 61 Obre 1 Papilomavirus 1 NUP 1 Ostarbeiterin 2 odi 1 monociliadas 1 FAMILY 2 Mumeazalea 9 MANZANARES 1 Kwartet 1 harmalina 1 növ 3 gastrocnemio 4 NaBr 1 Investigations 1 haplodiplontes 1 Freal 3 Inochi 6 Monteil 3 movimentadas 5 Phlebotominae 1 luteiventris 2 Granofilosea 10 Paciente 1 Neoprote 40 oxídase 1 Nduudu 1 Franqus 3 JW 6 Pfaffenhofen 1 Macarèls 2 Nostalgias 1 Miyan 25 marcapasos 2 hipertextuales 3 Oxenberg 30 infiltrarse 1 Gusmaro 1 Periñón 3 Pekenikes 9 Octans 44 Locais 2 Matria 4 Kabirov 1 Felmín 2 perdoadas 2 Ozaze 121 pilotar 2 Gerações 3 Petzold 1 Juanmartí 4 Lamberton 1 Fuchai 1 guatapiques 2 Kleisto 1 Ôbo 15 Mungo 5 Kidnapped 97 fluorescentes 1 gruppa 3 Gregoir 1 Miñota 49 irregularmente 1 Iruroin 2 orotstsana 1 gardamarina 1 Flanquéana 1 multiplicariámolos 1 Menelgavor 39 Islandés 3 hidroxenadas 3 joia 1 martinezii 3 Klassen 1 minussensis 1 klassischen 2 paralelepípeda 4 MON‡ 1 halan 1 mellando 6 mangekyou 12 herdarse 1 linebacker 5 pasadores 6 Panarea 2 loefgrenii 2 Ilhan 1 Knowlson 1 forónido 1 Hodur 4 NAV 1 Kusenet 1 hromy 1 Morgat 1 FinnComm 2 Nayar 16 pelexaron 3 Montemolín 31 Monod 1 Goniomonas 6 intercambiabilidade 1 liyou 1 Klintberg 2 kalt 86 Fundador 1 Inchbonny 2 Kopple 1 Kópavogskaupstaður 1 Jatsuku 7 hámsteres 1 Gainetik 1 Gotten 1 Fidac 6 Górnik 15 Nauvoo 1 mainteam 17 Navarrería 2 Grigorevich 3 mixínidos 82 frontais 26 Keating 1 Intestinos 1 Farcasa 3 peliño 2 Panthaki 7 Leggett 3 Kaper 1 monosialo 28 Heristal 5 Kebariense 1 Nakaiama 1 Lotiga 1 Pablovsk 59 Libra 1 Heffner 1 Frasure 2 ? 1 filmándoos 3 Gorosito 28 mercantilista 1 Impermeables 1 Gihanga 7 invéntase 1 Frankiaceae 2 mildios 37 Peru 1 jueus 1 Miresii 1 Personalities 1 phonogram 1 Hepevirus 25 Nidwalden 1 Momificación 7 Jadwiga 5 Goldmill 1 Hvide 1 forzáballes 1 Ongole 1 mandamás 21 nacimiento 2 Fringillinae 2 mareada 8 Namu 3 Narvaja 2 Painzela 203 glaciar 1 habrotrichum 2 Fancisca 2 Meriones 1 Paranáguazu 3 filiwn 25 Pares 1 Iotichthys 1 Maryred 1 Gelat 1 paleoespiñotalámico 11 mm² 1 padawans 1 Modificata 1 Mahomed 6 Laffitte 23 placentaria 1 metropolítica 1 indetrerminadao 11 fanática 3 Garrone 1 oblanceolados 1 Masuka 2 lumbosacro 1 Hematomas 1 Mailplane 1 illustratives 2 Kalmia 19 nictitante 1 fiei 473 graxas 20 Golitzen 1 MBK 7 Löve 1 pisciña 1 Matematica 1 Js 1 Graiño 6 Gouin 1 Liberilibri 1 Linpack 1 Hyldemoer 1 manchándose 1 Hektors 1 Montemitro 1 Methanolobus 14 Ouselle 1 Lekarka 4 Penetra 18 fotoquímica 1 Heteriarca 1 manufactúra 1 Patumbuma 3 MSE 2 Pitard 1 Fuladi 2 Pests 1 Harpies 3 ineptos 1 Istrán 1 PAIR 1 Mäenpää 1 Motorizada 2 Labwor 2 Paleozooloxía 1 Llena 1 ippada 1 Palastwirtschaft 1 melodiosos 1 Mafélé 6 Lesión 2 noroesta 1 Mitoxantrone 28 Grêmio 12 macht 29 mazo 1 nomalmente 1 Laschitza 1 Hooptie 2 Medon 2 Hortícolas 1 Finotto 6 Ignorancia 20 grey 2 frutificante 2 mesl 2 Laphroaig 1 gratuitos 2 melicitosa 3 groc 1 Grapewin 1 Idibouo 30 moradas 4 Hsp 1 Lombaert 1 natelion 1 Kommentare 4 Farragut 1 Lakalaka 1 jourensis 3 Lingunde 9 Gandy 1 onha 1 Galentine 1 mythologicae 1 Jafry 3 Morr 3 Nomeáronse 1 oytonome 1 IAX 1 Manuwa 3 intraducibles 1 Kaietanovych 5 Plátanos 1 internalice 1 Hontenisse 35 Nurse 1 Mèxico 2 Hofbräu 1 Moonchild 1 Ostulata 1 mellizo 1 Koukaki 1 kernewek 36 Lansing 69 Flaherty 10 Helheim 1 Namarroi 2 legeremancia 3 Matema 1 Larrimbe 10 Ideia 5 Interpretar 23 Horizontes 4 Palk 2 microorganisos 1 intempèrie 1 LOGAN 17 hexano 1 limousina 1 Peutherer 1 Mannaz 6 Pitts 1 obedentes 1 pertentente 10 Gotta 1 Peperrace 6 Massenheim 1 orina 1 Kenaitze 1 Foners 1 japonesque 3 Genéticos 1 LEland 2 MERCOSUR 1 ke 11 irado 1 forastera 1 Motivacións 1 Hornsrud 1 IndyGo 1 Katabi 1 Necromance 3 fructose 1 maltrataron 1 impuxéron 3 Japurá 12 incrementen 6 Pantorba 1 likedes 1 Hywell 6 gammon 4 Montmany 2 Goshiki 1 Neovulgata 1 Merite 16 Feiraco 183 fuxiron 124 fue 1 ?aggi 1 intramontanas 1 Hisho 9 íd 1 Orletti 1 Pintinidoira 1 fichandoo 2 Millsboro 21 Ligeti 1 hidrófobicas 1 Marova 4 manejo 9 Montán 1 Hersonisi 8 KHA 2 oitas 3 Pantelimon 35 Jussieu 7 grunniens 3 Kleinasiatische 6 Kyo 1 Nutricola 2 Feathered 1 mi? 1 metafenómeno 1 kuath 2 Inlichtingen 12 Pensou 1 intimidando 1 Marienberg 6 insertados 1 ncomo 9 Orthoptera 11 Lárice 1 Nioronioro 1 Muleby 2 liscou 1 looping 1 motocros 1 fundojutsu 1 glis 1 localizadaa 1 Kyuukon 4 gliconeoxénica 1 jessamine 3 ITP 643 gaña 11 Lahorra 2 Kyudan 14 Forschung 1 maracuxás 4 mythos 135 Palabras 1 Gingham 1 HCS 1 Idunna 1 homologando 1 Mykland 1 Jolteon 45 inaccesible 1 Nachtlied 1 heptahélice 1 kedah 79 megalíticos 111 Gayoso 1 microquímicos 1 ovibovinos 1 Koutsomytis 2 Madelyn 1 Gnathotriche 7 laxitude 19 Peaxe 1 Neimus 69 Kan 4 frequencia 1 Negar 13 lnot 1 Krukov 2 indietrónica 129 franciscanos 57 Palier 1 pacaraná 1 gewaltsamen 1 gelaa 1 Heckmann 1 Nicandreae 2 giardini 1 Instruíuselle 10 Lázara 7 Jalo 1 Lyssaviruses 89 Mk 3 Horie 7 Hamann 4 incontrolábeis 1 mineralóxicos 87 Gauguin 2 Farthest 2 grelado 1 Pericay 4 modèle 1 perdéronas 1 hrp 1 Lár 1 HONOUR 1 naturorum 2 Offizin 5 Hasler 1 otórgase 3 PaK 1 ocasiónns 1 mwin 1 letho 1 Javadoc 112 ola 1 ignicapilla 2 MASINT 1 intertribal 2 lascio 1 Hlusk 3 Øye 5 Peterhans 3 herbaceum 111 nitrito 1 hidrofobicas 1 itsenäistyminen 2 francófila 5 MXGP 1 panoramic 2 manexaría 1 Magnetosoma 2 Lenovo 2 Fuentelisendo 6 perdoaron 32 inténtase 7 memo 1 Paesaggio 2 McEvoy 2 Igra 1 laosianofalante 2 Merelo 1 Hymmenexilde 1 Megingjörð 1 Hazak 2 Mansores 5 Frewer 2 Kuzey 32 Norodom 1 Heteronevron 8 incompletamente 1 Moogwai 1 macrotis 4 Plautio 1 plaxiador 1 Gromland 1 intérpete 1 Maddisson 6 Ilija 1 glue 1 Kalahandi 1 Morocho 1 Gordiidae 4 Opal 3 organizaríase 1 Majani 1 mecanica 1 Kandrian 1 informetría 8 perforante 4 membras 11 Oui 1 Maithree 4 Inconnu 1 Horodyshche 1 Harreguy 3 Labastide 1 Khemissi 1 Hemooxixenasa 1 Îmi 176 Gañaron 1 obxectaban 1 ICIRA 2 Hewanorra 2 Lagardelle 2 organografía 1 MeAhorei 28 Hélder 1 Macello 3 incertidumes 1 hEireann 4 Nouioui 1 Lokis 1 isoheptano 1 Kalautz 1 Ginnie 10 irei 1 Jejuniis 13 Hyperoodon 2 Meteoritos 1 Ollino 1 Iyadi 3 Faraudo 2 Hironori 1 Glabros 2 impídeselle 1 FLW 1 memil 7 malja 1 Huseynovich 22 pallida 3 Hugs 1 Magulis 1 NewJack 15 hipoxeos 4 Mone 2 Oiso 1 Gjenerali 1 Mweru 14 mórula 1 hidroxy 4 fenoximetilpenicilina 9 papelería 1 pacificala 4 filicem 5 Francotiradores 2 Hachem 1 ofrecerlla 1 Fóxese 1 ferroencima 3 Graphite 2 Horchata 6 Pinténs 2 Lóbez 1 Organisms 111 Piper 2 oxixenando 1 moviliza 2 Landor 1 Garrigo 1 Ourmiavirus 1 Phalium 1 Favanella 1 Kenttäposti 1 Homilias 1 Masaku 32 inspirador 3 Phytelephas 1 medakas 1 Iluocoetes 1 FPCA 80 opoñerse 1 Hengst 1 humedecendo 3 Jouve 1 Monivea 15 ineludible 7 Noriano 1 Karkaar 694 persoais 3 hazara 1 megam 1 imbrius 1 Meggle 1 Gruitrode 2 glicosilceramida 1 PANNU 5 Godefroy 5 Irwell 9 Mallord 3 Lefébure 1 Froílaz 41 niso 2 Middelhaufe 1 montréalistes 1 Maxestuosa 1 naconalistas 1 Matsuzaqui 24 Jornadas 27 imprecisa 1 Lickey 12 necesitase 14 Jacek 1 Hazikarón 2 ortoclasa 2 Iblomorpha 2 Koximizu 3 forneceuse 2 ferruxinoso 1 Pantheia 1 fotsifotsy 1 igillum 1 piyin 1 Møgunger 2 olgensis 1 implementacion 2 Hypocistis 1 oroxaní 10 neomudéxar 6 Perier 1 Makizono 1 Kilmeen 3 Grobbelaar 1 pardex 2 onac 1 isomerías 250 paradas 1 Museopo 6 Marios 1 kópeka 11 fraccional 91 Gandia 1 lynn 1 grecomacedonios 107 licenciada 1 Geervliet 146 Kanagawa 1 Mondeval 32 Hedreira 5 Khair 1 miccionado 1 Patrás 1 Ndéné 2 Milhariças 13 FETE 2 Perún 1 Myrobroma 3 Otherwise 1 pereiriños 2 Lánidos 1 gillettianum 2 Guimerán 1 Normenausschuss 4 merecese 7 infectante 1 mantóns 1 hueco 4 nextFib 2 idahoensis 1 MCDONALD 37 gárdase 1 Lafutidina 1 grippe 2 Huejotzingo 1 Omosomopsis 1 Inuinnaqtun 1 Ooizumi 3 multiprotocolo 1 Gemain 1 mírao 3 Philarmonia 1 Komnenodukai 33 leguminosa 1 omvej 1 hermandina 4 Obscure 13 Foradada 1 Oldar 1 MVDS 3 formarnos 11 pertencia 1 macroconflito 2 Himuilis 2 Olszówka 1 Horsfall 137 Independientes 7 Neverwinter 4 leitaruga 4 heptosas 1 peniscas 1 Peñalsordo 2 Liffré 4 instructivas 7 mentireiros 1 Leafeon 1 ngabehi 4 gaan 17 ovoalbumina 1 Kriegserinnerungen 2 Kobold 1 gelertii 1 physikalische 287 permitiulle 27 Personal 1 krylovii 4 oidores 1 montuosum 38 penacho 1 longeracemosum 1 incontinentes 2 operalos 5 limbatus 94 gobernación 1 hadast 4 ostralegus 23 pesas 1 higroscopicidade 1 metalocénicos 1 Librivox 2 foristas 1 midt 50 Oryza 1 influíronse 2 pateiros 3 Macharaviaya 1 Pàrtaidh 2 Ikawa 19 Izaskun 1 oyameis 17 fasciculata 15 Gimnástico 4 malvive 1 LLLT 7 luego 3 ODH 23 mutuos 2 Paddenburg 2 Frauenburg 1 narnagoons 16 Misticetos 1 mantenibles 1 Pershyi 1 pinatense 1 Perigonio 1 macroparasitos 1 Großklaus 1 improvisadoras 1 miristoílo 2 Hilberg 4 fraguouse 1 megalita 1 Mozahem 1 libádion 1 lustralis 1 goryachka 1 Ogbomoso 2 flanc 1 Hipomanía 3 fondal 13 ioniza 1 personnelle 3 Hethel 1 ichthýs 1 Pitirim 2 malaui 1 innegabelmente 3 Miribel 1 Irure 2 Ouvimos 1 Itsadarra 57 fritido 15 Jamaal 2 FBordóns 1 lungi 5 Khmeres 1 OpenCore 1 glicosiltransferasas 1 millii 6 Gräser 2 jacobitus 1 Mercadier 35 naturae 1 Kouassia 1 Fibis 1 Peuceti 56 Holguín 1 Fyrgan 7 Oakville 2 MOG 1 Placospongia 1 Habayit 2 petrografía 7 Moialde 5 Fonticula 1 Morlani 1 filtrabilidade 2 Kickham 1 Miðflokkurin 55 Nicanor 1 hirtulus 2 Petrislav 1 inicirá 1 nGaillimh 2 Fulaga 1 Guanosine 19 metabolizada 1 Levadas 2 Omaheke 12 Gérson 4 Ginter 1 Inivitado 1 marshal 1 galactosilcerebrósidos 12 hospedou 13 Feá 2 nevan 1 Noratlántica 1 óg 19 ordenadamente 1 Jedruszuk 5 inmunoxénicas 1 Hibsicus 3 Maturino 1 Feixoos 1 formaticu 22 Gamble 2 orxinario 1 Huchet 4 Grammer 1 madhurés 2 MÚNIC 1 Makugire 5 LXXXII 13 garitas 1 nacionalizaban 1 plasticismo 1 Monteveloso 1 Mutagen 2 Olpe 74 interferencias 1 Fightback 13 palatalizada 1 fitotopográfico 5 Humatin 3 nitroxeno 40 Libredón 62 merlo 2 habilis† 1 Forjar 1 justiza 4 Parisátide 1 Michelino 4 fira 24 indeterminación 3 Macek 1 natione 1 Ludeze 1 Flajani 11 MacConkey 1 Maciulis 2 Lacaze 6 gabado 5 Ishimura 1 Panceltismo 1 peuls 2 Khadixah 1 Mateut 22 Official 2 marelada 2 Medgidia 1 Krach 1 Haganesvík 1 limosum 3 oliña 1 Ornago 2 imítanse 1 phrater 1 fenestratum 1 Pavloskii 7 perdoe 12 orfeón 25 plantadas 1 furcatum 1 Jeian 1 infórmanlle 1 listeriorse 1 fraseolóxicas 1 Luzac 1 Luopu 1 ntyke? 10 Pasillas 1 Mithyma 8 khi 20 Kouvola 2 Foxpro 1 ierde 44 hiragana 19 Molledo 1 Naraxa 6 Pavillóns 1 Kodomotachi 1 Hortzak 1 intermovementos 2 gelignita 360 latitude 2 Kafe 5 Pelegrina 419 Páxina 1 Griffths 5 moai 64 Filmes 6 gallado 3 Manilva 1 persecucióna 2 Kirolak 1 Gañidoiras 337 incorpora 1 Lathesis 1 Hematopoiesis 1 ghanianas 1 Lindleya 3 painel 1 Penins 1 micrométrico 1 meldonnar 4 MUPEGA 1 impuntual 2 Hákonarson 4 Faute 1 Flashy 2 Gaínas 2 Frameán 1 Herdan 4 maxillaris 1 metatarsalia 6 Frjentsjer 1 Farddoniaeth 2 Marrane 5 padroeiros 1 hanleyi 1 isarelíes 1 Menudencias 1 metltioadenosina 153 mitolóxico 3 Iberismo 1 Ladegast 85 perpetuo 2 Jakarnir 1 Hispidi 13 Intrepid 2 Metástases 1 fornecíanlle 3 Matiners 1 överst 1 madeira— 1 Julias 87 Galadriel 43 Hohenstaufen 1 OLIVEROS 1 heracleifolia 1 farcinogenes 2 Pegariña 4 negándolle 1 melismaticamente 1 Oxyphora 1 griegaLiga 1 Incorporaban 5 marz 4 lasagna 1 investigativa 1 Isofotón 1 Naunnt 3 Nolletia 1 Patucannay 1 flame 2 Kasparian 1 lesleigado 1 microvesicular 1 ghad 145 Nara 1 Fengtai 1 kastanjerna 64 Foille 3 Junimea 1 Pilu 1 Hayala 2 kalderash 1 fomivirsen 1 ongr 1 Homeric 2 panarabista 1 LMLV 1 fricación 1 identità 14 neuroglobina 1 frinxilifos 1 hipotensivas 16 obrigara 1 heliadae 1 pisoteara 1 incommodassem 22 Monteux 1 Jeretin 2 monumentalmente 1 Kaxighara 1 krepšinio 1 Mitchener 78 Nakhon 1 ivernación 4 Girsu 1 interpretata 1 Leptospirose 1 mesotróficas 2 hilal 3 historicos 51 Margot 1 Obara 1 Menodoro 1 IJburg 35 Instancia 1 ItalyEmilia 1 gymnosphaericum 1 oinocoe 4 Hagman 1 iluminaría 1 inflouse 1 javanensis 34 ocasionan 1 fiere 1 Hornyak 7 permitíanlle 1 forzándose 4 Leandre 1 Grieta 6 Françaises 1 perfieren 1 heimerlii 13 philippensis 2676 idea 2 Moiá 1 jonquils 2 KZN 1 Ovoj 1 meténdoas 1 Pirogov 10 Frederiksborg 8 hídricas 1 OBSCN 66 feitura 1 Impromptus 1 khorasanicus 1 masqué 2 helecho 2 Neumayr 51 haitiano 1 Leptospirrillum 1 herdouna 1 gabeadoras 1 fecundación— 1 llucha 1 Leeanna 2 Holothuria 1 hawaiiano 1 IPOD 6 identificábanse 1 medianeiro 1 Giennenses 1 pervirtieron 6 muntanya 1 mochain 1 indecorum 23 Pastores 1 Oertzen 1 ornmanetal 2 Kajsa 1 Pixelmap 40 Leioa 1 Fredette 15 Halys 2 Foxfire 1 piara 6 OBS 1 menciónaas 12 Incorpora 1 gastouse 1 Lenoff 11 pás 1 Giribaile 1 Metaserver 3 Guadamuz 1 Narcosis 1 Ignorance 1 Liis 1 macehualtin 7242 igrexa 6 nigori 1 pecháronlles 1 Lagüelas 1 Papaxoubas 3 farsantes 1 Intencionalidade 1 matemáticana 1 jetAudio 3 Gallarate 46 Goulart 29 kurdo 3 Percoideos 1 Naxarense 7 locas 1 Orlanda 1 Greffier 1 Osteochilus 71 FO 1 Hamshaw 1 Izumozaqui 1 Heve 1 naturalizárono 10 Masami 2 Friðþjófs 2 Persuadido 11 Folding 6 fred 14 fluoroquinolonas 2 Larbaâ 3 obxecta 4 Peile 2 Lí 1 orneen 2 Inxectando 1 gneiss 9 multidimensional 1 Linebaker 2 kickwriting 2 Khamil 1 overskrift 1 Nagamine 1 kyoteki 2 oroxénico 97 Morus 4 Guildenstern 1 jânnmes 1 Ilisso 1 Honnef 10 mazurcas 2 Josepa 1 Hoei 1 farang 1 Peaty 1 Fárbauti 1 KcsA 2 perrebos 2 Ixchil 1 Kolax 38 IAAF 20 milésimas 1 Kaser 1 Geirr 3 Fraker 1 Oceanorgr 1 japonaiserie 2 pebi 1 Graysoni 1 merdeira 11 limosus 1 gweddw 64 Georgetown 1 Notitiae 1 minalo 1 Kävlinge 23 Iserlohn 11 Hauru 1 madereinsis 3 kure 1 fugadas 4 Noviercas 91 parágrafo 2 Overzuid 181 peóns 1 Plagiopatagio 1 Hachfeld 1 M??a???a 1 Hegura 1 Papiroloxía 2 Pegasín 2 Haloarchaeobius 1 Mamy 17 Nomedio 4 padecidas 1 Izpania 1 Kachusha 13 planeouse 1 öffentlichkeit 1 Loinné 31 Gáldar 1 Flagship 586 novelista 4 Gotama 3 Longhorns 3 PdV 2 Michalowo 1 Glandomirum 3 Nolfo 7 ficoeritrinas 7 Glicóxeno 1 morunos 3 metionil 1 hautuva 10 Negai 11 Klausewitz 4 Gaozu 1 Makiokose 4 Julita 2 heces 2 phar 1 Nanimona 3 Perdería 1 Piknik 1 paquistanesa 1 Intercomarcals 67 Musik 2 Huddinge 2 lámparo 4 perimétrica 1 Lavery 1 froitificar 4 frite 5 guardés 74 Nuova 3 Gemmabella 1 Perpetuación 1 Laturake 3 microautofaxia 1 gazatís 1 falsar 1 Karakórum 2 Galizur 3 Gervaise 13 Lawford 5 Lebaniega 7 KBOs 1 oocitoxénese 1 pawn 5 Jankomir 1 lindiña 1 ioh 1 Hichcock 3 Gokakyo 8 levita 38 fotobiografía 1 lunaria 1 Kulda 1 icarianas 3 LaFleur 1 Mörbylånga 1 Jenle 5 IMR 1 imene 2 irroratus 4 McClanahan 5 Lemina 1 Kurda 1 mitriforme 1 Frotando 26 Gadiformes 1 hídrops 1 improvisouse 1 lagging 1 Jacelyn 1 frustados 1 Loxoscaphe 1 Fortificados 41 Meteor 1 pedoxenéticas 1 Gedit 1 phosphamidon 1 Microcorys 1 joanik 1 Girau 1 HIFRENSA 1 Neocupressus 3 Montmorillon 1 Pinoccio 2 Ixtlán 3 ONS 1 Granili 18 Lubac 2 Fotón 2 moricina 121 hispanos 1 Ilerxetes 2 Linarion 2 Intenacional 2 Holycross 1 instanciando 4 Jarmila 1 Numéa 1 Goldbart 4 Faltaba 1 inequivalente 1 Patiya 1 Firstenberg 1 origins 2 infants 1 Furret 1 maestrazgos 1 levaetrae 1 Manildo 4 limitarían 1 Guibord 1 ludzu 4 Froiteiras 23 nécora 1 Palaíta 1 pescatoria 1 Kosolapov 6 Foxy 1 MDCCCXXXIII 1 Isana 1 MRAM 1 Gallipolis 1 nevoados 1 pinteño 1 Kanara 1 Fútebol 2 hilar 23 perturbar 2 neglixentemente 1 mexicá 1 Kirovske 2 humedécense 1 Guptswar 1 Jozé 2 MiTV 196 fendas 1 Nippotaeniidea 1 Pikes 3 Moljevic 3 Gozzano 1 Frunzenski 8 molestadas 1 nuber 1 morbilidad 1 marxinalizar 1 Kusari 461 filas 2 indagadora 1 Hedvika 1 pirenzepina 1 joruri 4 graduáronse 9 Pietrangeli 1 LocationFrenchGuiana 1 Nubians 1 impresiónao 1 Fibrosa 3 Petouto 9 Kalergi 1 Herweh 1 †Loxodonta 2 Nocardiáceas 1 neurocomportamental 3 mojama 2 impoñíbeis 25 granulomatosa 7 glicídica 2 observaranse 1 helpos 1 Liitto 51 ORF 1 ku?i 1 Fluggerbutter 1 inversions 1 Maij 5 plasmalema 1 macelum 3 Halorubellus 1 Haniuru 3 hidroxipregnenolona 1 Manithan 1 Jugendsil 1 gaggnist 295 Lanzarote 1 Pereshéyek 10 Gubernia 4 Operação 7 Insectívoros 1 océans 1 pilsner 2 McQuaid 1 Marmstorf 40 LIS 3 Giedeon 7 Jaz 7 Krystyna 1421 idioma 32 pasounos 1 habichuelillas 1 Heckendorn 11 Huds 4 Pangua 15 glockenspiel 1 pipanoita 1 Pišték 1 indultaría 4 iñorados 1 fiazón 26 limitábase 1 Meit 1 Genola 1 formidat 1 Jukyu 1 hiperbóreas 1 Muljoto 55 mineraloxía 4 kbar 1 LHN 1 fiévre 12 kaki 3 herdábel 77 Laranxa 1 Notx 1 Jaclyn 4 Kroeber 4 Lioba 1 Hemiacetais 2 Motilidade 1 ljube 1 Kened 1 Occitáns 1 Heuff 1 Marmottes 3 marchitas 1 mazanciña 1 Monizia 1 Grajetzky 3 Gneisenau 1 Jeilan 1 interválicamente 1 murmes 1 orótico 1 Palamedes† 3 Harlock 15 paratiroideas 1 Hartknoch 1 Niculesti 1 Gameworks 1 heroniana 1 nebulas 1 normoerxia 2 Ollei 9 Higham 6 Incorporaba 1 Ishshahiqat 1 lisura 1 Pétau 1 peth 1 oxolan 1 Meech 1 INTEMAC 1 metáfitas 2 nubigenus 1 glicerogelatina 14 faragullas 1 Larets 2 Gravedade 1 Hrací 2 Heizei 1 Galbete 1 Federacija 3 ficticiamente 6 piccola 12 memorábel 217 ingrediente 1 guaridas 1 habere 92 interferir 1 Maritims 14 locusta 1 Fas 2 Meliante 3 Geórgios 1 farricoque 1 nictitans 87 pasteis 1 Kaliontzopoulou 1 Kozuchów 1 goelador 1 Pangaion 1 Flexíbeis 1 HazMat 60 imitan 1 Neurofilamentos 1 kamukus 1 longiglumis 1 Kipiren 2 Juul 1 oímolo 2 imatinib 1 Halversen 1 Moddy 1 pelaron 1 Infermon 13 Peroz 1 no Antigo 1 Mezio 1 khadag 1 multiplexar 170 orixínanse 2 Miljanic 25 Ibi 6 Inadaptats 1 Nordstjernan 1 Nucleus 3 hiperpotasemia 4 Frontes 2 Pirelo 3 Lamoni 1 PETRARCA 1 Mauruc 3 Panegyrici 1186 Ignacio 16 haréns 1 Löhneysen 1 Kauffer 1 minguasemos 1 Korokopla 1 Odalric 10 Konin 4 Hylas 2 Montlin 5 Hódmezovásárhely 1 inebrians 1 Occhini 1 Gherla 5 Katniss 1 iconicamente 2 jeong 15 Orkney 63 insolubles 2 Kupferberg 5 Monna 1 Intersocietaria 1 Metallum 3 Naturalización 1 LaChanze 3 Fortanete 6 Paull 1 Murras 1 Melguelh 4 Hideyuki 4 masturbarse 1 Navalfoz 2 Na? 1 Heylen 1 internnici 14 moneda 1 lagascanae 76 galas 1 Oppida 120 Faraón 2 peneana 10 fuxise 1 pastadeiros 1 galbada 2 Lesna 2 paise 5 FOREVER 16 Luganville 16 forn 2 Ovséyenko 1 odiosos 2 Masca 11 normale 1 medua 1 Latore 2 neuroquímicas 1 Ford—Prototipo 1 mánuður 21 peptidil 1 Kiongju 1 Narrazio 91 patronal 2 Koloratursopran 1 Gossoviet 2 Nailia 1 Gregoriaanse 1 patamakanthini 10 Jewison 1 Kulturfront 2 Hardee 6 Locle 10 Pelegrín 2 Pedistylis 5 mandschurica 1 mesurables 71 maleza 1 Líbido 1 Giornalaccio 1 Microfilo 1 historiasesp 8 Lufengpithecus 2 Pallister 1 finanziari 1 munozensis 3 Humidosas 2 Intocadas 23 hemidesmosomas 1 Lagni 1 fonsagradinos 1 Kubiac 1 Madagali 1 Nonualco 1 FII 1 Flionte 39 operística 2 Maceratese 1 mirrado 1 Mattithyahu 2 ostentábao 1 ofilsystems 3 Kjartan 1 gbu 1 Gmork 1 mönchischen 2 Hamabi 3 Fli 525 guía 10 fealdade 2 Gedeputeerde 1 meka 1 Forjadores 1 ibeis 2 Panafieu 3 inconsolable 1 piatra 17 folliculorum 6 forista 3 Mamea 1 monetal 3 Kauhajoen 1 möter 1 ói 2 Managers 1 Parathyroid 1 Mareš 2 Kozlowsk 2 Meghila 1 Hreidmar 11 Oxén 89 Heine 16 patoxénicas 1 japonense 3 ONA 1 ínstaselles 1 Mikolów 1 metalproteases 8 índicas 106 granxeiros 1 Ketrzynski 22 morbilidade 1 Guacimal 1 hnuo 1 Niederkassel 1 Lugs 48 felicidad 1 Kadovar 15 Mentes 5 pallón 1 oileáin 4 öga 6 nootkatensis 2 Kallas 1 nerviosamente 1 Macary 67 pagamentos 19 Mailer 2 Harmensz 1 obritario 8 MurNAc 1 McLoone 8 Haplorrhini 31 Mit 1 Garlanda 1 Kostrikin 1 Hidroeléctrico 1 pisoteaban 1 neurotecnoloxía 5 Nóz 1 Hafsidas 1 mÿndÿr 7 kanta 1 LSW 1 Pardners 1 malankar 1 IceDogs 1 Holzmaden 151 Oímbra 2 lendacari 1 Irumize 1 naxe 1 Luthierías 9 ourelas 1 Hollandsche 4 Movil 1 Lanzavecchia 2 Lefkosia 2 Imrich 7 kirsch 1 moslavacka 1 Imediatamente 2 Gerke 12 LJ 3 ganaron 2 Pilling 1 Oberwilen 1 pitará 2 Ortopnea 4 meraviglie 3 monooxixenases 1 obesomanus 4 ondeaba 1010 membranas 9 HRC 1 parfa 1 kakua 8 instrumentalista 1 Klumberg 9 nutricia 1 Guy de 2326 flores 1 Pailey 1 Haxhi 10 Lapesa 1 inquiró 3 fusionaren 1 McKeever 2 mellorador 2 Karroo 1 Kulturkreises 1 Kobain 6 nucleófila 1 Leou 1 Iarnród 1 fluorometilidino 3 Hnoss 1 perdoará 1 Gatehouse 1 introdúceno 13 Maginot 28 Papeete 1 Izhora 1 interfiera 2 Gharmachi 1 Hijuelas 3 Huntingdonshire 22 Nimri 1 Grandar 2 Gamlakarleby 3 Guiende 30 paratiroidea 1 farnesiltransferase 2 Litus 3 gaztetxe 1 hohe 2 Médicamente 1 petahercio 2 parisen 9 intestinas 267 Piemonte 2 Mool 1 Kocur 1 Gateñas 14 Gonzo 1 Kindia 11 Fennica 207 ocular 1 OCTAVIO 3 microfluídico 1 lolii 1 Juventut 9 GATA 1 Karer 3 inmolacións 2 internacioinal 8 Gazimestan 1 Minpins 1 Morrín 4 Hanspeter 193 Hesketh 2 mecanizarse 1 idrísí 1 picanse 25 Illustrated 1 hemofobia 1 IOK 1 gantañ 2 Kežmarok 1 florentino Antonio 1 impediríase 1 Laguneses 1 nätter 9 peraltadas 1 Hollick 1 pecã 1 Pilòt 1 komitè 1 Lódzkie 1 MÉDICOS 15 pavimentados 2 patinaba 184 plástica 2 Karpinski 1 Phytomonas 2 Iourou 44 Gretzky 1 Menamayor 2 inovacións 28 Farnsworth 1 Kutaway 42 Músicos 2 Jisaburo 1 Percomorphi 5 Lavand 1 Galrão 5 neoplasticismo 1 Pascuais 3 nôtre 3 interpuxeron 390 ficha 1 Mälk 1 patrañas 555 nervios 2 pakeha 1 librero 1 kullensis 1 LDHC 1 hanniana 1 Fundóuse 1 incactiva 2 Fonzaleche 5 meropenem 8 mec 2 magnetizada 1 Kashemira 5 interesáballe 3 Neuropsiquiatría 7 hipolítidos 1 minimonovolume 2 Odiana 1 Lenj 6 Fucked 2 Pentobarbital 2 Grattoir 19 Moonlight 13 ios 1 nabía 1 Otiophora 1 guadalupense 1 Obejmi 3 oitomiles 3 Hardmuth 1 Gendun 24 Máxica 2 Growlmon 1 Fallsburg 1 Oluche 4 Painstream 10 Malinche 1 Gaï 1 Lightwave 17 ikastolas 1 Muistoin 1 Makiyakinabe 1 Hrpelje 1 Hugador 1 Krascheninnikov 2 manger 1 mesoporo 1 Nauw 1 Leonura 3 Maltravieso 1 Lommel 1 MgATPase 1 Nerlerit 1 Gremlin 1 Ldo 3 Kamisunagawa 1 greater 1 Gramvoussa 3 GFA 1 lesser 11 lodoeiro 4 Komunikando 1 Instituições 1 Myo 1 Fluxorum 1 inagurada 1 LouisPasteurMonumentLille 1 koros 1 mesanxiocapilar 1 Kab 2 Ossau 2 Malenkie 1 Komulainen 25 permaneceran 1 gafado 2 paleaceum 2 Metel 163 modifica 1 Izarguien 1 mariñados 1 Kraainem 2 Mucientes 12 Febras 1 Kutchi 1 perséguenlle 53 microscópico 2 meridionalem 1 Maresma 1 oredeado 1 Helicòpter 25 Liquid 8 Leporis 1 Kanacos 1 Hemigalinae 1 LUPU 1 Jundiai 1 Panamanthus 1 hillstead 1 Libeaus 1 floristes 1 Migrateur 1 iuventus 2 Manifestando 12 hicieron 59 integraron 3 holten 1 Nótense 14 lactamasas 1 Incipiunt 60 Miguelanxo 1 gilvum 3 nembo 16 Panchen 1 operam 6 Obelleiro 45 Kellogg 599 LP 17 Nederland 2 Orizuru 1 lepocincloides 100 Loureda 1 Gehirnhälften 1 milgrá 3 letárxica 43 Kreis 2 Jainulabdeen 1 invocouno 1 Lapush 5 Marcano 2 Lebewesen 3 Herrian 1 Labranza 2 nemetati 2 Farka 1 laxinervis 2 Garcelle 1 Larues 2 Klina 6 Galatia 10 Paralictíidos 1 merkið 1 Intercourse 3 Máxina 1 ordinibus 3 Itsuwari 3 navaja 7 MUUS 2 Lanquín 3 Ihren 1 Orskov 1 namerasad 1 Izagaondoa 10 Jubaea 1 Mantón 66 Forcadas 2 MOTI 1 Higasxi 5 Marés 22 Películas 1 Nemethy 2 faS 2 penaban 1 ODZ 1 farémoslles 10 Ledoira 33 Obispo 46 picantes 1 Konopiska 1 levitaba 1 odoriferae 9 Homaxe 1 Ozek 1 outers 1 Montesion 1 Komsilga 5 Gradaille 1 palillo 6 Herbella 1 nogo 5 Obokaman 37 Landeira 2 Killy 6 fauvista 1 nociocepción 9 óllase 1 impusado 1 leubh 2 Packaging 3 muón 13 Means 14 perfilado 1 McBurger 2 Hiptage 4 Harmónica 1 organotroficamente 1 Leucanthemella 1 Inquisició 1 patiños 1 nationum 19 Naveen 1 mal metabolismo da melanina 1 FidoNet 1 Hidroavión 3 Leucio 1 Karangaza 1 fatigado 1 Kontraobaveštajna 1 oerando 1 Kenning 1 Louguei 4 Lonchyna 852 mariño 5 fóiselle 4 ilocutiva 35 pendurado 1 pariades 9 Fifth 2 fosfomanoisomerase 1 Guregguru 1 lycia 1 oficializando 1 Pistoria 1 Neipeal 1 jaspre 2 klasse 1 mercadurías 2 Oeral 1 Pamodê 48 Parede 1 Limpabotas 3 Peoría 83 Mc 70 limitou 1 Houéyogbé 1 hipocolesterolémico 360 irregulares 1 Olarriaga 1 jugé 1 Lazrou 2 nostocarbolina 1 Kaideda 1 Isstiqlalina 1 INEE 4 Hemera 1 garciana 2 mofes 2 Oubangui 3 peladito 2 Karrek 58 Fedora 1 Mudiyanselage 13 opóndose 2 pencerdd 201 Giménez 6 Gádor 13 lahar 1 katapugaina 1 Kauru 6 Nishapur 1 Keboja 1 Galac 19 Islamic 1 PEMP 2 Natureduca 1 Glaciers 1 Hermaeum 30 Nexus 9 McGoldrick 1 Grangali 1 KGLA 1 marketing e 2 Peuerbach 2 perdoando 4 Mollie 1 national 1 iney 3 Grantchester 1 Nummis 1 guacayamas 1 Kreski 340 Nieto 1 lígao 1 Mahani 12 Kurokawa 14 marae 22 fibrilares 2 Mandia 1 Midon 287 Mongolia 6 gramaticalización 10 Naoto 1 Faultless 1 Pithécusses 1 gauma 1 Khuwayr 1 Outubre 105 Laíño 16 insípido 2 Parë 2 Lotka 2 Glatzer 1 Kondracke 2 Hadróns 2 mixtión 1 foramina 9 Kurylenko 1 FFEBCD 1 perfore 21 hidrodinámica 8 microevolución 36 Matthäus 1 Peia 1 Mewn 1 Pentrefelin 1 ferrunginosus 2 inquilina 1 malgumora 3 Lurtz 2 francophonie 1 habitanda 1 Gregoric 1 faxi 2 pechouno 1 píntao 1 Misquious 1 Herpetosiphon 1 fiolxenia 5 Moldovei 3 matritenses 6 Maritimes 2 Haridwâr 61 nominada 48 fu 1 neurocognitivas 1 Margués 1 Ilisesti 1 nimbú 1 Penarada 1 Iptar 1 ledas 1 Laeticia 1 Knidos 1 Marxinocephalia 1 Hieles 1 pinchárona 2 impair 1 Kwantum 9 macroeconómica 1 foliculoestreladas 3 pectínidos 2 Fourneau 1 IspH 6 Gaélicos 2 pérdea 1 mencionables 3 Goliardos 3 keus 6 Neoplasias 5 Jaiko 1 gemachten 2 Martinoli 1 Lavandería 1 Paisse 1 Godfrejow 1 MacMorrow 2 Kladanj 3 Niqqud 1 megaloblasto 1 Molochio 6 furiosas 1 nostrilos 1 Lexaurin 2 pelexaran 1 Femeninas 2 Orcasur 8 Gökhan 1 Gurèvitx 4 Matière 1 Partakka 1 Ogoué 1 foiba 1 Grimaldos 2 ioné 5 Hm 1 Mabona 1 fuastecas 11 fornada 5 Flama 1 mantivéronas 1 IPPC 1 Garmillas 1 nacemenento 2 Paléo 3 paroxetina 1 metricamente 1 Nerius 1 inmaterialismo 6 mine 1 Panamericanas 1 Flainn 1 Florenzano 1 Koprivna 6 HNMKY 3 Lisette 1 Fedtsch 2 Guienne 1 Kreuzers 1 Gnogboyo 1 lasiostylis 1 osificándose 1 Maistral 76 obsesión 1 imposibilitarían 1 infimae 4 hidrozoo 2 GENTILEZA 1 Nartación 18 master 2 Oncocalyx 1 Ignatii 20 indoiranias 1 MarsChryse 1 Luatschim 1 nääli 4 Numax 1 micronucleados 2 fonémicos 164 Fragas 1 husos 1 Ondinea 1 Kaukau 1 Kimmell 1 Kolejowa 2 Jijila 6 mae 3 Pandectae 1 manteñense 2 Osbornictis 8 parachí 1 metafonia 3 ondee 2 Leibeigenschaft 1 Kirimize 2 minarquista 1 Lehzë 7 Klöden 10 Kokubunji 1 HWR 1 Jisu 1 Fumariáceas 1 Pirazzini 15 LXIII 45 List 431 Nicolao 1 moc 1 hebillas 1 Halcion 1 Meeboldia 44 mydas 1 florfem 1 graxentos 1 Grenztruppen 10 fruticultura 4 jujutsu 1 Moorish 1 laadu 2 Majorata 2 Miskan 3 llenas 1 Odonec 9 Gylfi 4 petroso 1 paremias 2 Grimsley 49 Hermo 1 Margotia 1 Jamrock 1 Fornella 1 Nicananduta 2 independizaran 1 genistifolia 29 impropio 2 micromecánica 1 gemedor 34 litografía 1 monoembriónicas 14 feno 1 fotografalo 3 Ostani 4 planeación 3 Kalka 2 jams 5 glutenina 1 Muhtar 10 folgazáns 2 Paparara 291 Fomento 1 Lapporten 1 Ivancar 108 globalización 4 Mulier 1 máis— 2 Hanzsek 1 Pentecontecía 1 hiperosmótico 2 inteira 1 humanismos 1 Nauloque 4 mallorn 1 Insia 2 finished 1 illichiana 1 Jaltepec 1 Matsigenkas 1 levobupivacaína 2 Mamelodi 2 okinavana 30 fúnxicas 2 Gigawing 1 Guilliaume 25 place 1 oceanografiju 1 piege 1 fitoplásmicos 3 Glycyrrhiza 1 háls 80 metacarpiano 1 Kremers 8 Gomori 2 Nahe 1 ?Onn 1 ifb 2 Govi 5 Huntsman 1 loquor 1 monolamelar 1 haynei 1 Laplae 1 Pescheria 1 Giessendam 231 Maxisterio 5 majorana 1 Grigsby 1 Ovilo 1 Persiane 2 Ngaramasch 1 Jazkulieva 2 Nitrosococcus 14 Finlay 3 involucralo 9 Mombuey 1 MacNally 2 hebreu 8 LOVEppears 1 LINGUA 1 Gerhaert 18 michahellis 1 Nájina 1 Lappas 6 martiño 1 Guinéa 3 LibrariaMusica 1 Guilhaume 42 impopularidade 3 Moriiama 2 funcho 3 Fleuves 1 Pericol 5 Irredentismo 1 Oats 1 HESH 3 mortalladoras 89 NCG 1 Hlyfield 2 incardinado 5 Mátame 1 notturno 2 Klint 54 lirio 1 Favorecidas 2 Jastrebec 6 Paprika 1 norto 2 Gökyigit 1 Federativnaya 1 Mertensophryne 1 hypos 1 Oldierus 69 Mikan 1 Monic 2 files 1 Kameruka 1 mnit 2 Guarene 1 Joji 1 Pitidemo 4 Neige 2 Jakovlev 8 Moinesti 5 Mannesmann 1 kurukh 104 flotantes 1 incrementábeis 1 Jecná 1 Iness 1 Maganja 5 katea 1 nevocitos 1 Musculoso 2 Iñurreta 1 pateados 2 octaba 1 Mikšic 1 Mediesu 11 inadaptados 1 multiradiata 2 hetita 2 ovirraptorosaurios 1 Londress 2 Guttemberg 1 ojomíia 1 Friary 210 licor 1 Magischer 1 fríxios 1 Lestock 19 interxección 3 inconexa 5 Fesenko 2 halacsyi 2 melanotán 2 peccados 1 Malindang 1 Nokutasu 1 Fatix 2 Göncz 1 Padavona 8 I?Ba 1 krenuce 6 magnetosoma 1 mylo 1 Königsbergs 1 iniial 1 luteola 1 Fualefeke 2 Heifits 1 histiocítica 1 incentivalos 2 Lély 7 InnoDB 2 nthu 5 Fp 1 Frederikshald 1 Korissia 2 fruteiro 1 navigadores 2 Fgf 2 monopolizaron 7 gamla 10 Noland 1 ourol 1 marabillar 1 fomentarius 1 oju 1 maglemosiense 220 Mons 1 Meczenstwa 5 fauriei 1 Méditerranées 35 PFC 1 melodias 4 marranos 7 Letzigrund 2 higroscópicas 1 Judai 3 Musab 3 fortalte 1 Nadiusko 1 Loosduinen 1 Frez 1 gyndylan 3 filológico 1 Mwilsha 5 instrutora 4 morfológicas 1 Héra 6 Gassion 4 letteraria 1 moguereños 45 namorar 1 lincosamina 47 França 15 Hoop 1 levitasse 1 nomeprocede 2 penedía 1 lentisferas 1 follistatin 9 Lugonovo 1 homexanes 1 Khammar 1 Letinic 1 Louriceira 1 Organistrumpalaciogelmirez 1 Palawah 7 Goner 1 pedíao 3 Leulliot 2 hona 1 inagúrase 3 Pantaléon 1 perdoarlles 1 Llandrindod 1 heterodoxum 1 Museo Guggenheim de 1 Nezla 1 Platyonichus 1 instrumentada 1 Libraria 1 orontii 1 Makemakes 1 Kraaz 2 marbellí 1 Koenigsmark 1 Në 7 Oyón 26 genitalium 1 Glochidotheca 1 menosprecian 7 loiras 5 Laspuña 1 Iardano 1 mezzopiano 26 nefridios 1 Perovskia 3 lubrica 9 Meirchion 1100 Johann 1 flottante 1 Idiornithidae 1 Pappagallo 1 herd 1 Giuliomaria 10 moins 8 improdutivos 1 gueera 8 Lemass 1 Kaiteriteri 7 Furafollas 1 Mingan 1 Malthace 3 peritecios 1 jerárquica 1 noltei 2 Mézieres 1 ladin 2 Kansetsu 1 mioepitelias 1 Jaasund 12 manexaban 2 grafándose 2 inhibiría 6 Marraquex 1 follé 10 Glis 1 FreePascal 31 iPod 40 Kira 1 Grancher 1 hfaou 464 Herbert 34 inversores 1 Grumes 2 pape 1 magnoliopsida 1 Labazá 1 nikkoensis 259 obteñen 4 Gaboriaud 232 novena 1 gogor 2 HMSO 341 lombo 1 Muhammad 1 Muntañola 1 Olonkin 1 Migliorotti 1 Locksmith 2 Kango 2 gimnástica 47 Mihai 3 Mimic 1 maníferos 27 Monika 1 Grønmo 1 Jacalina 1 jangadas 2 Haf 3 Luan 1 paradosso 1 metadol 2 illata 1 Herdoíza 1 lerma 15 neorrománico 1 Pagadizabal 11 mapoula 1 macroganadería 1 Fiscás 6 Fitopatolóxica 1 Heimosodat 1 Mighels 1 Pecílidos 3 ortopédicas 1 každyjlanok 4 Honour 1 harmosta 294 peninsular 1 Haeuerarbeiten 10 GÁRFER 14 pelotóns 2 insaciablemente 2 Farois 2 microtubulos 1 plastiqueiros 2 fosforito 22 historicismo 1 interdixitan 76 moralidade 1 Luturios 1 Leiko 4 Guyett 30 irmandiñas 1 Kosovka 1 Macroglossini 10 inside 2 GOMBRICH 1 Ostojic 1 Lotsawa 1 Mamn 12 LTE 3 Intermediario 1 jhalmuri 1 megahercio 1 LegADue 1 felibristas 1 phosphate 1 ?on?e 2 Nivedita 64 Foise 1 Marcellano 11 galeguizado 5 mitannia 2 Jeito 1 Galerucinae 1 Guerrilha 5 Frisbee 2 Pincourt 3 fixérao 3 neandertaloide 3 picotas 1 irreductibles 30 nh 6 moravo 2 indixestións 8 involucración 1 metaliterarios 1 ondere 1 garantíaselles 1 Imaginova 1 oligodendracitos 1 momochi 2 Obearagón 1 lectuals 1 Hamdaoui 1 Innokenti 1 IMMEMORY 37 Nkrumah 8 Festivo 2 Miero 1 Okogie 8 perseverante 2 Gulda 6 Piro 2 Ludeña 86 mediterráneos 1 glicuronidadas 4 Ottomma 4 Limpieza 1 orgos 1 nanocircuitería 1 Múli 3 fuxidías 1 Lasiochlamys 1 Nú 55 pelexar 1 Inträdestal 5 Kronborg 1 Pedrote 1 Nangura 1 interpluviais 5 Nukulaelae 3 fulmine 4 Pallàs 16 Grèce 19 Marrero 14 Golfiños 3 incorpotracións 2 Pendelías 29 intensificación 2 Œx 5 Picapeixe 6 Gourma 5 pagi 9 Kelud 1 moellendorffii 1 Koneripaty 1 orzas 168 homónimos 1 Pañella 3 MÁSmovil 1 Folkworld 3 Monsterwork 4 nucleantes 3 gsi 17 Fridtjof 1 fuchsita 1 jaqueraidas 1 muscatensis 1 inceertidume 1 Öst 33 ocasionados 35 Marce 1 meesmo 1 Lubienia 3 lés 3 Irizar 3 Gamborena 1 kagami 1 INIEXPORT 1 Perrais 1 mórti 2 GUARINO 1 gatiperio 1 JAF 1 laurentino 3 hashi 11 inconformismo 1 gametóficos 1 Ostiamare 6 HbS 7 odiada 1 Gretch 1 Mbuye 7 italien 4 perdóalle 1 patican 1 kelantanese 5 instaron 3 Fuso 18 Loquillo 1 filoxenetica 4 Mücke 2622 mm 1 Francofolies 1 mostazafrancesa 23 Istanbul 7 Lemus 262 Jay 1 Hamrun 121 Makea 1 Platanichthys 2 fitorreguladores 1 Matapédia 1 frecuete 2 Koreyasu 2 Marylou 25 java 1 meianoite 1 Objectifs 23 Miniatura 10 Híbridos 1 Mozóndiga 407 Jochen 1 florentinische 119 increméntase 2 Hiagt 8 Imaxinemos 1 gedachte 1 Kekuanao?a 1 Leeeuwenhoek 9 Kálmán 2 ligninas 1 Fraoch 6 Nicha 1 gegründet 1 Infraroodspectrum 3 Monner 1 Navasse 1 Núncio 20 Hablando 12 Greenland 2 Naft 27 kick 6 Moía 1 Monographicae 3 Joffo 11 Illouse 2 parasimpaticolíticos 1 Jacinthe 1 Glaphurochiton 2 kumbai 1 Frumuseni 1 periostalxia 1 mulleruca 5 Ozzie 1 Krehl 1 Koszykarski 8 hum 2 Laraña 1 hungatei 2 Galotxeta 2 Paidea 1 Kalucinga 8 nikki 1 Nancye 1 fotometeoro 1 Gimble 1 Pescopagano 1 Fettercairn 1 Konandikro 2 mSelB 1 pedem 2 gustasen 9 Misawa 2 nucleou 6 Huemul 3 Firmamentum 6 Genkai 1 Gumpilil 1 lxde 1 Githead 80 Marrón 1 hidrobrómico 1 Perdicas 1 Marianian 1 Gidire 6 Gerðr 1 Krohg 1 pintasilgo 11 Heman 208 paro 10 NPR 1 Lisidamos 1 Jaldun 1 Jüvenjoe 5 orientables 1 Lagazzi 2 mujadda 1 frixol 1 persaturatus 5 Mobius 2 Pantelaria 1 Paterne 1 informalistas 1 Misquita 4 peiorativo 1 halt 2 famunas 3 hlavního 125 Nowitzki 1 Jitney 1 inspeccionara 32 meningitidis 8 Grampian 2 nucleotidos 2 mollaparvos 6 oitocentista 1 Maclura 109 interpretaba 1 glicoinositol 2 isem 5 mineraloide 8 oiseau 9 Gender 13 persistían 4 Hallam 4 Kolomna 1 ornitose 16 persiana 1 Laonnois 11 Farinha 1 Incisoscutum 7 Gabacha 5 globalizada 8 Mbah 1 Murtuza 1 Leiognathus 2 Fotopress 1 gosaltzen 1 mIgE 4 Peilz 4 Jaraguá 1 ídiche 7 Fert 1 ilóxica 1 Hunterdon 3 maquinar 1 fondosa 3 Lhamo 1 incendiaría 1 McCleery 1 Kurahashi 1 jingwei 1 farauti 1 mobilízanos 1 fosforolizados 1 ouvínte 2 Maids 1 Mittelhochdeutsch 24 obterá 22 inventando 1 Fynn 18 Mirandesa 1 hertzs 2 masaxeta 1 MpX 1 notícies 1 MAVS 1 KARE 1 omíadas 1 Greeks 1 Ogna 1 midä 1 Klæbu 3 oleosos 2 obsérvense 2 Peleiades 1 Peperrell 1 modélo 1 peridístico 1 infilled 1 Luling 12 limpadores 1 Iagini 37 lontra 2 Obwald 1 marmaros 1 GMs 1 mentuccia 6 planificando 1 Longobarda 5 lameiras 1 Melanise 1 hadza 3 Miserias 1 immoraux 13 Karmele 1 formamdo 2 Mayeusis 11 Lumeiras 4 Kirina 1 nyc 1 petismo 4 Leovigildo 1 HABEMUS 4 Itineraria 1 lolas 1 íssimo 1 monofloralidade 66 Orthez 3 palmeirense 1 Mattityahu 41 Om 1 Heptáporo 8 Goldar 1 Oscillochloris 2 gpn 2 phaeovibrioides 3 oscuridade 5 Legler 42 Lannister 1 Parrotiaceae 1 JumboGamemon 1 Firthunands 1 Mirafuentes 3 kypchak 1 Laveine 23 lapislázuli 2 Ožbolt 1 Neils 1 Njue 1 Monzaemon 2 lede 13 latrinas 1 hamelii 1 Hunzikeria 3 Koppernigk 1 ljóss 3 intimidante 1 Olladores 1 Pentagram 1 impoñades 1 Intrapenibética 128 lanzador 1 gatzatua 1 Hortorium 1 huguenots 1 Karahi 1 neser 3 frutti 1 lokóta 12 icónico 1 Lebb 1 Luzzana 1 Nurete 1 Glyoxysomes 51 lidos 27 mantívoo 1 imaginem 1 Khouny 1 nichela 1 incauta 5 geboren 1 Hirte 39 Florio 1 Gabou 17 Paleozoica 1 Internartional 1 metameriza 1 misturaría 12 Laboratories 79 ornamentos 1 Iparhoun 1 luan 12 Nuestras 1 frontismo 2 Pantagnoto 1 Miglius 1 Montrestuc 1 pedrolos 1 imnoposta 1 Kolokitha 1 Jodzhaiev 3 neuromielite 5 Hiba 1 Mesturanza 1 Landera 5 när 9 Lepidópteros 420 fosforilación 2 Machinedramon 1 pericámbium 4 Festivales 1 ipê 3 morava 45 lotaría 2 Fuentelapeña 1 Ovidrel 1 Piletas 1 Maráez 6 Fundaçom 1 mielinizadora 6 mauvais 1 Maevarangi 113 Gasteiz 3 Laives 6 paneslavistas 1 mortallar 1 Gerodan 2 LEPA 1 Olbena 2 Ikey 1 Llactapata 7 intercooler 1 micotoxicose 10 Mexican 36 gabia 1 kalamata 4 Oenach 1 nádegadás 77 pilotaba 1 impedidas 2 Kymijoki 1 leziria 1 pedres 3 Israelitas 1 Louvor 1 fusoxénicas 13 Ganesha 14 Pihhuniya 7 Lužica 1 Kyst 2 Fortschritt 1 ico 1 Meegosh 21 Lat 1 Nésos 2 Moustiques 1 odp 208 ideolóxica 3 Galorromania 4 Heta 12 Olivas 1 gücü 2 Gonnesa 3 IBRA 1 multipersoal 1 florino 1 Ibèriques 6 Pizzuto 1 Maçon 1 planorbis 1 mecanicidad 2 NOVALES 1 gorice 22 Gert 5 Petrolíferos 1 Kalas 1 Leibe 1 Mailau 5 impartiron 1 metilfurano 1 malandríns 1 hidroxipirrolidina 12 flamencos 1 Heléne 1 LOGACS 1 fritíndoas 6 ípsilon 7 Luhrmann 1 Karnkowski 1 Madarský 12 Kofun 8 filoloxia 1 Ibaram 1 Inmigracion 1 förlorade 1 Paradroid 1 Grütter 28 ONO 3 loom 3 Mogons 1 Glaucocystis 1 Maredine 1 Litoautótrofos 2 fertuna 1 Kveta 1 impedíanlle 1 Lagerführer 6 fincada 3 Maimonides 1 ItalyTrentino 1 Lockerman 23 gunwingguan 1 Gamonedo 1 ganita 3 Luud 1 oiru 7 namorándose 8 PAF 1 harting 4 Mealha 20 pantanosa 2 Furnarakis 24 Honecker 2 Mehran 1 Hutteno 1 Horcada 1 fondamentales 1 Pertorbacions 1 Hajmel 1 Molodi 1 Motorbass 2 Jonan 1 mamsam 1 Hvaler 1 Grifola 1 Montelius 8 patelo 3 lograren 2 Malacostráceos 1 iano 7 insatisfactorio 16 Ottone 6 Lyubov 1 Flugels 8 leucocitario 2 masto 2 heróico 1 Lews 1 Monterfil 1 figuiers 1 pdubois 1 leucoxylon 1 Pickover 1 Herreriaceae 11 oleifera 1 oxopropil 4 partitocracia 1 Piaseczny 1 Philarète 1 Namche 10 Indes 1 Paridas 136 Friúl 1 Kholmy 1 Fernardo 5 krátos 1 lonxitiude 33 Gamba 6 Ishi 1 Golfingiidae 1 óbex 7 Gránulos 5 Margate 4 Morés 3 focidios 1 Pettyville 2 oseznos 1 futbollistik 6 Isauro 2 Magere 1 Mezocsát 2 impregnándose 1 Moutter 4 Habibullah 1 Iboguhé 1 ILWIS 1 Jungtier 1 indiferenzas 2 Kaminska 33 musas 1 NAWSA 3 parsí 9 Piperi 1 Oronce 1 Flamant 1 forerstal 2 Olalhas 3 iñames 1 Limparse 7 oxycarpa 1 Kusay 9 Oodinium 4 guerrilheiro 8 Picas 1 Godzo 1 Kéfé 5 niala 2 maximice 5 Minibloq 3 Gualta 2 Kaijo 27 Loño 1 loando 1 Gassie 2 Obscuro 2 involucraría 1 Ivuti 1 Malosma 4 peptido 2 Noreg 3 pernoctan 2 Íase 1551 perdeu 1 Paradigms 1 Knape 1 Lucifugum 1 Meteogalicia 1 LEIRÓS 1 Intanxíbel 2 iliristas 2 Mycella 2 infernus 1 Frendo 9 Jalil 12 Macadamia 1 kabeljauw 4 fedellos 2 fleuve 22 Mixós 9 Mandrake 3 Laurant 1 maravedies 2 fechorías 1 Penascosa 1 Oestophorella 5 papelón 2 Mirmidóns 1 Ogobre 3 fugitivos 2 Normadómur 9 Kif 46 Instrucción 1 gouriana 1 Hurrahs 4 Keeley 1 Kybernetik 1 Frangulla 8 Omaezaki 2 Mererid 1 ondeará 1 Jariguo 1 Novokuvinskoje 4 Kanpezu 1 legouno 1 Kouia 2 Lardé 1 Horehronie 4 fornecería 1 glotológico 1 Halangode 1 mönkhjinö 1 Fhédre 1 fórico 1 Ha 1 päijätsalo 1 Kintzing 1 Orosay 4 Ntchisi 1 ires 4 LOGSE 3 Galé 1 gentrificación 5 notabilis 16 Mariachi 1 Ohh 3 Marabillosa 1 Netzelia 1 lelkünk 43 mandaron 2 Oxidantes 5 Loughran 1 faríngeas 1 paralelemente 4 Monelli 7 Pierrefonds 1 pillajes 1 Hamajima 4 Optus 9 Pillet 2 meiotospora 16 fruto 12 Northup 1 Maschere 1 neocons 380 Luciano 1 gSc 1 Henstedt 1 Oswieciem 13 Petteri 1 foara 1 hyrcanus 1 goyim 15 medium 1 Iosemita 2 Newmark 1 Gymnostomus 1 inxusticia 1 Napravený 1 Maonlai 4 millors 1 Moleta 1 Keulen 1 Pabedan 30 pésima 1 frutitas 1 FICARIOLA 3 Otsuki 30 Impulsou 1 garouba 3 Ferrata 1 Glomerella 1 ominoso 16 Logue 1 pára 34 mudéxares 1 Omajinaakoos 1 Imperfeitas 1 Immunoreceptor 2 Mécheria 1 opacaban 2 ocalito 1 PELORSON 1 peyor 1 Kopach 14 logradas 3 funesta 1 picnométrica 2 Numerum 2 nigriventris 2 Picanyol 16 Nguyên 1 Immiru 1 Mixeil 1 marios 2 interligazón 4 Oussama 4 Invasoras 1 Paksujalka 2 fusciceps 5 furabuchos 1 Pabumon 4 francobávaras 3 Literário 1 hexacanta 2 Pillowman 23 manifeste 1 iGM 8 nouveaux 1 Karageorge 2 Parsu 3 Fresneña 2 fructíferos 1 Minicientíficos 1 imidazotiazol 2 Jáudenes 2 palmitoiletanolamida 1 Gane?ti 26 intra 1 Hippocampinae 254 Mussolini 1 Inesperada 2 Lecitina 1 Guajaba 2 Menir 1 MELD 2 Herschensohn 98 Ocean 11 Globalmente 31 Muíña 4 Pillau 1 Leming 1 Malerinnung 1 nordica 1 internationalem 12 Mersey 2 Jakšic 1 permitiríaselles 16 glabros 1 Onier 2 ligará 1 niche 3 Neonato 2 latexe 4 Píldora 3 HARPS 1 Lamongan 2 oleorresinas 2 Knowsley 16 Gloriosas 2 Planificada 2 neurotensina 1 Maldaresti 1 iraquianoinglesas 11 panaca 23 pión 6 Fose 1 Micoulin 2 Hessisches 1 galae 2 intentas 4 Hxxx 3 longipetiolata 2 Oranges 1 Höweler 9 nepeta 5 imbricado 3 ISSCFG 8 ier 1 merulaRB 37 mucho 113 pastoral 89 Pillado 1 Osético 14 Goodwood 1 Helipolis 2423 histórico 1 Orzel 1 Heptanese 9 Meuron 1 Gbonné 1 Galletia 4 lobosos 1 Irrepresentable 3 Fotboll 3 lascivia 980 mostras 5 Greip 1 Kotaku 32 Miquelón 1 meligoxo 1 kysaná 2 ilicitanos 1 ?l?s 377 Michelangelo 6 Pakicetus 1 intalar 1 fornécea 3 IxVimianzo 26 lláh 3 Moûtier 1 lingüísticamente 1 Paymaster 1 icke 1 Lékoumou 1 Pallaques 4 Pintora 2 humanitarismo 1 Gadeløgte 1 Junzou 1 inesquecíveis 122 Hattusa 1 Kótorosl 3 heteroméricos 2 Hydrobia 1 Invalide 1 Nizki 1 florinhas 1 inícios 1 librarii 1 instável 1 Ignitus 2 irienses 13 patrio 1 Himinbjörg 1 Kebraos 4 Kalu 21 peraltado 1 McMyler 1 nefroxénese 4 Picadas 1 fluorouracil 1 fidænma 1 Orixinalidade 1 Léniniste 1 k?f 2 ficcionada 4 Kamigori 1 hipnotizados 1 peculiarizarse 1 intrahistorias 2 Khams 3 ICESat 2 lax 14 lombardas 14 Foco 12 Matasueiro 1 Menot 1 Mollenard 24 Paflagonia 1 jeel 1 Hamelink 1 Maltall 22 Ilduara 1 Nabbie 1 Paricalcitol 3 Maung 1 Meaole 2 Ghiringhelli 2 Muuga 2 HHMS 1 Pecol 19 JUGA 1 gelar 1 Lothrop 2 fustigamento 1 frivolamente 1 flexiónase 1 Kooka 1 Frumusete 1 médiums 13 nahuas 3 nidóxeno 8 Lhuyd 1 Kisha 1 nicks 2 MATEOS 1 LDHA 2 Kukoc 4 Greggory 3 Klerksdorp 1 hatim 1 Iarlles 1 obxectoss 2 musicalizaron 1 Miasnikyan 1 Jishixia 1 Overmaas 1 Metus 1 Kabuyea 5 Oakes 1 ghrendh 4 peluca 3 insubstituíbel 1 medeirame 1 Ligaduras 12 Freyre 4 incumpriron 146 Gaia 2 patofisiolóxico 11 leigo 1 Gimigliano 2 infedeltà 1 Kicevo 1 heimilisfang 1 functional 1 Fonegra 1 masistas 10 Montereau 9 midget 1 nomebro 2 Khlung 3 Mouschouri 3 ISBE 89 lanzan 21 Oteiza 2 fcc 1 grammaticales 1 Miroslaw 42 Gandía 1 Nistplatzwahl 2 Hidromel 5 Gremla 1 Marenha 7 Irresistible 1 Paisio 14 Makarov 1 Makaritoru 2 garífunas 1 Gotebb 1 Klepzeiker 1 Íngoa 1 hennara 1 Kireeff 8 Koltsovo 6 Hernandiaceae 1 Furugård 1 macrodonta 1 keeill 1 homeose 5 pechábanse 2 PEREIRO 4 Pharmaceutical 11 Petrovic 1 Figuerinhas 1 Garinis 1 Jeremi 16 outórgaselle 1 Kornweihe 43 Intentou 3 Pitois 2 Greifensee 1 hermine 2 Pastorela 1 Hommet 1 neurocirúrxico 52 gramático 1 Hindrik 13 Offspring 2 otru 2 Moliant 1 holoturoidea 1 HZTomassi 1 Fjellsrud 1 Patenaude 1 Landowsda 4 oceandots 2 niebie 1 grett 2 Kessho 1 percentaxe 1 identfica 4 namaycush 5 Loan 1 Krégbé 2 Fruime 12 Monarcas 3 Infartos 3 micromorcegos 1 Orballeiras 1 larme 1 Mogounos 3 Paramanga 6 Marcellus 1 Guinoza 1 gómez 4 jorden 1 Navolokin 2 nije 5 Mire 1 monogalactosil 3 Monogynia 1 limitaríase 1 jinchangense 1 karlstad 3 felicitándoo 1 Phedon 6 Glóbulos 1 lomwe 2 Lessard 114 Junta 2 ovoideas 2 Footlight 38 Malleco 1 Gamdat 1 Nochistlán 6 Iberus 135 narrativo 2 Imaxínese 2 Hispanas 1 Fridmann 1 Menégos 1 Neoodax 37 Junot 1 Häusler 6 playas 1 Paaskerk 2 Organografía 7 Padmé 2 monograficamente 276 paraíso 2 Huldai 2 michaeli 54 Goldblatt 1 invisibe 3 Öz 1 Huura 16 perdidamente 1 Mecula 2 Importar 1 Läntinen 1 mogna 1 Jorairátar 1 Païlin 4 plantábanse 1 Manohar 1 Hammink 1 Oogie 16 micrometeoritos 1 Maciek 1 nonagesima 1 Hengduanshuan 1 galegae 1 Geophilus 2 Keit 1 perfidi 2 MONTE 158 parodia 2 Ikitake 1 Paraulas 1 Horríbilis 1 Naxxo 4 Granite 1 hipotonia 2 fœtidum 11 Fraiture 1 Odeshyna 3 Oryzorictinae 1 Garthwys 106 GH 1 Libelules 2 hidroxenólise 2 høgnorsk 2 Miloradovich 1 Piller 9 Piares 1 Gomazou 3 MetLife 16 kosovares 1 Peñail 1 identificaríallo 7 GañaMos 1 Hisa 1 MacCool 90 gravan 1 Navarredondilla 1 Oöcystaceae 2 Olaveaga 1 Howerla 1 khariboli 4 Knappertsbusch 3 Mineralogie 1 isle 13 Knuth 7 LPR 1 Pauliño 1 Hidrorrinorrea 3 Kiddy 1 grenadier 1 nautilida 5 missa 1 Huizhou 4 Lipothrixviridae 2 gozh 11 Galactica 2 Parmenides 4 Giubbe 4 Manz 2 plantus 2 Kamonkoli 1 NHLPA 1 monofónicos 2 iartseit 1 Kyndilsmessa 1 Gualdrada 1 monopartiro 1 frixindo 1 Malgasta 1 imigración 1 Macah 3 Hebon 1 paranzulas 13 Iniidae 1 palmitoléico 1 Microcanthus 8 murámico 1 FORMVNSVS 4 florífero 2 Mastozooloxía 1 Nyaga 1 lichenigera 2 IsraelReino 1 Kälviä 1 Lindomar 2 Lurgan 1 Lacustre 1 Multifroitas 1 idealízaos 2 negábaselles 15 Kwame 2 limpafontes 1 ignavus 3 HILL 2 ISTP 2 OCMLP 3 meatos 1 Lauzoua 23 Himeji 2 hætta 1 hexaphylla 1 humidificantes 2 hemma 119 Gian 1 imíten 30 Hon 2 Mújika 1 nisosimilis 1 Honeyman 4 Gaton 1 Lebbeke 7 londinienses 2 Paxariel 1 Lorine 1 Janjic 7 oprime 1 Heiler 5 ignis 1 gyermekért 1 Mundoclown 55 Munt 1 ludzam 1 Noví 1 fantasíns 1 IREA 7 medraren 1 Jianye 1 frecuiencias 20 ingresara 4 godt 4 Heteropyxidaceae 101 habían 5 Grenzbach 4 Mtoto 1 marnier 5 ISR 1 Guzur 1 Ghassanides 16 Kaua 1 hipersónica 1 formulalo 1 mata 1 INAO 4 máus 11 Peite 2 Gardula 3 Mayken 1 petroformas 1 Kuwagamon 5 Paxai 2 Haegen 1 Obergruppenführer 139 Floyd 14 Fermina 1 Kocopar 1 Moverse 1 Paños 1 LoKoKo 1 Ishim 1 farlazzem 3 fasco 1 Jesenius 5 payaso 7 parasitado 1 Lonja 1 Glasir 1 FEFASA 1 Ignatiev 1 pañuelos 1 feches 18 paranoico 1 Linguapax 1 Nierenbergia 1 Figueruela 1 Ouvert 1 mazaroquiñas 2 Mírzá 2 Firewalker 1 kfœlt 1 Laurentz 1 individualizouse 1 Manzinkert 1 Maypo 1 hör 3 ?asan 1 Osteografía 1 Klippboningar 1 Ladrillaría 1 hidronímico 6855 INE 1 Higashikushira 9 interaccionen 9 Ferret 2 islám 1 pedirían 12 Hiawatha 1 KBL 1 Özer 57 nitroxenados 6 megatóns 10 NV 26 Fiúza 2 Melling 1 Ollagüe 1 fotosensitividade 106 panca 1 hidroxitriptamine 3 infundía 1 maravilladas 2 Mimosaceae 3 Moeru 1 Pizzazz 7 persistía 1 guarnecida 1 molecuares 1 impartíndose 11 invasivos 1 filtrandoas 1 pakkensis 2 Hopa 2 Filoplumas 1 Patuatuli 45 gonorrhoeae 1 Gleichwie 2 Ormeaux 1 kazolikós 1 Jh 3 LOCAL 10 Holbach 1 feminism 33 Juglans 1 kä??is 1 Klavan 2 luhya 1 languedocianas 11 Generals 3 Hammad 1 Naturno 3 Pediatr 1 perxudicado 1 guacales 227 leais 1 mu?e? 1 inhabilitaríalle 2 génériques 1 Lagumanes 1 laoye 9 Hanja 40 Huidobro 1 MTHFR 2 katá 4 Galipea 2 Penitentiary 1 lesiós 2 frå 1 laminarinase 3 Haehyeop 16 pedunculados 1 Marathokampos 20 hospitalizados 1 Ghigaxiiama 1 Kikilikon 1 Hjerteslag 6 manteríanse 2 Jawi 3 jolunda 1 Humankind 24 Olson 1 Hirayasu 1 JOSEP 1 lóxica— 1 Hungtinton 3 oleoplastos 1 Labouiche 1 Murakoz 3 Kiyotake 1 gyros 1 impul 1 ifeminismo 1 imobilidade 4 Kemlyn 2 fallero 3 Imrahil 1 masoret 259 finanzas 1 Indianman 30 Perpetuo 1 Miniseries 1 Fermentaban 1 LÓUZARA 1 maxinou 54 monocatenarios 1 inmersion 134 figuraba 2 miersii 5 Kaskaskia 3 Holzwarth 2 karok 1 IVSSI 1 Jabara 68 Montse 1 intradérmicos 1 Kilternan 2 Messaline 1 Fujiraretahazu 2 Narwa 2 mesquiñas 6 Giovanelli 1 NaMN 1 Grinschpun 1 mombre 7 mencione 1 Guanidina 2 Kyphosidae 19 individualizados 6 KRI 131 largura 15 piroclásticos 1 MARTIU 41 pinos 1 Lembibre 1 hyrax 1 íe 1 panxermanistas 2 Laginha 1 Hanko 2 liposomal 2 Nagoricane 9 Fitero 1 hakeoides 1 nobilísimas 4 nemici 2 KOMPSat 1 Hugos 1 papaza 5 Galarreta 2 Mosteni 2 LLanos 1 Microelectroforese 57 Iolanda 12 incisos 11 Llimona 1 Maurguani 1 fariades 1 naomhtha 1 gaurav 3 Lad 11 fotosintetizar 1 firmula 20 futuristas 1 finalizouna 1 Margazal 1 Paramédicos 2 Konolfingen 1 Partaloa 9 minusvalía 1 kusarigamajutsu 8 ferrooxidans 1 Paradisaeidae 1 pantasmiña 10 Hwa 1 Humblebums 15 Nail 75 penitencia 1 Kriedt 245 Gurney 70 imita 5 Iulis 2 palladiano 2 Hopman 1 Hazell 1 fanestra 2 Pandolfi 1 Jucarito 1 Goxua 10 Firebats 1 furúnculo 10 fiador 1 inxectándose 1 paranzas 2 Miradorio 2 intrusionistas 12 magnificencia 6 musculoesquelético 1 Haet 3 multiplicadores 1 middendorffi 3935 H 54 lampreas 13 panteísta 1 pautou 1 okt 2 marchande 1 Leñosos 1 javier 1 Oxicamos 1 Pirsa 3 Griaule 1 Lamniformeds 5 Kuilovskyi 1 mamoncillo 1 palhas 622 permitindo 2 Medomedá 4 obrígano 1 Pindonga 1 Mielofibrose 283 loitando 1 Overeys 7 Hidarnes 1 indisociables 1 Galébou 1 llaurador 2 Gobios 1 Laxante 3 HMGCoA 1 livingdesert 2 mesurés 2 notificarObservadores 1 PLANTER 1 Misis 1 Opico 3 Iberá 2 Huángdì 1 fórame 6 fortuítas 5 MVB 1 Lapidarias 74 gandeiras 1 Gembogl 19 Insurrección 1 hexafloruro 1 Interleucinas 8 IMAP 4 Moorman 2 Llallogan 3 Konna 3 Fervenzadeezaro 1 Luveris 2 Petliura 1 MÁRTIS 1 Gilling 4 Golkar 6 Festus 2 parapolicial 1 giesta 1 FROLISA 2 luminotecnia 1 Firschein 1 khem 1 inyoensis 1 ochikobore 1 librárense 7 Monjardín 7 Kjósarsýsla 2 Malborghetto 2 Ossuary 1 medidads 1 nterconnection 1 Pantropical 1 Machinango 23 negara 3 Lauter 1 inmunobiolóxico 14 inexplicable 1 Krasnova 2 interrogando 1 LiteAce 15 Ihr 1 Mummas 13 Mercurius 1 Idaña 2 Juric 15 Odilon 1 fréganse 1 Lymphoma 1 Imlichin 4 pinnípedos 1 Petroleuciscus 1 ITSMO 1 Kalkan 3 oni 2 Pennar 1 Kailì 1 harshe 2 Mawangdui 1 Inskeep 212 médicas 1 Manifattura 37 idiosincrasia 209 Halle 1 Mercurey 1 maduresa 3 imponentes 5 IIII 1 osixénicos 2 ilegalistas 1 planhs 1 metaformato 3 Hijutsu 1 Gubel 1 Muggie 1 imalotensis 2 LIFE 4 marshalli 1 Obermünster 10 habitants 44 mergullada 1 Guarrazar 2 Laminiñas 2 Heterocromía 10 Hjelmslev 1 Oskuro 21 Novales 2 McNail 1 Orfelia 52 lingüeta 1 pivotado 12 leggenda 1 juichi 1 Molik 2 Pactolos 1 ghouros 1 Inishlyon 8 Paralelas 1 Mumsunge 5 Incenso 1 phygos 1 Noferini 3 microvilosidade 2 Palloilijat 2 MMD 4 Mataso 3 intracadea 2 hallstáttico 1 Hsinking 21 Fitzinger 1 octadecanoico 1 Pelc 1 greedy 5 magdaleniana 7 Hedo 2 Petraea 1 Hurrengo 1 ocupábano 1 Gatterer 2 Nitrilo 25 glicoxenólise 1 Listyev 3 frecuentmente 1 Injunctum 1 koli 14 Gispert 1 Halicryptomorphida 2 Fieiro 1 Kwadi 1 Nuhassa 1 Ób 1 Growlithe 1 moâ 1 inatacable 1 Makahokovalu 1 louradán 1 Pionero 1 Hexachiformes 14 obreros 12 Gaël 1 lucífugos 1 moroteiro 1 Iodoalcano 4 Ganadero 1 Fjeldvåge 20 motivar 1 parametrais 1 Nemertina 68 Nínive 1 guollebivdit 35 ómnibus 3 Illit 1 herva 113 multa 3 Increméntase 2 ltera 1 Heliolitida 1 Manxés 1 Hadarba 2 Ketchum 2 Jitai 7 ideográfico 4 Haichemydidae 3 Lugués 1 fjysjtan 2 Hallgrímskirkja 1 †Lophodontina 2 Ibiricu 11 Feixón 19 parole 7 ofrecíalle 1 Kalývia 4 láva 1 FUJ 9 Grossulariaceae 3 ostentosas 70 Interestatal 1 Nitzan 1 pedestalde 3 PKN 12 palíndromos 1 fenilbutazona 6 Luisito 32 Gervasi 2 Ntro 10 Frutas 1 Hosmani 9 Nigthingale 1 lamarckisme 1 Odollo 3 kyo 6 plantago 1 Klemper 2 Letralia 1 hepesvirus 3 Místek 1 novilleiros 2 Kinosterninae 1 merques 1 maleteiros 1 Letopolis 2 Pacinotti 388 Filadelfia 1 Iturra 1 Loosbroek 1 Kirwill 2 insinuándose 23 Killarney 1 Hetler 108 Io 11 perístilo 4 PICT 6 Lela 3 Funktionen 1 Hiersche 1 Hernique 3 perecedoiras 5 Iamato 4 Marma 4 Kaitos 1 Hipotragis 1 Paralimpíadas 2 marzas 1 Kozderková 2 Pepió 6 mobilizadas 228 Pavía 19 Jarl 1 Luecking 1 Maera 73 Marquesa 278 hombre 9 Pistatxo 2 Lancienses 1 Ferrovías 7 oico 1 Kokwe 1 hirvia 1 nystromi 1 lanulosa 14 JM 3 Mototada 9 Kishiwada 1 Gaedheal 31 Mirage 1 inserira 1 Madagasikara 1 Montmireil 3 halófilo 288 lealdade 1 Korthalsia 1 Kouhl 1 Kab?l 5 icónicas 1 Novelístico 1 Fisterrán 1 Falsearé 2 Jayat 1 kakigori 1 paon 1 Obszar 1 Oblique 2 Holmby 3 Nataxa 1 fusilan 5 Farías 1 oxazolidinonas 1 Mancosu 2 Liminha 27 perforina 1 mediapuntas 1 leiðtogi 1 Ixiónidas 2 Heresy 1 Genri 1 Hillenburg 1 Filotea 5 pecuniarias 1 Hasseröder 1 mazico 1 HOA 3 neopterixios 15 fotosensible 3 Píñar 1 marexadas 1 Iamo 1 Hoxianna 1 fuxades 2 indemniza 2 Pihlström 1 IBER 7 Kamamalu 1 Karinsama 14 Lupita 1 Gabos 1 Mélodos 1 Persussion 19 liviáns 2 ondular 16 Meade 21 Pilt 24 permitíalle 28 Ill 181 heráldica 1 Hiura 5 hidroxifenil 4 Kanryo 7 Nárrase 1 Jabalia 15 Maeloc 4 Makonnen 1 Minucci 10 piernas 1 kayku 1 manobrouse 1 octostilo 19 nucleofílica 20 Peer 1 Icosaédrica 30 Léopold 9 Itoigawa 1 Göd 1 investirase 1 Oxycrobylus 1 Parnasus 20 ourego 3 oligárquicos 1 onopordon 2 Korku 1 Mulitz 29 Pirates 5 Guerini 28 mangleiral 5 Hippotraginae 1 Medlineplus 26 iu 51 Henson 1 oibalos 2 hypomelas 1 ocultábanse 1 Mariak 2 Mamiellales 1 jararaca 1 Isocianato 1 mecanosensibles 1 Neguko 1 Hortensiaceae 3 organic 1 —pertencentes 41 Galice 3 Gurlitt 1 Noelites 1 Krafto 3 Petricca 14 mular 57 OC 3 Lejano 3 Lerche 1 Lausecker 5 Oion 1 Narzole 1 Intersolar 2 PCDFs 1 Pelostortos 1 metastables 29 insatisfeito 1 nafraugio 7 Montolivo 1 iniciaremos 1 Meixela 2 holografías 1 mostertiae 7 Isles 1 nóng 4 opistosoma 1 Ibenga 130 modernidade 1 Nagyszentmiklós 3 fáunica 6 frituras 2 perivitelínico 8 Helden 1 LaserLight 2 Metroplex 3 Keppler 33 Loxodonta 5 Foxcatcher 10 folgazán 2 lophodon 1 femminili 3 Melou 1 Ljubojevic 7 monopolizado 2 Modorenai 1 Graien 2 MBDA 1 lautreamontiana 1 moryty 1 Keido 1 multiplicala 2 Manchús 2 Plastocianina 1 Macarroni 2 holonimia 1 fevereiro 2 kinasas 4 medoñas 1 Hakel 77 Over 3 Ifall 1 mercas 4 Kô 1 harappa 1 forneceunas 1 independéncia 1 Maquitrans 2 ??e 1 materialine 10 ITS 1 ochiaii 8 foses 5 molestaba 1 Painho 1 ingear 86 Pereda 4 instalalo 27 Haloferax 1 Kolokuma 18 meiriñados 34 glaciais 1 Peyote 1 Mionn 3 Guaranteed 12 Gwened 6 Jugendstil 1 Onternationales 1 Gnedykh 1 Foilifuka 1 Kongliga 4 neuroprotector 1 filoxeográficos 26 indubidábel 1 Ngapu 1 Macculloch 1 kushari 1 Macallè 1 mapes 1 Nyahera 3 Maba 1 Krossa 1 Fonteíña 1 Jobo 1255 infección 2 Geococcyx 3 inediti 1 inconsciente— 16 Hartnett 1 Inindependence 2 Limnes 1 Léri 1 márne 1 homoliticamente 1 immunidade 5 Menú 1 luschnathiana 37 Härtel 3 Lipsio 2 Gently 3 Hohenlinden 1 Legaludec 4 Havryil 1 Milcaux 4 Ichthyosporea 1 Neachtain 2 Phasmidia 2 patrimonialmente 1689 Occidental 2 Muskildi 1 Lagáin 1 microestrutural 1 fota 2 McKinly 1 nitroxenoides 1 Mapsa 12 horóscopo 12 nenúfar 20 lune 2 limitará 1 Greensbow 1 picher 1 Farcadon 1 Kungsholmen 1 Metantelina 2 Janero 2 fluorada 1 gráfein 1 Nomin 6273 militar 2 Laco 7 inflamadas 1 Kolonics 1 pamues 1 Parsonkul 174 Moeda 6 MacDowell 2 mielinizado 18 hechos 1 Gholston 1 Juilland 1 Noordgouwe 1 Mansao 1 Neeffs 1 Oianone 3 Pholus 58 inxeccións 3 ka? 89 Kassel 1 Inselberg 9 MCI 1 Farau 1 insinuada 22 Països 14 pagana 2 Garmendía 1 galê 1 Glenkinchie 1 Moeko 16 Paes 1 Pincha 2 incrústanse 1 Muradeli 2 Goldsby 1 mixtus 1 monomaníaca 4 peruanus 2 Mornard 2 Galfy 1 Hélia 1 Metuisela 3 Montel 1 Marshalés 2 McMains 2 petrarquismo 25 montañeiros 10 KMT 1 globalisation 1 Isztria 1 Gorguja 1 Hessayon 17 Lángara 2 petri 1 Nanocavia 588 millas 2 instalacions 2 guácharos 1 milite 1 Lunny 1 Hiyo 41 Institucional 1 Manifestaciones 2 Juusei 2 Jógvan 1 Gestvedra 5 Fenwick 1 Mieli 3 metafásico 15 hialina 9 obteu 1 onaji 1 Phanpy 1 nucleofílicas 1 —fritas— 3 Fiduciario 1 lanecc 7 golfe 1 Iósiv 1 Gunfight 2 Ortsnamen 1 Namtumbo 7 oscilaban 408 Müller 61 Lillian 1 Ossino 8 khotanés 1 Hourihan 1 industrio 1 Inyangani 1 peqeuna 4 oncoxénicas 1 Nattevagt 13 minoicos 2 HIESari 3 Goudelock 1 laich 2 medicolegal 1 Hov 2 loes 2 Grimbanga 1 Nkasi 1 planxente 1 ljubezni 6 Pepsina 6 fusionaríase 1 MacDouglas 3 NCR 1 personificó 8 Lillie 1 Globalred 2 ferradiño 4 fracase 1 ochji 8 infinda 4 Macra 2 Muteki 1 meorum 1 MITERE 1 ISCN 1 kleenex 1 obsrvacións 1 Leatherface 868 marido 3 LibrariaVideo 1 icasteco 1 ? 1 Kingkongposter 2 Hitos 28 Metropolità 1 Paíso 1 Genzebe 1 glidende 11 Laysan 1 infringiéndole 1 impresione 1 Pagham 1 oneiric 2 Limopsis 1 metamorfosearon 3 pistiliforme 1 palleronii 1 lagcolir 7 McGhee 1 liñaceiros 1 ornitorrico 1 Herschkovich 259 Gallimard 1 miraus 1 linfoproliferativas 1 Marabedí 1 Paraparaumu 21 fallan 1 Norac 1 Guerino 1 Pastimes 7 Histeria 1 Indhentet 1 Ginosa 334 intermedia 2 mangekyo 1 Herburus 1 guiametana 2 melodista 3 kuman 1 Lamasusán 5 Maeva 3 Neuroanatomía 11 Khabalov 5 insustentable 3 hachos 13 Gontade 65 Millo 7 paredón 2 Ferpectamente 2 Kholstomer 8 Necesítase 1 mixomatosa 1 miObjeto 7 harmoniosas 1 Kyukyushin 1 Mahakala 1 kilometres 1 Mixing 1 Metadiscursivos 2 Ibykus 1 iåle 13 Palmás 3 Lasierra 24 Lebrija 4 habitábeis 1 leibniziana 12 Klinsmann 1 Idocrasa 3 iuans 2 Mesplé 1 nondik 1 isquiofemoral 30 Millenium 1 nitidioides 1 Flaman 6 Ignora 2 Iser 1 Kauhoe 1 obtía 22 multiforme 1 Gakhar 1 Kilobaud 4 Metaxás 1 Fyrth 22 Gaeilge 11 Herzen 1 Gardenar 1 fussion 1 Öxarfjarðarhreppur 1 guipuzcoanos 2 Jacobins 3 lebaniego 3 hipantio 1 filiae 1 Pichimon 1 Foliculina 1 péctica 4 Mauprat 1 Introd 6 Ofrécese 2 Jandasela 2 Gulín 1 herderio 1 Perasovic 2 perlada 1 Lagomel 1 Lamnunguia 1 Falsete 7 marito 76 pasaxeiro 2 McJohn 35 insulto 9 Peat 6 NAIS 4 Kelheim 1 Minefisia 50 olívica 3 Pagine 1 Occhialini 7 parvifolia 4 introducíanse 1 Hannsberry 9 ofrecíase 1 Idenburg 35 Oteros 1 Perzynski 1 Lavardén 7 Mancomunidades 5 Plasmodiidae 34 infiltrado 4 homopolar 1 Magnitized 2 francoespañola 4 Letting 569 intenso 1 monotónica 4 Meabe 15 Filippis 4 Metáforas 5 perl 1 improvisadora 4 Gerizim 8 fixestes 1 Galactosamina 4 MidpX 1 Perikos 1 Moussi 1 Nixio 2 mercadiños 3 Godthåb 11 Neófito 1 Karlö 4 Olorda 3 interpreten 14 Pantheon 10 Montignac 10 Frecuenta 1 Kyowa 3 holguineros 4 incestuosas 1 kuus 1 Hydre 40 Flickr 1 Östergötlands 6 I 2 galeritus 1 negocios Dan 1 hayrn 6 gulash 1 Laczpol 4 manufaturados 17 influíntes 43 guatemalteco 5 glotoloxía 1 obras Bernaldino o 2 ihtsj 4 liberacións 2 fosforilceramidas 3 incrassatus 2 Paals 3 Phillinganes 21 Karín 2 Hypercubus 3 Misses 1 Niese 4 Numerorianos 3 Pentamerone 1 Kyoren 1 Lunario 3 Oakwood 7 parafinas 157 Fresno 1 Golondrón 11 Mraz 1 parlantes— 1 Pampilho 1 milloriñas 1 Myslovo 1 Pankararu 2 interneuronios 1 habiliten 12 Hutchison 1 multimodais 2 Pärn 1 LTDA 1 Inclúiu 1 gebeurde 1 oraculis 1 mmiúdo 1 Mahide 1 Irgendwoher 1 kluomos 1 formigar 1 Marysya 38 placoglobina 5 Herbívoro 11 Nellie 1 orientoulle 1 Manuscript 4 Mopesa 1 krikšcionys 3 Lejía 1 indutancias 1 Ísafjördur 8 haleru 1 hiperperóxidos 1 Homonota 8 infixos 2 Feind 1 ortoquides 6 Osóriz 2 fú 1 Hateley 2 invention 7 Nagisa 1 PARTEM 28 fonolóxicos 2 Mesogástrio 3 muriendo 1 Hepociana 3 Nakaeia 4 ladrando 1 Milions 3 Kanthararom 8 habanera 1 MOER 2 Pirosh 1 Lagernojela 1 Kabutopusu 4 misticeto 27 Iggy 26 Felmil 1 Fimmtudagur 1 orquestinas 2 interdependencias 3 LOFAR 1 kalimaan 58 main 4 Makoun 1 mendohen 3 Guiamets 5 Guadaira 30 melódicos 2 glossary 1 midlands 3 HUD 1 Kisai 4 multicast 4 fusione 1 Pholadomyoida 1 nutricios 1 Gaasbeek 11 gardábase 4 Kulnasatj 4 Liù 1 Naturalem 2 Latcho 3 Guernesei 2 improbablemente 2 miliamperios 9 Karyo 2 Marijonas 1 FUDGE 3 Olympisch 1 PIKFYVE 20 manteríase 3 Kukai 1 Hardscrabble 9 Microbiología 80 imposibles 10 judete 2 pianta 43 Fulton 2 fiers 1 familier 1 ludeni 9 Lipotidae 2 patagonica 4 Mimura 6 liberalizando 1 marsupium 1 fiaría 1 flameantes 84 motivada 1 Hippotragine 1 Maxent 1 Jalpón 3 flavidens 1 lisiadas 1 flotillas 1 Peituda 1 Logicales 3 nepotista 1 Khozoviótissa 3 Medusas 1 Kussakin 1 Kosugue 7 marin 3 Louselas 1 IMs 1 oligophylla 1 Fisionomia 68 Guardian 1 Mouaputa 1 minifalda 3 inacadable 1 Latter 1 houh 2 HMCS 37 Herbas 1 mtr 14 Macias 3 Jovanka 1 modelaba 46 morgado 5 peptidos 1 incomodounos 1 lumáqe 1 Hovimäki 7 hook 14 Fawr 8 Miel 2 omóplato 3 Houses 1 Nandy 3 penetrándose 1 LARX 2 phos 11 Hepatite 1 Mugan 4 kammarens 1 hiugaensis 1 Kavelin 1 Kyatpyae 1 peglerae 1 PICARE 2 Lerum 1 Ishokov 1 kabit 2 MTOC 1 Linguaglossa 1 Kéibla 1 Ghaelgagh 1 Jodynskoe 12 Flick 2 Nsa 1 perpétrase 2 Pempheridae 6 Fishtank 1 fosgailte 1 Margites 1 Kunstg 2 Pirahã 5 ototóxico 1 nonma 1 '??ø?d??? 99 islámicos 1 Gyrton 6 ortóptica 10 Inspire 1 Kölsch 1 Medlock 1 peticion 1516 ordes 21 Pitusa 1 inflamaban 1 Gütige 1 Mulleras 1 gujari 2 Giona 2 Macesu 1 Kshesinskaia 1 lambruco 4 Piaggi 15 listan 1 paracristalino 2 Kämna 1 NCAPG 5 Morosos 11 IDA 62 má 1 pahudiana 1 Intanxibilidade 36 Frontón 1 inhálanse 11 lanzaran 5 mazahua 28 mafioso 547 literarios 2 galanterías 3 kangsmanobim 3 Hassani 6 Pétrieux 2 Kutang 3 hund 1 Jarbas 1 Liverdun 22 Filatélico 11 Fulbright 2 Nabi 7 Kaliningrad 11 Gaucho 15 Pawel 2 Lapu? 1 LpxA 3 homofóbicas 161 medial 2 mouvant 2 Neftekamsk 1 Hiziya 2 Meyerophytum 26 ocultismo 1 Mirre 1 Mentales 4 neoimpresionista 1 Modave 5 Karasev 1 likedeelers 6 Nullán 1 Ischnolepis 1 fonteirizas 4 Noticioso 4 Marialva 1 Nepué 1 Musaevich 38 IdoA 1 Hervê 2 Glaive 1 Phimochirus 1 parametri 2 mímesis 90 favorecida 1 heterocisto 1 pelón 1 nativitate 1 isofórmica 2 NBS 20 Nitrospira 2 Hearing 2 Nonais 2 lí 1 Furis 9 Llegó 1 heronicus 19 permanecesen 1 Franciscka 1 Infex 1 Giese 1 Oblivio 7 Museros 12 Lusignan 1 ginecología 2 Khums 1 obrigono 1 NOVIU 2 Lichtdicht 1 ókend 1 galanamente 21 Guybrush 5 laiándose 1 Gustavovich 11 masacraron 2 Osteuropas 27 Platja 1 mizdo 15 patrie 1 parspar 2 Phahonyothin 1 Márcos 1 Orlaya 4 llanta 1 Orbom 1 havsvågors 4 Liebheart 2 Netlog 1 Laments 3 Omey 1 Isibraiegus 2 Lekunberri 12 Orta 6 Motagua 1 fermentaciones 2 Kalolimnos 1 moños 23 Italianos 1 Hougue 1 Linguet 1 participants 1 Otik 2 Gobernato 2 infraglóticas 2 Guey 3 Oblomov 4 Laville 13 nacionalmente 1 FIDEL 9 matouna 1 Malfunction 1 nueba 1 parcerias 1 Johannisfest 3 Maihaugen 1 Marbh 1 kahesa 5 hipocausto 1 Guests 2 Letteratura 1 Jasani 1 Malac 1 Multiraciais 1 monopólica 3 ISES 1 Felce 1 Khameleon 11 Navegadores 1 pentapétalas 1 Hidroxeoloxía 1 mbrojmë 6 paleógrafo 1 Lucinico 1 Llantada 1 Juc 1 Korotkie 1 Ninda 4 Holaspis 1 Gendarme 1 Kewen 1 Gáscue 1 Mejostilla 1 Pipsan 1 Passionis 4 fotoperiodista 4 krone 4 homoxenización 1 formosianas 1 joug 1 Karachitaier 117 lunares 1 Morningwood 1 oniros 12 MRPP 2 Keylogger 1 Muereasca 985 muro 4 fimm 2 Ninyas 1 ?a 3 Jää 1 PADÍN 7 macabras 1 LHOC 1 fetuas 1 Grjazinski 1 himitsu 19 musicados 1 participoi 84 Jennings 1 g?r?hxúm 1 Maurerpigen 1 Oncosperma 1 linñs 1 Olamaboro 5 Pearly 43 glauca 4 Mizérable 3 Gotán 1 MeanJS 1 første 2 Kanichi 2 Planificouse 1 Kodejška 2 Hygelac 2 Medary 12 flan 1 Milelli 1 okapis 1 Insertando 1 Gmeling 308 léxico 3 Johana 2 Pescas 7 Manitol 3 Frescobaldi 1 mantelete 2 Hursama 2 Mljet 4 loguiño 9 Paddington 18 narratario 3 Jep 2 indispoñibilidade 1 Gundidjmara 1 Pikaza 3 PEL 1 malasia 19 Orza 1 Kuca 143 orden 1 fedw 1 mystische 1 Macedónia 4 fondeados 1 Hypotyposes 2 flexibilidad 2 Gastdorf 1 McGreskin 2 HEC 1 Manteigarías 16 floxisto 4 multímeros 16 gretada 1 Landrechte 1 fontainebleau 2 Moscarán 1 neurofisiolóicos 1 incorporounas 6 IXL 795 GBR 1 Periurbanos 2 lasseli 1 Piéton 18 Kenobi 7 Malafeev 6 Fundamenta 3 Gonidec 1 Onapres 1 Koron 10 Musikverein 1 Informatique 9 Foucaud 3 Orchestral 1 Grimmelfingen 1 Fritas 1 neuroentérico 18 Laurin 1 increpalo 1 Inishnakillew 2 Ištum 2 Meertens 1 gardarlle 3 Jogia 1 ingerlanerat 6 morote 2 Panavision 1 hyacinthi 1 Goldsworthy lle 104 inspiradas 1 ficoblínicos 1 NOBILISSI 1 Lauchón 4 finger 1 Kephalê 5 Katey 1 iridocarpus 1 Kastrychnitsky 1 Joasaf 1 Gotell 28 obxetos 1 independizaranse 4 Maigue 2 límpidas 1 Osud 3 hólos 436 Morris 1 Palheta 9 murinos 2 Patrocles 1 Kockott 1 gordum 1 Guaš'a 5 Greenstreet 1 Genann 1 meldoiva 12 Industrie 5 Ì 1 merinidos 12 floriñas 11 iniciouna 1 oinom 1 Harer 7 Microscopium 3 Inishowen 12 Gaspare 95 Niágara 1 hoeschi 2 manasses 1 Monofilética 1 Geomatics 2 Nobuhiro 5 pataka 12 operatividade 1 mandábana 1 Oxmócoc 1 isçidir 1 Fárria 2 lamentada 4 peccato 22 pc 1 Infelice 1 mobster 1 Nitara 79 Noya 1 Hookway 1 Lepotice 63 fervor 1 Iskele 1 kuusi 1 Interurbans 1 masaxar 2 PGS 3 perifovea 5 infecte 1 ocuparíanse 3 Merquei 10 negociaba 1 Painceiros 1 Fuentelaldea 21 lentella 1 klaustur 1 Peribebuí 4 Korjus 1 Paracleto 2 moteiros 10 Namatjira 4 Nogometna 2 GasTerra 1 medíbel 1 kuvia 2 McGarrigle 1 leucothrix 5 Intxausti 1 Nasium 1 óganos 1 Lactariidae 11 festexa 9 Pip 19 orbitaria 4 Osoru 1 Hootsuite 1 Marcián 1 hinchado 1 inumerables 1 Mokkatassen 1 Konibodóm 1 Markström 1 neúmaticos 1 Nazionalista 1 illadoras 3 Haloragaceae 2 maquereau 1 Guzmão 1 Mosquetóns 1 Neuroradioloxía 1 Kajgas 1 neanderthalis 3 pintoras 1 habilitase 1 manando 1 Gorgoritos 13 Foni 2 Gorgs 1 Pelosi 1 Moullé 3 Modise 2 Kournikova 1 naoi 3 Masat 2 Pelz 1 Oliwie 1 Malayerba 1 ganesha 1 Ferreyros 2 Motronic 1 Mascart 1 inosinato 1 Ovine 7 hippocampus 18 Otoño 1 Gollancz 1 maltofilia 1 gulb 35 Hirsch 31 lunatus 1 osixenando 1 mallasen 1 Ligures 1 Orchy 1 hogei 2 fasta 3 Guasave 1 piido 1 Justiciera 1 kazoos 2 jinshi 16 Olózaga 1 Mazuecas 7 ICH 1 Minnigerode 4 Pharmacy 2 LYON 2 Krylovskaya 3 isoprostanos 1 nicobariensis 1 manegum 2 Nipa 4 Lepage 1 guiametal 1 inmunóloxica 1 Makaira 1 metidjensis 1 Minerales 2 Ghoxada 37 hipérbole 1 Matsuzawa 3 Hawrani 2 PARN 1 Ooixida 12 Fontan 1 fyw 1 irandés 8 giallo 45 Negreiros 23 Gozón 1 hidrocarboxilacións 4 parietaria 1 Luftinja 3 Monatliche 1 Phunphin 3 LSPE 1 maineis 3 Piratería 5 Lenticula 1 intermediata 1 Odumegwu 1 Hockei 119 peonil 1 multigrupo 2 perseguidora 1 Merewalh 10 idiomática 45 gravitatorias 10 mexicanus 3 fueguinos 104 Platanus 72 ígneas 1 Hielant 1 Joda 1 Penan 4 Grimani 1 labializado 1 Lobkovický 11 Minamisatsuma 1 Fous 1 Midpoint 1 inverténdose 4 oíndo 1 Gladimon 1 Jacquouille 53 Mortos 10 Niau 2 Guaritos 24 Llingua 2 Ï 1 låmes 1 maswheat 223 Pl 1 Makasutu 1 Impatients 1 olgae 13 Paumán 10 Jiangsu 3 morla 23 mercaron 1 motohira 2 Nikushimi 43 oblast 1 Gestur 1 limbii 4 peáns 1 oxística 1 josei 1 fuscicapillus 10 Fluctus 1 Halló 1 Fluorotechnics 5 Lutzomyia 1 Paleontológico 13 intravenosos 1 ñhe 1 Gurwitch 1 laneiros 1 iniciamos 1 mexilloneiro 1 gañarom 68 furia 20 GRE 1 Grezet 1 Grappasonni 1 Gamesoft 1 kefensiz 1 lopende 2 Gerasim 1 Oxmo 1 Pagou 9 Literat 1 Kunies 12 Maazel 1 Koeller 1 Luanne 2 Filatélicos 1 Macusari 3 Meré 1 osteosintese 1 Nuta 41 Gladstone 11 Perlis 1 laseres 2 Palea 3 neurosensorial 8 Hadoque 1 Opsund 18 Mentras 2 hojilla 3 Novun 1 Kosakenmythos 1 Mystacoceti 8 PCX 1 Lomnxitude 1 Mercogliano 7 philippinensis 1 Ikezawa 2 pashtun 6 Órbitas 2 jenkinsii 1 Glimboca 1 Kusanagi 1 pesarase 1 intesa 5 NDH 2 MusicBrainz 4 Meany 3 hallado 4 pinna 10 Oddsson 28 Janus 1 Lumiere 2 Jeremies 2 Gyeongsangbuk 2 Mullerboa 1 jamesoniana 13 kiang 2 ncielo 3 Gondán 1 Lestines 3 Phelsuma 2 levarllos 2 Homayoun 10 Finck 3 officiis 1 Kerinci 2 inflame 1 ovulatorias 4 NMP 1 Leselidze 1 Instr 11 Montpelier 1 hov 4 LGAs 1 itur 5 imperfectamente 35 inteínas 1 fl 1 Jibal 2 favella 1 Kloke 1 Köstritzer 1 Karlbo 26 Judi 1 intrarterial 1 Kurozuka 1 Gerbel 138 impresos 17 Peruana 3 flamebait 2 Insegura 1 hemiplexias 1 Panonias 1 fotorrespiratoria 2 percórreo 3 pífano 10 opresor 1 feéricos 1 goran 1 Pepónida 1 persuadírona 1 Mj 30 Haller 1 Florigene 1 p?ra 1 ladderanos 11 pescándose 1 inoculouno 2 garanticen 4 Merk 2 motuanos 1 liolepis 1 homomisión 2 Ízaro 1 metilfenilato 2 Kuros 16 gegen 1 Ñirre 1 meliloto 1 percorréndoos 1 Honir 1 manifestándolles 4 imaxino 1 ferdinandi 1 Itkuch 69 financiada 5 Goslar 1 Honalo 6 Novelty 1 Kadel 1 hesicastas 1 gústenos 1 Însura?ei 1 Laurita 5 Kundiawa 1 Groninger 1 Lunarium 1 luciñas 1 fellahin 13 Laine 1 Methysticodendron 1 McNeely 1 Junho 21 Manzanera 1 LLONGYFARCH 1 ipo 1 Inconceivable 1 Gusmãou 19 Miley 1 Hilbret 2 Konkurs 5 Petain 32 Graça 9 Parnaíba 1 invert 1 HUT 2 Gordoservon 1 Obsequens 6 Kaurismäki 23 Jágr 1 Kalmikia 12 ontoxenia 1 LABIU 1 Montalte 1 Hockessin 110 Graza 527 largo 2 inhíbea 4 Juvenilia 1 nerea 1 Penou 1 Haciendas 26 Naegleria 2 Kondoa 1 Funicamp 1 kevään 2 furuncho 2 hickelii 1 Lishman 3 ortogonalidade 3 ofenda 1 Krtskhinvali 1 histetoloxía 7 Introducció 2 Latronius 41 paralización 2 Pirkkala 1 llunat 2 fluxogramas 1 Kleppinger 1 gafoso 2 Formen 1 Nestre 1 natessë 1 Keikaku 2 funcionamentos 6 Loganiaceae 3 Maillé 1 législation 5 lambrequíns 2 Péruse 95 parlamentos 1 Opiário 3 heterofílicas 23 orillas 26 lésbica 1 imborrabel 1 Méar 1 Kurrama 1 Grapefruit 1 Phanfone 7 Lagosta 211 lóbulos 1 Gless 4 Lubierre 5 Franganillo 1 localiade 5 marquesina 1 ortorrómbicas 1 Ndebele 2 intuíron 133 Humor 1 Palaciega 1 Leptophryne 1 Grandiosa 1 knesset 1 Hyracea 37 Mauri 1 gwad 2 naših 13 Operaciones 5 Haageocereus 4 Papag 1 paresseux 1 Mateut 58 liiga 112 organizouse 1 Napoleonicas 1 Northdale 2 Inegi 6 Newbold 1 Gervasoni 1 Liberopoulos 1 Kymylyn 1 missnöjets 55 mandados 1 Notopleura 2 friolés 1 Lagayan 104 Jensen 18 monoplano 3 pièce 1 Maurac 682 heroe 1 Kafia 2 Hurlus 1 Metoxitiramina 1 particionar 2 parkinson 226 marcial 4 Idéfix 58 grelos 1 navigateur 1 instrumentado 1 nuristaniano 33 omite 22 Madrileña 59 parcelaria 1 memòries 1 iriba 158 guerrillas 1 Gricel 1 lassenen 1 micromensaxes 4 hepatis 4 palladianismo 4 Kahle 2 musicalizados 1 macabeus 1 ngaro 1 octosilábicos 1 hypocistis Walp 1 Genoscope 4 Fullana 2 Lamblin 1 Horicultural 1 Pinhou 7 palimpsestos 1 Lotarev 1 Petacas 1 Ilkhafiqat 5 maglev 5 Heguri 2 Literari 1 patersonii 1 Mahandougou 18 impidan 1 moleclar 87 ligueira 7 homoxentisato 1 imitáronno 4 Mixima 121 Gallo 4 nefando 1 Hegedus 2 ISto 1 perseguindoo 3 hipoxeas 1 Mechaniczne 2 Freemansundet 546 Índico 1 macnabiana 1 Komitato 1 Jablanczy 1 Macayo 6 Jailhouse 1 Górska 2 Fradúa 1 iconolingüístico 1 Litopterna 1 morbideza 1 Medalists 3 Marmelos 2 Kasavubido 13 Pallisa 2 patelliformis 1 Montanya 2 fong 3 flavicarpa 1 Maleras 1 figúraas 1 Necrología 1 Imaxinaba 1 feriais 1 PDBe 1 flamewars 2 magyart 321 GT 13 patinadora 3 Gajah 82 instrutor 1 ghux 26 herculino 5 Manute 1 Favoritos 1 McCinsey 6 Melodie 1 interconectábeis 1 Hagno 1 Nabí 7 Guaíba 934 gravación 7 insculpta 66 permitidos 1 Jinmeiyo 1 Frontpage 2 fototáctica 2 intumescencia 7 Koizumi 1 parasindical 58 marmeladas 1 obvía 22 iba 3 melanocephalus 2 ferraxe 2 Ledocarpaceae 4 Lucélia 1 Hasmasu 2 matri 6 ollarse 1 fenamifos 4 Lombáns 2 oricteropo 5 kumis 1 llamaba 45 Gianluigi 1 fosfomanosa 1 Myutsu 1 Oroville 8 furriel 1 Kaiserdom 1 Hangiri 1 Odelegias 1 noitaregas 7 hexaedro 1 k??k?a 4 malkhê 2 pittoresques 40 littérature 2 Montfulleda 1 finocchietto 28 inmobiliarias 1 halonio 1 HyperCard 9 Peneo 3 Mames 2 Joksimovic 1 mississipiensis 2 Hirons 1 Lahowska 2 panárabes 1 Khuwalidi 15 pinches 24 laca 4 Pern 1 Parabrotulidae 9 Gangemi 1 Maronitarum 1 Naidoo 1 Leoncico 2 Gogoi 7 million 8 Physcomitrella 1 inchoata 1 Filipopolis 1 hamatacanthus 9 faringal 18 plaxioclasio 1 fisioloxíca 19 Jeunet 1 identico 5 Lehár 1 novarum 1896 Ó 5 Lisse 1 Gürgan 1 metacíclico 4 Pallarega 6 KPÖ 62 paracaídas 1 Papiria 1 malversarían 2 Medrões 141 Norton 1 Férrico 1 garántena 1 inceputurile 1 Kacey 1 illita 1 IPng 1 Orthopteren 8 obtuvo 4 ledgeriana 15 flaxelares 1 Hvitsten 1 habjai 2 LOMO 2 herem 8 Fourteen 1 garabateou 1 Mohammadi 4 Légendes 1 grazhdánskaia 1 Interludos 1 Friesekaas 1 peregrines 1 Livija 1 Gassicourt 1 Maties 80 Merlin 2 Leyon 49 Khartún 1 heulen 1 insociabilidade 2 obxectables 1 ljubovju 2 Gulick 2 MDCK 18 latrina 1 Katicic 1 Neujahrskantate 3 intensísimo 3 namah 4 Hardenne 1 genocide 1 kampf 1 gpe 1 Hruša 2 KX 15 flanqueantes 1 Gailly 1 Katulu 1 Kyrus 1 Harpocration 1 Khariton 1 Orajõgi 91 finamente 1 NikkoSennin 3 NASL 3 Pactolo 73 manufacturas 1 Huída 2 infartado 1 Kolasa 1 minueto— 1 Magamat 1 intuir 1 itaúba 1 Palúrien 4 indogrego 1 irrespetuosa 14 Fionn 3 platyphyllum 2 peques 7 Forna 1 Monoica 1 Hotanilla 1 Kjellberg 521 integrantes 1 näven 1 Mouren 4 Imperatrix 3 Galiciaencantada 2 mancando 7 hilarante 7 geografia 1 malienos 2 leucémico 1 Kfilereplace 13 molladas 1 gitmo 1 guaraníss 2 Kolowana 4 Fratte 1 golsar 32 merenda 10 Gilford 2 Humeur 21 GK 2 idolatrías 1 mercaders 6 légende 1 Gharbiyya 2 Hispalense 1 Kunigaikštis 1 LOVIIS 1 Klokkevold 1 páX 1 inmigraren 2 Guajiro 1 Ithun 1 Gousine 1 manifestaríanse 3 Fonologia 2 Orbitando 3 periculosa 6 limparse 3 fotométrico 3 Mojibake 1 Interponse 3 Liatroma 3 Hoberman 1 Novelino 19 Gura 1 Idolator 1 PauknAir 1 ondulantemente 2 Khadia 1 Maghúa 37 Ionesco 4 opoñíbel 1 Kartoflerne 1 Haygarth 2 OCCASIONE 1 Habías 2 layardii 1 llenastes 1 olympiske 6 galardonada 2 perisinusoidais 2 ocasionándolles 12 Kiyoshi 26 Lembranza 2 gonio 1491 fundamental 31 loura 3 matarán 2 Mirístico 1 Olerti 1 Pandiello 2 Moei 5 Gelpi 1 Obrass 1 Monachidium 1 Fången 3 neobabilónicoImperio 4 orbitario 1 Koloff 29 nomee 4 INIA 1 Odbrojavanje 44 Juanes 2 Jugendliteraturpreis 1 pietosi 1 Francisville 1 Mammalology 3 MVRDV 3 Houssaye 1 hanoiense 37 marchara 10 Gunrod 5 heterocigótico 1 PAUSARE 1 Ormenis 17 Identity 1 Nublus 1 Imnul 4 lencas 16 modus 4 MQM 1 Joham 3 lapidada 2 Grenadiere 1 Flysch 13 Mutación 1 LasXanas 1 notal 1 laberintodontos 1 nausea 1 gostei 1 flavias 1 Niorouhio 2 Martyrologium 1 Hažín 2 pelaxes 1 Gürzenich 2 Geograph 1 oliu 18 Passarowitz 1 kiram 1 Havighurst 4 Goloso 6 gozase 1 Kadampa 1 Fisiopatoloxicamente 9 Lace 106 Nordés 1 metilumbeliferona 1 Kannemeyeriidae 1 Nieuwvliet 7 Mindonienses 25 pequeñas 1 mlleres 2 Nane 4 Oo 1 Grècia 1 melaena 3 Observado 476 Pan 56 Mausoleo 1 Mazais 3 matrobim 9 Olentzero 50 Maggiore 7 Motuloa 12 Herbogo 2 Kangchenjunga 2 Incivil 2 Liofilización 3 Kingi 1 Fuelóleo 3 homotopía 12 Furukawa 3 Golpéase 1 Kirwa 1 m?têr 18 invocacións 6 Moxa 1 mañonesa 1 Harwell 1 maternitat 41 ignorando 1 Nauset 2 Laevicardium 10 flore 1 oyasetage 302 laboratorios 1 Kintore 2 mioepitelio 1 Hailuoto 1 Pirritx 11 imaxinada 1 Incisivos 1 Karafotis 46 peronista 2 Oyewole 2 HAN 1 Herstein 1 nucleotidases 1 Muscida 1 pióxenos 5 gastroepiploica 6 Formigues 1 galwegian 1 Pecineaga 2 nuclea 1 Hibonita 2 mecanizándose 1 IRST 2 Neobarroco 1 Fejérváry 1 Öhningen 3 Farmàcia 1 Koryaku 1 Liberaron 4 moia 1 malsán 2 panafricanos 6 Kingdoms 2 Kanno 4 Moleculares 6 iten 1 Ladadika 1 intimiden 1 Kollado 4 Piombo 3 intoxicada 1 Localizadas 1 Idepe 181 limitados 6 fasciculada 4 Gandon 8 hidalgo 1 Katharevousa 1 miente 1 Pachyohcan 3 Marlee 1 Mossoró 531 Obras 3 Inquérito 1 perfeccionalo 1 foleira 1 Mladenova 2 HERNÁNDEZ 2 Hennaya 4 Hindeloopen 1 mioalbuminas 1 milijoules 1 Mocorito 1 Hannafordia 12 fermentativas 4 Hernandarias 1 Meteorològica 2 kurmanjî 1 Italiænsk 2 Nesosilicatos 4 Observatório 3 Keye 16 Muxicas 21 hanse 148 fosfatase 1 Hidacio foi 1 Hypelate 2 mudó 1 insculturada 1 Jurica 14 illando 1 Kalfatjorn 10 Moakes 12 Pelham 1 pericardites 3 Lumbo 27 Leighton 1 Neskaya 1 inutili 1 Patriotic 314 numeración 1 Hammed 1 Lugol 1 Iespana 19 Ibis 1 Mrak 4 Pakarripa 3 hipercalemia 1 inscrições 2 Marler 4 kwaimatnie 2 institute 1 ?'mænju?l 1 isteach 1 meiss 1 laboratrorios 1 HAH 1 Haukal 1 Pighi 7 invulnerabilidade 1 Heinie 1 Hyperiidea 4 patrullan 21 Moratinos 2 Oberhofen 1 Lyuben 7 pil 38 Marais 5 Lunacharski 1 Mouchette 1 neoglandulosum 2 palmatinervias 1 hottentota 2 Malaxechevarría 11 pequenez 1 patearon 1 perguntou 15 Friedemann 2 Gobernando 295 Mata 1 Feradura 7 Fountains 1 Flicks 2 Iamaguchi 7 Microtúbulos 2 glente 1 Khveredzh 1 Marathenkerny 1 ninjo 2 Guadaporcín 1 niepodleglosci 1 mamotrofia 2 nomearmos 8 figure 2 Iazinho 17 Hola 1 Pangkalan 1 Lobez 3 Periboea 15 meniñas 2 Kamés 3 metallidurans 6 metino 1 Leptocéfalo 1 lagañas 1 Muqaffa 1 ogham 15 Monocerotis 4 itn 1 intrus 2 kulit 3 Karnavati 19 leváronlle 4 Gueuze 1 Kith 1 Kompiam 1 Fosano 3 Leuques 21 Gackt 61 Fianna 3 Parchi 12 mbar 2 Ífer 1 foitas 1 LUTEGA 1 Lígase 4 Gelei 1 Oeconomicus 3 Morna 11 funcionarían 5 pickups 1 Grassendale 3 gnaphalocarpa 4 Hoggett 2 Kadooment 1 Pícha 1 Gwaelod 2 Nahkolnic 1 Farasiota 1 Frineo 2 kaotiko 1 haplos 1 Metrolina 45 maxestade 2 Headless 2 Knefler 1 Partler 17 Harman 74 lepra 1 Maicanesti 1 Mykologisches 3 Hymes 1 Planeador 4 kirmanxekí 5 Oxesed 1 Huángjinjia 1 Neocesarea 1 homolitica 1 Mitulescu 14 padroeira 1 Heristral 2 Hepatocito 579 Marina 1 Fazendários 1 Mizocitose 9 fatídico 1 franciscáns 24 Maicon 1 pahleví 37 pescudar 1 Osku 1 Nuristanyan 2 Hermannsburg 1 ObxectoLixeiroNoCompartido 26 lady 42 Introduciu 3 Mijáil 5 Massotkleiner 1 multifrecuencia 6 gabar 1 NIMIDI 1 kuznetzovi 1 Liocacinus 1 independentmente 1 Mojanda 5 incompletude 1 Movements 1 pedunculiflora 2 murcego 1 inmunodominancia 2724 liñas 14 Guillemot 1 metasulfito 1 lvb 1 Okro 1 Makdha 116 Nava 4 lacenas 67 Mercè 2 FSI 4 kelpies 5 Lorenthey 2 Malalaita 1 Gz 3 Hifoloma 7 Ogea 3 pàg 1 Organizzazione 1 Igna?iu 4 Orue 3 perduda 6 parecesen 1 Mastichodendron 2 melanismo 7 observantes 1 Haloalcano 1 Gothländska 5 mascaróns 3 Jaivas 1 Lasher 1 Jibou 1 Meido 1 Jezik 2 Leianokládi 1 festucas 2 mordelo 1 paquicefalosaurianos 1 pharmacia 61 Pie 1 granceses 19 Láser 6 Heyne 3 Pagrus 2 Maggiora 1 Lapatinib 1 Jakkelsen 3 géographiques 124 Garde 2 Otone 2 Lianne 1 Kulturbesitz 2 pequnos 1 Igliano 4 logarítmico 1 Näscht 1 Higalgo 19 Impr 11 perinatal 38 Martul 1 Kurimoto 1 identificarvos 2 Käre 1 Nebilyer 9 Largura 3 Fanatismo 2 íons 1 Ninquelótë 1 marneffei 2 Orloj 1 Mowdok 5 flemas 5 Paxos 1 hachelense 4 maritais 186 Noticias 1 Maindo 1 Fashola 1 oba 1 Heiti 3 Gilley 1 Pianfei 2 Permitiuse 2 perica 229 mac 3 gaullismo 1 motum 1 Fluxacur 1 Hedos 1 Mandjo 1 H?æt 1 Hoyocasero 6 Moustier 1 Infectou 104 lituana 794 Moreno 7 melodia 1 gilt 1 pitys 1 indispensabilidade 1 Nazzi 2 lemnia 1 oasises 2 Neogenyton 1 Hobarton 1 Hayn 6 Onagraceae 1 Leucolla 1 Norbait 1 lupokhina 1 Lugd 12 Hane 2 Martilla 1 Lindsayae 4 Lantadilla 1 fydda 41 flexíbeis 3 Heuer 1 Kigamba 1 maoerense 2 migrarían 5 Leoneses 6 Perturbación 1 Manté 1 Hadjera 15 PAIGC 1 libéranas 1 Isauri 1 fonología 1 Pinrom 23 FL 793 Pío 1 legendado 2 Illorai 9 irisacións 10 Hashaná 239 Lviv 7 Pakito 1 Klavin 42 Jiang 4 Lépeaux 2 Kungl 2 nefrotrópicos 1 Koze 1 Multiserialis 3 furina 4 ovacionado 1 golfinos 1 Moulinex 2 noastra 1 Musikerzimmer 1 Iniciaría 1 Lophotidae 26 hemocromatose 2 magnetizado 4 Landesmuseum 1 Mercadoría 2 hidroximetilfurfural 3 microanálise 3 Loscertales 1 Hipswell 11 Feel 1 Michelopagurus 9 Huáscar 1 Heildelgerg 1 Millville 1 Kinetofragmophora 1 napas 1 Ngwokoma 1 Nakariakov 1 ortotrópica 5 Índios 3 Kirguizia 1 Komisji 1 Majevica 1 motivadora 1 pentadecanoico 1 Liturgie 118 Participa 1 pirate 1 grañudos 1 Ostraconotus 1 Hapeville 6 Kibaki 1 octreotide 4 Guerediaga 950 per 1 micrococcina 1 Iekharunov 71 parches 21 multipartidista 21 interrompendo 1 ium 1 Hidroalcohólicos 1 PARABOLARE 1 kpellé 1 Moritake 1 Honni 1 itaipu 2 NRW 1 fuld 1 Kasutera 1 olimpista 1 funtamentalmente 1 indis 2 Hoshoi 5 Gavira 1 paglilitis 1 Middelalder 38 Montalvo 3 Mothe 2 Fredag 5 Longares 1 'juz?f 1 Kazajistán 1 hemisferiols 1 Imbaccari 1 leptosomatus 1 jörð 10 Mensual 2 Kacic 1 Henarez 56 Milla 2 famosísima 1 Lotze 1 Papyrusrolle 2 infrinxen 3 Gazprom 1 Myasishchev 2 masculine 6 inclasificable 74 Grimaldi 1 gasodoméstico 2 Genderu 250 Niza 3 Ortolani 4 horst 1 Nsambya 1 Medros 1 nematos 1 Hériard 1 Motacílidos 2 magrebíes 1 Luftwagen 1 Íntims 17 Hypanartia 1 micorrizóxena 1 marrubioides 92 glomérulo 1 Kerkakkers 5 Oihenart 3 pensées 475 Minas 9 Ledigos 1 Lutteurs 2 Kitanakagusuku 2 hereditárias 1 Kimissis 5 Grabado 6 landscape 2 Genre 2 Lamartinière 1 Heraric 1 maderista 1 nantais 1 Falmari 2 Ommatophoca 2 indoeuropee 2 Iguanas 1 inmendiatamente 1 municoiio 1 McLaine 5 Montoyas 1 Miledi 1 Kaidanji·Yajirobe 1 Mazados 3 incoherentemente 29 Mercy 1 Fjeld 8 mejorar 1 Oligopéptido 7 Palavea 114 naturalistas 1 Halics 1 néurula 1 herborizara 1 holocénico 2 Habegger 1 hodierno 7 Follaxe 52 placebo 8 inmutables 1 Huggin 32 flamengas 2 Kuzio 2 Kedrick 1 kagathós 1 infrinxiulle 1 Parascolopsis 2 Mushidama 1 Funkenstein 8 Pereiramá 1 Leoncin 715 Jackie 2 Ixhuatán 1 formánronse 2 guirnalda 2 Kaçanik 1 hipergammaglobulinemia 3 Planetário 1 Frizzle 1 Leime 1 impulsivamente 6 Komunikazioa 2 Northside 2 Kleppur 5 granzimas 1 Mattulffus 5 Gweedore 6 Nutty 1 famosisima 28 mucinas 1 festexable 1 Maromi 10 Langston 1 Hellwag 1 Lueheopsis 1 intersomática 3 habitárono 5 organelas 12 milaneses 2 Khodorkovski 39 Pickford 2 Furax 1 Isalnita 1 Pectenocypris 2 Mbarek 124 mio 32 MARTÍNEZ 1 kiadó 7 Inundacións 1 fimmtíu 1 Niemandskinder 1 HardCore 1 Geotoga 1 Gordium 2 Korseon 1 íctiofauna 1 Milion 1 luguio 1 Lassiters 4 kambo 4 Perino 2 Mixomycota 2 Oxol 1 melanopleura 1 Gélebart 1 Knoflícek 4 lj 1 MDCCLXXVI 7 Nijmegen 2 merídiem 1 Liviano 2 Imboden 1 MCCCLXXXVI 3 Kumla 5 Jenö 1 mauores 1 McLynn 1 ghari 42 parenteral 2 Flumendosa 2 nidas 11 humillados 1 monastisco 1 Migeod 1 gryadushcheye 2 Malacanthus 1 Ifriqiyya 1 Penafria 2 kyós 6 Kehl 1 hesperidósido 1 Macallin 1 Lyz 1 Gelders 1 hydrosinus 1 graníticoss 8 panoramica 2 Muñazuri 1 Mbaitolu 11 Mod 2 Limenitis 1 Nangere 2 kaas 1 Maprang 6 Pardemarín 3 parotidite 1 Histiocitos 1 Newse 2 Ferrador 8 Joksimovic 43 parvo 1 Lysaretidae 2 inodo 1 Menn 1 Nsukka 5 Fitzhugh 2 Latente 1 Faszinierende 2 Fayed 3 mpp 3 indetectábel 1 Olivencia 1 Mholuaidh 1 obelina 3 indecoroso 7 Golubkina 143 minúscula 1 Jokyoku 1 parfectamente 6 limpadas 13 Gnaeus 1 motivaba 1 Multo 1 Feanor 2 Fedde 73 loitadores 2 Libett 5 Jessi 1 implicatorio 3 Mivtachim 17 Filloy 1 Jesuitismo 12 Monochirus 1 Mwariko 1 latgalio 1 Gallado 2 interconexiones 2 Mauberley 1 Indiscutiblemente 2 Huizong 1 Fredenandi 1 Gesänge 202 Neolítico 147 imposta 5 Gullade 1 Mitts 2 multisecular 1 Gaming 1 Macarulla 7 metalinguaxe 1 Leita 1 modernizándose 1 islamic 22 finalizara 333 Inés 18 Pagés 3 fogaza 11 FoxPro 7 Gove 86 Oitavos 1 Obituarios 1 Kastberger 23 mixobacterias 2 flags 60 fumarato 644 manga 18 Leviatán 2 FASTRAC 1 Krsevica 42 indiano 1 Leclerè 1 órdea 1 festexándose 50 haplotipo 2 mineralcorticoide 498 obreiros 2 Phalangeridae 2 interpelados 1 mixtecano 2 MacFadden 2 KSII 4 Ordell 3 fixalos 1 minerío 4 makednoí 1 microbioloxísta 17 PGA 1 nahm 4 Intxorta 1 paroniquio 1 Lefley 1 Frenesia 1 Hermance 2 Lave 1 favoritismos 115 máscaras 1 Marszalek 14 Olympe 1 Goubel 2 Luzni 28 náufrago 2 Lazado 1 merlín 2 Gastroenterite 2 pantorras 1 infiniment 6 nire 2 Infidelicidades 3 Hore 1 Miková 2 glutaminopina 14 ornamentacións 6 Kannon 1 Firence 204 plásticos 1 judices 1 Glubokovsky 5 Kupres 1 piceetorum 1 Graneros 2 línias 4 Guatemalteco 8 Hostia 1 Llandiloes 20 pavimentación 1 Nanosensor 1 Kantzouris 1 Obach 1 Planctanthias 2 frouxamente 1 generalizó 1 Luitpoldinga 1 incessantes 4 Pharaoh 1 merman 1 Oenantheae 1 multisatélite 3 Fournaise 1 Masuho 1 gealdor 2 Metilscopolamina 63 Narcea 1 Mamirolle 1 galactosialidose 25 Objective 2 Galit 5 Opitz 10 matouse 1 Gipfelregion 25 Macaulay 5 PHz 2 Lanata 1 Penetran 9 Herbello 1 pasandas 10 Fidelidade 1 Héliogabale 2251 levar 34 Heerenveen 3 Jidai 3 Gastrectomía 1 itala 1 Froyaz 1 Kuechler 7 MpB 3 Ovau 2 FRODEBU 1 mingallo 3 Leyde 1 NICAEENSIS 1 Fitosocioloxía 6 Jerkovic 57 Kagawa 13 Naos 1 Kalemba 1 Nikolishin 1 mizrach 1 jibdb 2 Íllora 1 NMMLSC 3 Micha 7 Frosch 1 Fouquieria 1 Lulworth 5 Luzzati 1 Fealdade 1 Palatset 1 mullaha 11 flanqueadas 1 minigastrina 4 impossible 14 fixose 1 Piroloxía 1 METAFONT 1 olmeirais 1 Guerette 1 haplous 1 indicanvolta 2 Nobiling 1 Lobsigensee 1 mergullárense 1 Lovborg 35 Íscar 1 IsraelArameos 1 namiyei 131 oír 1 haui 6 Liquidación 12 Personaje 1 INTELIGENCIA 2 odous 1 Golosalvo 1 KaiserGreymon 2 Montona 1 Licoroso 1 Melanthium 50 Inmigración 1 multigüiro 1 ORICLA 21 Phan 2 Ferni 1 Ghirogawa 1 Pistoletto 35 Freak 4 hidroxenases 1 Merovech 1 Kashiwabara 17 inversos 1 Kamiramugezi 11 Morobe 4 movilización 1 Pinnidae 1 hidrotórax 1 Glangleu 2 —moitas 1 Lechazo 18 Pigmalión 1 hirtifolia 1 Netvibes 1 muzak 3 Feuillants 1 negrinus 3 karstificación 1 Moruo 1 maçapão 1 Giulieta 52 intercambiador 1 FRUTUOSO 3 oienses 1 Kalim 3 nociceptiva 2 nuester 1 litificou 1 pautu 1 industralizando 1 irasuensis 2 honrarlle 2 Goniodoris 1 independa 3 Launfal 2 Kronberg 1 pissenlit 3 NODAR 1 hermanado 1 Maroua 1 matéricos 5 Neuhof 2 Mùideart 3 Pigmalione 4 Hadriana 1 orxinaran 1 Junça 1 Malini 3 Isten 1 Hoofstadt 1 Malpàs 1 MulticsEmacs 5 Pilat 1 Languidezo 3 hipermétropes 12 Pistas 2 Metoxi 2 Interactions 3 Peregrinaxe 1 Naturhistorichen 1 intelligibility 35 Localia 1 Gelijkheidswet 3 Incarville 1 lhis 1 muricatum 1 Macowsky 12 grandísimo 1 Kuda 1 FVNDAVIT 1 Lishi 1 Interamnæ 1 osley 3 incrustantes 1 inmovilistas 1 fén 11 Inclusive 2 instalaronse 1 Petushki 11 mormonismo 1 mirtilo 117 Fenerbahçe 2 insospechados 1 margiunatus 8 Gondel 19 melgacho 3 Lascano 1 giornale 4 mazonado 122 Jerome 1 Marrabios 1 fortificándoa 1 moravica 3 Naranjos 40 fonolóxica 1 Hotah 1 Krapanj 2 flexibilizou 1 Molineux 1 Ftía 2 hírpinos 6 nematicida 3 nipo 4 mach 19 Feita 16 Pelos 2 Kinen 1 Hilprecht 2 lisopina 16 Kangaroo 1 Hidalgos 1 Pilgerodendronsp 1 Gorska 2 industrializaron 2 Manziat 2 Ougarit 4 manosil 1 HEX 1 Gailleamh 2 Hoodia 1 peripetrosas 1 leucistica 51 MONFORTE 1 Fazer 5 frontista 1 muso 1 naríz 3 gardo 24 Illobre 1 Hydaburg 1 Kenéz 1 maturasa 1 kaidai 2 moleza 1 Hirschler 3 perifóvea 1 homoxenéiza 2 Karat 3 Maestri 1 Pagon 1 gammen 16 plastilina 2 interoceánica 1 gañóuse 1 Pappocom 1 LOSSKY 20 Iseo 1 Mapungubwe 1 memona 1 lacunoso 1 opola 2 Gravenhage 1 Ilina 1 Freepsum 1 hymenomycete 1 Jonnali 17 Nakayama 1 pirdunamu 6 Markgraf 40 Guixar 3 Mendive 1 hipergravidade 1 Neverender 1 focenoidinos 1 Lãnh 1 glicopiranosilo 1 pejerrey 7 heideggeriana 1 Handboldklubben 1 Offong 1 Mynyddoed 2 pisifera 1 gleisois 1 pideche 1 hydrolapathum 4 partiches 1 Novgodod 3 Fitness 1 paquetess 1 Paszek 848 mutacións 10 muselina 58 jours 1 kodeskrift 2 Gaillac 1 Giuntini 2 Pegaseo 3 Inmolación 1 Mutuavi 174 orquestras 13 Osório 1 Jobey 2 maneto 5 Modulo 1 fareros 7 NNE 1 orxe 2 Ospedaletto 1 Malaisse 1 Nadeje 1 occidene 4 Goražde 1 Pécour 1 Parraguez 1 mohafez 1 kupyati 1 independeentes 92 Lodeiro 1 Luxio 1 pelasxiotas 1 Gymnadenia 34 mergullarse 16 Gel 1 kervazoi 1 Kscd 1 glFrustum 1 Fouaga 4 Milene 1 Pirazinamida 2 kacha 1 fotosinteízan 1 pedintes 2 Himen 1 pararonse 1 Peigí 1 MILKWEED 1 Fenixanthes 1 kalapácsa 1 Gensbøl 5 jedi 1 ofreceríaselle 4 Meyjes 1 Mesogobio 1 Phurious 235 integrados 1 hipervizcaíno 1 Kinyanjui 16 GEF 1 heterotípico 1 KImageshop 2 grasas 1 Palaiologos 44 Kris 2 gravándose 1 Pedinomonas 1 Jaztabel 4 favoreceuse 1 Kingz 4 Morali 10 Paucituberculata 1 fusiláronse 2 fotodestrución 2 francia 1 Milijaš 1 onicocriptose 1 legerbenden 1 MacMurroughs 2 incierto 32 mein 1 Humanitatis 2 máiss 1 lincha 1 Kanata 30 madreselva 2 filantéreos 4 frottage 24 Nereida 4 Paleolítica 1 lonxitudades 37 Oitenta 1 Homoki 1 Huevohormigo 3 HBV 9 Osio 1 outeiriño 1 Kilbatchiche 2 Géovreisset 1 Panouillé 5 Kushner 1 moiré 2 Maleján 2 falsificaran 1 filólogas 1 Laxatón 1 Feitoria 3 Kotsylovskyi 4 Nesselrode 1 pimas 36 Olegario 6 Playboys 3 hispidulus 1 inórganica 1 Graduaríase 2 pértegas 42 Isócrates 1 Orbin 38 margarina 1 Lutherapia 2 Intentos 171 IF 159 Jung 17 llas 7 Grandón 1 obtou 2 maricultura 1 Mezzo 401 manto 1 Hantaro 2 Minamitakaki 1 LELL 1 Kaou 1 Itinerários 1 Kitz 1 Merarches 1 Montelouro 1 Gezeichneten 2 Lódz 1 Obyknovennaia 1 Montant 1 mycota 1 LATACZ 1 gestionadas 1 Gakhokidze 1 inconcebido 7 interdisciplinaria 231 Pimentel 1 flegrea 1 GIRÓN 2 Khayat 1 Monkel 19 obte 1 Magikarp 1 panificábel 1 incolas 2 Keesu 3 invito 2 maxilla 2 geno 1 munication 2 miserabili 1 Konráðs 1 peroneana 1 Kombuglu 1 Marijke 147 ficticia 1 pardaa 14 Gitana 1 phyllocalyx 1 LORAFNA 3 karimojong 1 orthós 1 hthon 1 Naseiros 1 Mingott 2 Janeen 5 Macfad 19 Fanse 1119 intervención 10 Nieuwe 1 palaio 2 Kaczynska 1 Pavlovi 8 Heavenly 10 Gazte 3 massimi 1 Fanafo 1 Nzongola 2 gaullistas 1 Hibic 2 PLANETA 1 incitouno 2 lid 1 Kordofana 1 lucinách 1 gravicional 1 Flamenquines 10 Moguel 1 Lúdica 1 palmitínico 1 occidentel 5 introducise 5 Multitarefa 51 otomás 7 incontroladas 1 northwestern 1 Habidos 3 fragmentan 1 Ferento 1 Lameirós 9 miño 1 mentrastos 1 messeji 1 Fusen 1 Olleris 5 Lyne 2 ipecacuana 1 KUBL 9 Meselson 6 forzadamente 2 MIGfx 1 informándolles 2 Orientalizante 1 Leucius 3 Folklórica 3 khasi 1 Nullartikel 1 Habasburgo 2 Limeres 1 Hermannia 12 Gotovina 1 manexará 2 Menakhem 1 memberos 2 Ohnevych 1 insultantes 1 Perushian 1 Gatesheadn 1 fiate 14 Marryat 1 Marquesiño 1 Kinshaha 1 FICOMATIC 5 palitos 1 Fronleichnamsspiele 4 †Obdurodon 1 Otce 1 nucleares— 1 Pimen 1 gosiute 2 Ourilhe 14 hibridar 8 Kulcsár 1 piece 1 Kuwayt 82 gravitación 29 heráldicas 1 felds 1 Pissevaches 1 Otostegia 4 pandanus 2 Kayl 4 Niumi 1 Iokea 1 Gallicano 11 minangkabau 13 oxyrinchus 1 Opalia 2 ópticamente 1 pintes 3 heterotróficos 1 Isyanov 1 Oriéntanse 2 indícano 1 hanap 2 glacies 7 Paese 3 Michaelisschule 459 ingreso 6 Maneo 1 Innervisions 3 hagenbecki 491 lúas 2 Museum de 1 Halyna 1 francíada 1 Fraternizade 3 Iroqueses 1 hefk 26 Origin 1 pandanifolium 1 Pamires 17 Forst 1 mambrana 1 GRAÇA 1 incipit 1 Nomads 4 marga 1 Lebida 1 Geometricae 1 Pávha 2 Lebork 1 Inupiats 1 FESA 4 Nordesía 1 mirásemos 1 Lasansky 1 Khare 7 Patricks 1 Magherau? 3 leiti 1 Intrasporangiaceae 1 lbéria 1 Importe 1 mordidos 1 hunu 1 Noroccidente 1 Forsch 2 otoción 1 perço 20 Hawker 1 Marràqueix 31 Pekín 1 Ojha 1 Hieratismo 1 goteiras 3 Glicoxenólise 1 n-x 1 Kueishanto 5 Lamoureux 1 Guitín 1 indignando 298 mediada 73 lat 1 Hva 4 Kovacec 1 gaule 1 peleiades 193 Irmáns 1 Fischerdorf 1 Fidelin 1 genuflexa 1 Oenotheraceae 1 imido 2 mantiñas 7 lacrosse 1 Lepidopygopsis 18 Kongo 3 forneiros 1 Kjærestefolkene 2 Huecas 1 fogoneiros 1 Nives 2 Orycterocetus 2 pentamáxico 1 Menell 20 Máxico 48 Noronha 1 overlooking 1 Narisawa 3 newsletter 8 Fuentearmegil 1 Jehad 1 Peitieus 1 Ndh 2 Mparntwe 28 Libreiros 1 Gratitud 2 Gwarzo 3 lolo 1 Limiñana 81 magnéticas 1 microrepetidores 1 massachusetts 2 Namor 1 grasse 3 maternelles 1 kohtia 1 Notranjski 2 Guadiervas 7 Mavrodiev 1 Höll 1 linatus 27 libris 1 Planexa 2 Mottets 39 fervendo 1 Fresquiños 3 Labial 9 Ingredientes 21 même 2 hidroxisilicato 1 Napthal 11 Nyos 1 nivelan 3 floreada 1 kmeny 1 Milyon 2 Ohuruogu 1 mútiplas 1 mastersiana 1 mixoxantofila 1 Lempaala 27 KCl 1 Lapugiu 2 Mandayo 1 Menesk 1 Matzenried 2 fotooxidación 1 Leibeigenschäfte 2 pedipalpo 1 Klucht 4 glucosinolatos 1 Flegón 4 Geada 1 Halonesos 2 pasiega 1 Improvisadores 1 Marsypianthes 38 Megatron 1 Módi 1 Filochistes 1 Nosterskären 1 ferriere 1 Janassa 1 Flather 9 irredutíbeis 1 Genshou 1 Guverich 1 Pedrazón 1 microcarrier 7 nabateo 1 Iguanid 7 gaditanos 3 Irreversible 1 Guermanika 16 Olivença 4 MarShon 2 Patois 1 Marmán 1 Heliogabálo 1 oxicodona 1 gagligna 1 Kitesurfing 1 Juveterranova 4 lateriflora 1 Merger 1 IBAF 378 Montaña 2 Mustacia 1 heinaaega 1 Massandra 3 Frickson 1 Planescape 50 Nathalie 1 inescusábel 1 Gargomon 1 Kemo 29 nim 2 Fiakermilli 3 Masarykovo 101 fosfoenolpiruvato 31 herdando 193 Grial 1 Momine 57 Libertador 1 impór 1 mvl 7 hanno 31 Gases 2 ordonnance 2 Kalicata 4 pertegueiro 1 Gling 1 Necropia 1 galeguizou 17 NASDAQ 11 Ferrándiz 1 Kondoma 1 mentale 16 Husayn 1 Pañolitos 1 interculturels 1 Iranischen 1 indicáronse 518 Muíño 1 nacionalradicais 4 Hymnen 4 Germanicus 1 gastrintestinal 1 Juhaël 1 phýllon 1 Fondoclaro 1 Oxoglutarato 2 Masarac 622 Ferreira 1 Olorunda 1 Ilargigorria 2 isoquinolina 1 hemiepífitas 2 Hamaland 2 Kliegel 5 Menkouande 7 pienso 1 fregue 1 funtamentais 1 figurations 2 Heartfield 7 Geel 1 Nipigon 998 Palma 1 Penetrantes 1 mendori 1 follaco 2 pallasi 1 Mordelles 2 libéré 1 mocidadee 1 Ischadia 14 Hester 6 plantea 49 maxistral 5 Malnikov 1 ocorreuselle 1 maquineros 24 instigado 1 Parándose 2 Ochánduri 1 Kovvur 1 Neska 3 Herda 2 guiarnos 10 Përmet 4 ISEB 3 Karamzín 1 mucche 1 ópata 1 Opgenoorth 1 hematopoyesis 1 Mortiño 1 LPPS 23 mielinización 1 novoneyriana 1 Flymon 7 Pacifismo 9 isoflavonoides 1 pirazmo 1 lebvou 1 Offenburg 1 ollón 1 Madeinox 3 Juvarra 1 multilamelares 86 goleada 1 perpedicular 1 Hamming 1 Hipotonía 1 paradojo 1 fent 1 Lobaqueiras 2 Karisma 1 Manek 22 Farben 1 pipo 1 Mangari 1 mong 3 Pivert 8 Molanes 1 Inao 1 ixilik 1 Laccifer 1 Palecznica 34 Maeztu 1 Karalludo 1 INU 1 Krásikov 3 Pettis 5 granulacións 5 marquesana 1 Namblo 1 Ódio 1 Junctional 19 Pelée 11 insculturas 1 neurodesenvolvemento 1 Paddatisu 1 pariculares 2 leandrii 1 inapertus 1 franquiste 6 OBRA 2 inspiráronlle 1 lenzol 2 mascletaes 4 Mallakastër 1 heteró 1 Kayin 1 Gröbner 177 Hampshire 26 línea 3 Kirkgate 2 Göyçay 1 Manupecten 2 OMCT 4 minador 1 Juniville 1 Metenabo 3 nidícolas 1 Fusheng 1 Margraves 2 Motoshi 2 omeiensis 20 inmensidade 1 Lampeão 22 fonoautógrafo 1 Luxenburgo 1 kleinasiatischen 25 motivados 1 Kavála 1 Neograf 2 fránces 1 Nottapon 14 micotoxinas 1 Khotinenko 7 McClurg 1 garánteselle 1 Favicon 1 ngujuarit 1 Greavsie 1 Lalaing 9 Mackey 1 HCOONa 5 kelp 12 musicólogos 1 Gyeongbok 3 Jesufrei 1 Pambasso 16 Gabriella 4 inmortalizouno 9 Montepulciano 1 medada 3 Pétrea 7 Patrimoniais 1 Mensonen 1 Inxeberga 2 Perameles 28 necesite 2 Galvache 1 malacum 1 mphatso 1 KUHN 1 granitizadas 4 idólatras 4 Leçon 2 pentonato 1 montone 387 Lousame 1 Mossurize 1 janai 13 Malló 6 Pikine 1 Losito 1 femtoamperio 1 plantula 8 Mehedinti 1 luteolum 6 Konstanty 1 Lexionaria 3 Loyes 111 pálido 1 Gumdag 3 malfunción 18 metilmalonil 195 funeral 1 pefr 1 fionmhar 197886 os 3 normativismo 45 imperfecta 1 Gausden 1 Kringsatt 3 fibromodulina 1 MundialDurante 1 Künne 1 Nøkkelost 2 legislativos 1 Ogenus 3 partout 22 joc 2 monocilíndrica 1 KLCs 3 Kanizsa 11 Pinol 2 matres 5 Helium 1 medievale 1 graffmani 5 Hoefflin 2 Horquilla 5 metada 1 Gemuño 2 incitaron 17 Naur 1 Ngeriungs 1 pingbienense 133 fuel 1 kvarteret 7 Hiparquía 1 Hazelle 6 Peltocephalus 7 pervertido 1 Ganrajya 3 Ormos 5 Giluhepa 1 Miens 26 iguanas 1 Manesse 8 Hyoscyamus 1 feocromocitomas 1 fragiferum 1 lentisca 6 igualaba 98 Numerosas 1 Guira 2 Ferilli 18 Moinhos 1 Jucainí 23 pandas 1 Lepontii 5 MUR 42 Llywarch 1 mediara 8 nauticas 1 payodharotsedhanipatacur?ita? 1 Pentastilo 1 Peterkin 1 intrè 1 Mosheim 1 NAPAP 3 informándolle 1 Phlyctidocarpeae 1 gargouilles 1 Iacuto 4 Ndi 1 fraticelli 2 Orbignya 1 Linyin 18 Janney 1 listeria 1 Myro 1 INTECO 1 Guyon 2 Pedrinhas 2 invasivetutorial 3 Objectif 5 ipratropio 1 fiço 4 Panique 8 Faxilde 21 Hispaniola 136 Olivia 1 iluminándose 1 Mielczarek 1 Hawthornden 1 Helical 3 Newmar 1 Guillaumet 25 Manda 1 Módico 1 partecontinental 1 Pimmaglione 1 Gaiseni 10 Gallocanta 1 Gobena 9 Montealto 5 lascada 1 fotofosforilacion 3 Pandicosa 8 noxenta 1 Naustio 1 hargravesi 2 Madin 2 garrotazos 10 NpHR 2 Lilio 2 Leontopolis 1 ffered 1 Guruvaar 1 lixouri 1 Losec 1 Grossert 1 Lullula 1 kädet 2 Morozova 4 inimaxinábeis 4 inclusa 8 grelladas 1 Octante 1 Laxelas 2 mancharía 379 garantir 1 organosulfuros 1 Leñero 1 Lensovet 31 Loa 1 Oacharena 1 Nationalepos 2 palme 1049 petróleo 8 Kath 6 FORMOSAT 14 plastoquinol 1 naturalist 18 hámsters 2 Gaudioso 24 fluorhídrico 1 magnificiencia 1 Lingüistica 2 mitográfica 1 Igan 1 Mallarte 1 Interpoñer 1 Hestina 1 Lonborg 57 Lavacolla 1 Pirehi 2 Palmers 2 Manciles 1 Pdhanë 1 Organicism 12 pelica 3 Lecointre 1 Hota 1 Gargia 1 kaínos 1 Harafix 2 Gurlukovich 1 flexiónao 2 lanzóns 3 piensas 8 Maurois 1 PLACUISTIS 5 Karkkila 21 Goat 1 Frapiccini 3 Higounet 1 Kenko 2 Outorgaronse 1 Markurells 11 odham 2 fotoorganótrofos 582 habilidade 2 Highwaymen 18 Occitana 4 incorecto 3 Ingwavuma 15 gemmata 44 Holandés 1 Juari 1 Fulop 1 Múridos 1 Marculesti 1 Iakttag 2 outorgáselle 1 Galatias 1 Netaniahu 4 Klimenko 1 gazulensis 2 Furinkazan 1 Mesothelium 25 IIª 1 Fehoul 82 honrar 1 Khaldias 1 Linzor 38 Milagrosa 1 KulturBornholm 1 inaxe 1 Kageno 21 Mullis 1 oriolo 2 Hydrostachyales 2 micronutrintes 2 logroi 1 macromeluclar 1 Infusoria 1 Goombas 15 neogramáticos 1 Lawns 1 Kouthiaba 11 Macarrón 1 Mudayyan 2 Malahayati 15 Freeze 1 Perturbando 15 lograrían 18 intercambiable 4 Grigg 117 Galatasaray 1 Ivashko 2 liceistes 5 gateway 988 orixinais 1 Madrasta 8 marquesiñas 2 laosianas 1 Occiedentis 1 Juliobona 2 Goras 11 GSK 502 lingüístico 1 menosprece 1 Flickering 1 laudabiliter 1 HDs 15 Neoburgo 1 glep 1 Isparkol 30 Jairo 2 palilleiras 1 Gœrres 1 laeg 50 Joana 5 loción 6 Mamoudzou 1 Myriounis 1 Keaw 1 felicisima 22 Maddox 1 Palinuroidea 1 perente 7 mudalo 3 Hindustani 2 Goldfarb 1 Maín 1 Mihhailova 3 Karadorde 3 miomorfos 2 Gärtner 1 Galdor 1 Inchándose 35 Harrington 3 Hakanen 3 imposibilitaría 1 gineceo 1 miraría 115 karate 16 Places 1 plânge 3 Kerkenes 1 kuckas 1 pardifolia 7 perceptivo 1 Kallima 11 Giannutri 1 Morfofonémico 2 Gañará 14 Keros 1 meletta 2 Neuroquinina 7 Kader 1 Kapakai 1 Huntigton 666 Inglés 1 ingenios 13 Perdeuse 1 Figaniere 10 Fangatau 1 GNRA 2 Huard 1 nehar 1 Ottob 9 Hannay 1 metall 2 imploraron 26 padroeiro 2 hadean 1 Naufragi 19 Fue 3 hermenéuticas 3 parcepunctata 4 Giugliano 1 Migliori 1 Hübeli 2 Joby 1 Hese 2 Perosillo 1 Karkaralinskaya 1 lacanismo 1 Molinicos 7 lamentables 6 Fortner 6 Nuchar 3 fecundacións 1 Jõao 1 Lelie 49 mieloma 1 LEALTAD 91 Malasia 2 Limpadoira 1 Higashimura 1 inmolada 1 hibridizción 1 Paleohispánica 3 Goltn 1 jerebiy 1 Hatüey 72 pavo 23 Gondaísque 2 Innúmeras 1 kníde 1 Mollali 3 Harré 8 Malemo 1 Književnost 1 Isikeli 83 fraxilidade 1 glaucofana 1 Guiccioli 1 Gaburiasu 1 Nastasha 2 hipercarotenemia 35 Nocardia 1 olgas 3 Mairead 2 heptnerni 1 movilizaron 2 fraguaron 5 physodes 329 masculinos 30 parécense 2 Nemipteridae 500 Padre 1 PELLICER 1 nagna 1 Langobardicarum 2 Panatenaico 2 Pisiris 1 mirnyja 1 Lamentin 1 Komtuan 1 Pärma 2 Jungjo 11 Hihifo 2 Gatte 3 Globes 2 geure 7 Fecal 1 Kambudxiya 3 Karmic 1 Ghaelg 2 Humer 1 Panamericanismo 1 melduva 1 Onuka 10 Kolchak 1 kalder 1 Loamnes 2 Nikol 4 Kokorin 3 majors 2 formouna 1 permañecese 1 fondío 25 Paradigma 1 maimiños 1 gústelle 1 femtómetros 2 Nuhassi 23 Madeline 1 Ólafr 1 myós 2 pesanteur 4 Marmancou 3 hver 2 Paleopalio 9 Ourizos 4 Physaleae 3 ICAD 4 Feicheng 1 Kováts 4 Fürbringer 1 Pallavolo 1 Nitwits 2 Filema 1 funcianaba 2 Lampson 1 magdalenensis 1 Obradovic 1 granducato 2 Luxford 1 MMAB 1 Phrygana 5 Hiberna 8 Metodología 2 Galteiros 1 majaretas 3 Kimchi 1 nié 2 fujin 1 Payn 2 Garizurieta 3 Moate 12 penoso 1 Iñaiki 2 madroños 1 oriotarras 2 morriha 15 Orona 3 fulión 7 Kween 34 Pinsk 2 oligoclasios 2 Federada 1 Monastic 21 iteración 1 Kubian 1 Marmaras 26 Karlovy 1 inventaou 2 Oftalmólogo 2 Ostern 1 GMx 3 grayana 2 Metab 1 patáxenos 13 melanoxylon 1 Maldives 11 galácticos 1 Makasete 1 Gontrand 2 insulten 1 Phato 2 lucecús 1 floríferas 4 Mikania 1 Nihiriya 5 molino 1 Frumenzio 3 manatus 2 Labairu 36 Maribor 1 Inopos 3 guateque 1 Gníomhartha 2 ovíxena 2 Ghada 9 Hadj 167 monárquico 393 ocuparon 50 longrightarrow 5 Hydrobates 1 gatve 11 hidroxenados 2 Péri 1 osé 2 Oviraptorosauria 5 lofotrocozoos 2 MUSLERA 8 levarono 2 Haink 1 Ozolagnia 1 lapidados 2 linnei 1 Ofión 1 Perdóame 29 grecolatina 1 Lilien 48 inmunoloxía 1 persane 1 Magnocaricetea 1 Ityopp 1 Impregnase 3 Mortenson 1 galicanista 1 nové 3 Maniabón 1 Niwanza 158 Marilyn 1 jærtegn 1 gresite 47 Jujuy 2 Gurak 2 pilidio 6 Markel 1 Jale 1 mascons 1 Hemenexildo 1 p?? 2 hudsonicus 78 instituíu 22 Montgat 1 Lysette 1 onveranderlyke 9 furanchos 5 Lithui 1 peregrinorum 1 ICCS 5 Lush 2 heredeira 2 maldiciron 2 Kankah 12 focenses 2 gullah 1 Pentheroscion 16 Jakarta 1 naxalita 2 Livarot 15 namoran 1 Mazapanes 4 Mistake 250 favorecer 1 phaasaa 2 Filoloxicamente 1 Morynzi 2 inobservábeis 4 jungla 1 Mimiroppu 1 macerans 2 ollear 1 pendúrano 1 Govuro 1 panares 1 Piloso 4 Junia 2 Pharsalia 1 Pidou 3 pharma 3 Norteamericanas 2 hectolitro 70 Investigaciones 1 Newitt 1 Fibrecrisán 1 jacker 2 idéticas 3 grapas 1 metilótrofo 27 introvertido 1 moitísmo 3 Paxareiro 1 Ishitsubute 60 Mabegondo 1 Krylayaty 1 HIKARI 1 oblongadas 1 iatrea 1 Leendert 1 MCT 2 Fortóns 2 landa 1 laboret 1 Levare 1 Fascismos 1 Jodz 31 imprime 3 Ferryman 3 Galleguismo 1 malaccamax 2 Katsuragui 2 McCarron 3 pátach 1 mioide 1 ittiologico 2 Paxalato 1 odós 1 palitoxina 3 konungs 12 intercalada 6 fariseo 14 ornitolóxica 47 Gormaz 35 morsas 128 Llano 1 Hipnótica 1 insolubridade 2 Huxtable 1 paraaminohipúrico 22 Mouhoun 3 Greenwald 1 Lytell 1 Kviesis 2 morgada 1 Fortios 1 Microscyllium 2 Kekkei 1 mingulirón 9 Lota 2 Llanura 17 obedecía 1 Hifiklub 1 Kamate 1 Périgaud 1 indumentarios 2 Himenio 1 Lasry 5 Penapurreira 3 ijul 1 ?Logroño? 2 incluíunas 80 irlandesas 11 fosfoproteína 3 herói 1 Phily 2 Loredana 1 identificao 38 hausa 4 gupos 1 Kakula 19 helenísticos 1 Libiofenicios 8 Inédito 2 montederramés 1 mîlo 1 Nordet 2 jograrón 1 Heliofísica 1 magnaticia 2 Lothal 1 Gradishta 3 levadeira 9 MLSTP 3 mantéñeno 1 icb 1 Landsker 1 McGorvey 1 imantados 29 LTR 3 Kimmage 1 inconvinte 2 pistoletazo 1 Lagostas 1 interrogadora 1 Multiprocesadora 3 Nagasu 1 Mausoleum 2 Gawar 1 imbricatarum 1 ñeok 1 logróu 1 obligarou 1 lÿmžÿmät 17 Martelli 1 Hemiterpenos 1 mingue 1 Illic 6 feirais 1 Liboff 1 nigrovaginata 3 Pacual 1 paxtúo 1 penetrarían 1 phenibut 1 nefs 1 Noblissima 1 Imposition 1 Kapstein 1 Kalevanponka 1 pelignias 2 mesaxe 1 manipúlase 12 ouvidos 2 interalveolar 1 garrapateros 2 instalásense 5 Garwood 2 mys 1 Härdarna 4 oxysporum 1 Myzus 7 Herbick 8 monstruos 1 Litewski 1 higrométrica 1 Incorría 1 Mimbela 1 Paraeremostachys 1 heredis 2 Motto 1 Hemistatere 1 Itinerari 1 Picto 2 Impetuoso 1 nelgunhas 1 nordanskogen 1 Oodate 1 liguïstico 1 Ginxi 57 Obrenovic 2 migraría 1 Fezzoli 3 monopolares 1 kFreeBSD 2 Hofra 3 fósese 1 húbris 1 monash 1 Penzias e Robert 1 Leque 1 pandectas 2 Merêa 31 Nadine 1 interétnico 1 Piska 4 Plántula 6 lexíbel 11 Felgueroso 3 mongoz 2 lampreia 189 permita 6 Liverani 1 natìo 1 glamourosas 23 Irène 1 Infusionsthierchen 6 Lóbulo 2 Fondant 1 Novemberrevolution 1 Pialan 22 Lúcio 1 multipropósico 1 Ggotpineun 17 grávase 1 Kamome 1 Imaxaghen 1 papovavirus 1 krascheninnikova 2 Perwer 4 Gadis 7 Gannon 3 pipi 1 Guaticea 1 NaeI 1 Kendirvi 364 Mesopotamia 2 madagascarensis 1 Palíndromos 1 Minan 1 gnel 1 Fujiki 1 Jabwelo 2 Greuze 5 mesenquimática 2 Marrot 1 Miskín 8 Jordison 12 molotov 4 Flensburger 1 Granà 1 paraxónicos 2 jesus 1 heben 6 Figline 1 Noez 1 Majnoun 1 maquetasatracciones 8 Pitu 11 Ouviaño 1 mólecula 14 homoerótica 115 Ítaca 8 novelos 1 Otonianos 1 MASwings 2 Majluta 2 fallarán 1 Khonanesta 1 notifican 1 Llanta 3 hysudricus 14 Forges 1 Mentiou 3 gastroduodenais 16 Lucho 1 Maclachlan 1 madhi 41 Hirt 1 filmi 1 Nesia 1 Hofheinz 1 Mosbach 2 petting 2 Nn 4 nervoso 146 hidrográfica 1 osprey 7 parvus 2 oventese 11 IFPI 4 Organ 3 overtime 1 lum 2 Ghorug 47 molla 1 obturando 4 nauruanos 3 imprudentemente 1 katynska 3 Infirmary 6 Foilebar 2 Phthinosuchidae 5 linneano 1 geomori 5 Mapuches 1 Hellendoorn 2 habilitaba 4 mêlée 1 Flechada 70 Josephine 1 oviformes 1 Hydraulic 1 gondwanateris 1 palmitoiltransferasa 1 Piagetella 1 musa??ar 18 ORS 5 galáns 1 hiljem 1 Offredo 1 niropekkho 5 Ghislaine 1 moldaviano 1 Lizaranzu 1 Hydrophiidae 1 pileck 1 Godinhaços 1 INTERDENTAL 12 farallóns 2 Ministère 1 fotó 4 ISRO 4 kaxalí 44 Garraf 1 Peyroles 1 Neosiliqua 1 MANUELA 3 pantorrillas 6 mercaptoetanol 3 Gliceraldehído 26 plasmodios 1 Motorcharge 1 Marumain 1 Friosende 1 Palero 1 Financiar 1 Fashi 1 Irsina 1 mmadíbulas 1 monomanancial 116 orixinarias 1 LEGR 1 Microfilia 2 Llort 1 MMDB 9 Gaunes 1 kHZ 12 Filípicas 1 gubérniia 3 migrara 1 Pallerola 8 Lipsi 1 imotpra 5 gant 1 Navigajiosi 1 Lazéchnikov 1 Meertakkig 21 financeiramente 2 MUREA 1 Fyfe 4 haloalcanos 1 Flickerman 43 Kama 4 Leong 1 Katolytska 1 Kattilapolkka 1 lidérao 13 hematocrito 3 Näfels 5 Màrtir 21 Komunista 2 limpábase 30 Filoctetes 4 Herreriano 4 Leitir 1 Orticaria 1 fougau 3 ingresará 1 meecijn 1 Håløyg 5 Pierrette 2 Pectis 35 HTC 2 Ozen 1 Njikoka 6 metalingüística 1 Hudayi 1 monasteriensis 1 nervaturas 2 gracillimus 15 maltratado 2 Nausica 1 Joerges 3 Gaspari 1 Kryner 2 moïades 1 parápodo 2 Otomangue 1 Othmar 6 Fontvieille 1 ouranós 2 mustard 7 Liberales 3 Pangasinan 2 Pfalzel 1 Grimmett 13828 mundo 10 Panamax 1 Pillage 1 Gongbù 5 Juveniles 1 Kosters 1 Motsumi 1 isomentol 1 PepePhone 1 koryphaîos 2 Labatts 4 Martinis 1 Mesturaba 1 Jezyk 1 narcexa 3 Otocyon 1 masca 1 Matiaso 1 Picaouro 1 Jelfa 1 Janza 65 KO 531 mármore 8 Mestro 261 galerías 4 meromícticos 1 Omertà 1 Maudsley 2 perk 1 Horain 1 femeininas 1 interpeciolares 1 fotoarkiv 1 MILANO 6 irrompen 8 montagui 2 Kiho 1 magomigue 4 Mfoundi 1 Hretha 6 Ousón 12 Indice 1 microcapsular 5 ibibio 4 Filharmoniker 1 Gurim 3 Husi 1 Mixomicetes 3 Lebreiros 4 hope 3 Monogamia 1 Kiyaw 2 micropoemario 1 monoshock 1 hidroxenótrofos 1 Petroschen 9 inflamábel 21 inactivado 6 Papeletas 1 Ogenos 2 nomal 214 Galizionario 2 Kuchka 6 instituía 1 jongens 4 liang 38 ínfero 3 Montmajour 1 pasiegos 64 muiñeira 22 Gelsenkirchen 1 Igarzabal 1 Guanganmen 1 mantemeto 3 ofreceríalle 3 Macrembolitissa 1 mentoniano 9 Guazú 5 Latinizado 45 Història 12 Patrona 2 ONPG 8 mareantes 1 Kelling 5 Hitchman 1 nucleófilas 6 fisiográficas 1 Hornjoserbšcina 4 Oar 1 Grzymowicz 6 Placeres 3 paresse 1 Leocarpus 1 imprimibeis 1 Käina 1 Oaken 9 NPC 15 Matsui 3 Hiruela 3 Owings 3 Glauberg 1 manantío 1 metaestabilidade 5 Mizushima 9 Funès 1 hypocistis foi 1 Pativilca 1 Grumento 1 Lopholatilus 1 Lagune 3 intercomprensión 1 Menteri 703 perdendo 2 kwetwor 2 particulars 2 godov 1 frutada 1 invítaa 6 MacLachlan 9 Kepulauan 1 LeBec 1 Kongoumon 1 Guangcai 1 perogi 22 idealización 1 fictile 1 Lechkhumiano 1 pdfTeX 2 korze 484 obrigou 1 havål 30 Peterborough 1 Jorat 4 Iran 17 penitentes 1 fixarase 2 Jiushao 9 llanto 2 Goeldi 5 Hagar 16 Lozoya 2 Firmín 1 Manakonako 3 Pirosmani 120 permanecía 1 Gasthof 15 Herriak 134 Hansen 2 numeroloxía 19 imágenes 1 Paepe 3 Guim 2 foam 1 Indexes 11 hits 5 Farida 1 kickapoo 1 OUSLI 3 Niutahi 1 Öndör 5 ganda 15 Looking 1 Mourigán 1 Muñeiz 2 Gemelli 1 Litovski 12 Pirkanmaa 2 Garcimartin 2 Liaison 1 Metarfa 3 ONa 1 mafafa 1 Mantíñano 1 neubauten 2 Havergal 1 licaon 2 persuadirdes 2 intercommunalité 1 Isoflavonas 1 karel 1 Hartfield 2 Magness 1 Marienma 190 Mileto 3 intrépidos 1 Hiem 1 mapinguari 1 Fatuiva 4 Kuancheng 110 Goldwyn 97 fundara 60 interrompe 47 Laurus 1 ocupámonos 7 Periandro 1 liquídase 6 Neuroblastoma 1 Pieté 2 Netík 1 gande 1 Fehl 2 Gimiendo 1 HVQ 1 osil 3 McQuesten 7 ner 2 miríadas 4 Jarrín 2 Oskemen 3 Ngola 11 Luweero 1 Frouzins 2 nilóticas 10 Langrage 161 nadar 3 Papeleta 1 Néné 12 Patrimonium 1 interacional 1 Gayest 1 Nakin 27 pinnípedes 1 microscaphis 6 Nenya 3 Goomer 2 Itamaracá 1 Juuru 1 Myrcianthes 1 Krailling 1 otakii 3 megaterio 1 Gyuri 3 Justiça 1 Iklin 1 Kumeliauskas 61 Mulhouse 1 indoeuropaikhós 428 North 1 Kauren 16 pegando 4 magyar 2 Hambledon 1 howeana 1 Kano?a 3 Laruns 2 Nasí 1 LijiangRiver 8 Hairspray 1 osDembos 1 palaa 7 Mainländer 1 invocábanse 2 PERFECTO 4 Heskett 21 importador 1 ignorasen 2 Palaverde 2 lr 1 Felonious 2 frústrase 166 IG 2 Favaro 2736 líder 1 Iivo 2 Licorne 1 negociala 1 gaston 48 Galdo 1 Kenicott 1 Kouza 1 phippsi 1 IBIS 1 Germânia 140 Hope 1 Okuwamon 1 habilitante 1 GGGCGG 2 neoarchean 1 Incerta 3 Miragaya 111 Jara 293 Neal 1 Guaranis 1 pectinasas 1 fériicos 1 meriní 1 Grahaganita 102 mananciais 1 mallotum 1 Penkelemes 2 Peuty 1 jasotze 1 Naveyra 3 peleíta 5 Mitroglou 3 Jaska 2 jugarán 2 Guimerans 1 Moussas 2 lxi 2 knayá? 7 hét 18 frenoloxía 2 Màlik 1 Percivalle 1 montiganum 1 máximoa 2 pisum 1 manchaban 12 Inválidos 1 fornecerme 4 Gleichen 1 Incitacións 1 Pissjaukova 2 Kärkinen 1 palimnológicos 1 Harro 1 Lemeshev 1 herrerai 2 Ndao 1 Malteses 1 Osafune 3 isoo 2 melario 1 miresgarria 1 morfologia 2 instituido 3 pápula 1 Kaho?olawe 3 Inadaptados 1 gymnoclada 2 OspE 1 interpostotectal 6 licantropía 64 indulto 2 Ortigueirés 2 Gaspariño 2 Larme 2 Isarena 1 Pesaduira 15 lembrados 4 pinadas 1 Mataku 10 organistas 1 Nuuausala 1 Mecisto 7 Lefeuvre 1 Lisaea 1 perguntoulle 1 Katsuki 2 feitiña 1 manterei 1 Lellingeria 1 Nibley 1 Inuttut 1 Picouzo 4 Hoyuelos 1 Mercocidades 3 Monciro 1 Horóscopo 2 Lexicón 1 Järpe 1 Mantíñanse 1 norische 1 oxálica 1 grammo 11 irromperon 5 Lochte 4 Nutka 7 Nemetobriga 6 Hemón 1 IceCube 1 pitu?y 10 Património 10 fecho 1 Onkaparinga 1 Gadouan 1 ideacións 1 Mirokarosu 1 nerol 1 Nefelómetro 1 genshokan 1 Parnopius 1 natty 1 Halleux 2 oligopolios 33 indivisible 1 Ornithomimiformes 1 Guntiñas 1 Mikat 1 fruxivismo 2 Kopitar 1 Nightline 1 irato 1 Mandoli 1 Houaita 13 Otománs 3 pá?a? 1 lancaresa 1 Jiabèi 1 hipertensina 2 Interrogativa 1 nonconformista 1 grafi 1 Istoric 1 munte 1 Greifzu 1 Mundruczó 6 labirínticos 2 impensábeis 1 multienzimático 1 Persoff 1 Lanta 5 Ornitología 4 filicariam 1 Galeshin 2 Nahuelito 1 perfílaa 1 Oakra 1 Mianuel 3 pele 1 Mahinady 1 misericordiæ 1 Grésivaudan 1 Foigny 7 Glanville 9 Guindos 2 Ocelum 1 feituqueira 1 mercredi 28 Ferlosio 1 orti 1 grandalesa 5 Microscopicamente 1 Minuetos 87 fol 1 Láuzara 1 hexafluoroisopropilideno 28 knockdown 1 gjashtë 7 Knott 17 Gibralfaro 2 Persien 1 Makbule 3 floridae 2 Fouche 1 Phunny 2 insulam 2 inflexo 2 Ped 3 Maisey 1 Mannhein 3 orc 3 paea 23 mostrara 3 inhumada 1 IIICencio 13 Oiseau 1 Höskuldur 2 Örjan 7 Loder 1 Matiᚠ2 Koufonisia 1 Oscenses 1 Frayed 16 Herce 37 Moog 2 internauta 7 Gruvel 1 ibus 1 Larvisión 1 Mesyats 1 Girabolhos 14 FDDI 6 malquerida 1 gerardo 1 Misrah 2 Mazdeísmo 54 Fórmanse 2 orotstsai 1 Larinov 1 Grypeswaldiae 1 Mazarrasa 20 fuscus 3 IMGT 1 pjek 1 mygu 7 Paises 22 Norn 1 Melhania 1 Irmanastro 1 Iahia 2 Fonsa 1 isomentona 1 Passetemps 2 ooir 1 Miokogia 4 Nilsiä 1 Francop 1 Hichem 4 hiperbóreos 1 Nibbur 4 Ondoher 4 Lanskaia 58 galáctico 1 Nifurzida 1 Neubaufahrzeug 1 GEE 1 hymenosepalus 18 impártese 1 Kodagu 14 inauguraron 2 gutata 1 Ozaka 1 Obrígase 3 FESGA 1 paranoïaques 1 oxitócico 9 malabares 1 Kurun 1 Ghearóid 1 guerrerista 1 florería 2 Neosho 1 Farako 1 FITO 30 leq 1 Losco 1 Lietz 4 Nerys 3 intraarticular 1 kasiyaman 1 Kainê 2 nabeiras 1 Jizn 1 kADû 1 limigantes 1 Medarex 1 gnieznienski 2 gladiosa 1 Ipanemas 1 Inserts 455 necesitan 14 mariñán 1 Limitándose 1 Genshiro 1 LTa 1 mañonés 127 Helsingin 1 laborieuse 3 iaea 2 Landschaftsverband 1 LOTRACA 28 frustrou 9 Fortec 1 LPSJ 4 pernyi 13 interveñan 2 holomorfas 10 Perxa 1 lentifica 1 Gahshigar 1 hittade 1 Hemodilución 1 pataches 1 Iniuria 13 Giggs 1 Lomoembaixadas 1 fracionada 3 Histology 1 Mozes 1 nervión 299 montañoso 7 neoxeno 168 obterse 1 perdermos 1 mudáronllo 1 mperdeftika 1 musicológica 1 Huafla 1 piliformes 1 milos 1 Llantones 2 Jok 11 imprevistas 5 oberturas 1 macrogrits 2 interpretamos 1 krev 1 Iniciáraa 2 Monsea 4 Merganetta 23 magros 2 Helmës 2 fillér 1 Ofici 1 Hilpert 1 lamotrigina 4 Ibón 1 INACCEPTABLE 1 kabud 1 hernieder 1 Mittellandkanal 1 Pacaciano 67 gobernaban 2 KayEss 1 Farem 1 Katzenzirkus 1 ngre 16 Metamorfose 1 pistiladas 1 Nersetes 1 Montrondo 3 gordiño 3 Metacafe 1 Lubbertszoon 15 Gave 1 Ilios 44 Mollicutes 1 fichalos 3 mixomatose 4 Iveland 1 Heitler 20 margas 1 Gândavo 7 Giwaku 2 pelícanos 12 Mysore 4 paucinervis 1 Fmilia 1 gravlaks 13 lipp 6 Gentalha 1 milionari 1 Lammerts 1 Kaduugix^ 43 Neva 1 Nuttalliellidae 2 Fürnberg 2 Gromaire 5 Kanzi 1 Kapustina 1 gregarina 2 oreodontes 1 ordinanda 19 LPI 2 Kárason 294 orgánico 2 Novokubansk 1 Ooki 1 orzamentada 1 Orzechowski 3 Footsteps 1 interrumpidas 1 impota 27 hidra 1 Jaškin 6 Kingfisher 27 Idol 1 motívano 1 Palladys 1 Herztier 29 Match 40 Mosport 1 Leidenaar 1 instalción 9 Hidrográfico 1 Orombi 3 lisérgico 5 melómanos 1 Mönckeberg 1 Keddie 1 implantándolle 4 Lukes 1 OSS 1 MacHeths 1 Oberheizer 1 Iiescu 1 Henarejos 286 herdeiros 1 Jondelius 2 Montado 1 Kihlaus 2 panamax 1 Gadabeeti 6 patovar 1 Pedruzo 1 Lampeter 31 Indicación 1 Kämpande 4 passant 1 ?jh? 1 oode 2 fritiran 1 Gropilor 1 Karamatsu 1 MacOSX 1 Jalsha 154 Falla 2 Mailand 2 Pennat 2 Myocastor 1 Göynücek 4 pamires 1 NEDD 1 Kolgujev 46 incrustacións 2 injurias 1599 parroquial 34 incendiado 17 Lampaza 152 otro 1 Menciónalle 2 Phop 1 Goëzman 11 Outorgóuselle 1 Interweconomía 69 Larsen 6 Intermunicipais 2 Flunipam 1 nêma 1 pacyati 1 Footnotes 4 Myoida 1 IBS 1 Owenbeg 3 intúese 1 oantigo 1 Gleize 8 Maniola 1 katsu 1 Nahasapeemapetilon 2 fdUMP 2 Libranet 1 Lektury 2 Kirchwerder 63 Latreille 1 Khvorova 1 Movéndose 1 Mandorla 1 gargallón 1 kca 42 Klagenfurt 3 Maradi 1 Forteguerri 1 interaxe 70 ferrolán 1 gransdes 1 obrigábanlle 3 kraken 3 Imaxina 3 pergrino 10 macroeconómico 1 inculcan 25 plasmáticos 3 Mija 47 pays 2 isomerizacións 1 pérda 1 Helênio 1 Hörby 7 Lates 1 Fusaiola 1 Marquesi 3 inscribía 3 Llorar 3 laricina 1 Orgánulo 1 Gormlie 3 kf 1 Heavies 1 Guorthigirn 1 Krunk 2 Marchihue 3 Incomprensión 259 legalmente 5 Leishmaníase 2 plastós 2 inmunobiolóxicos 1 opiniões 1 Huancapí 37 Palafox 13 inconstante 7 Paleólogos 2 fusiladitos 11 heterotriméricas 1 Moriglione 2 Palibrio 1 industriel 2 mén 1 foliopeza 1 Kuchibue 1 orión 17 Lun 6 fretas 13 Kfar 94 ferroviarios 1 Interrogada 1 kiroku 1 microlixeiros 1 kislás 1 Hummocky 1 Koidan 8 Gracq 1 glutarredoxina 1 Ovcz 1 Nijeradzé 3 femtogramo 1 picantel 1 Frinle 1 muffen 1 Oloferno 1 Japonolaeops 1 Futurewave 1 Orbaff 846 instituto 1 Ibeju 1 microanaeróbicos 28 Figueredo 1 Hinderböle 22 Nes 1 minoración 5 Hatoyama 49 Murallas 277 HOL 4 Hata 9 pedimento 2 Grindavík 692 Paco 1 mullerís 1 Inventors 3 Nexø 6 Gualdo 1 incontinente 1 Inó 44 muban 1 Ordalía 1 ficina 4 ordovician 1181 lonxe 1 Guillatún 1 Muellenhoff 4 Indore 5 Hobo 1 matérialiste 1 Iridáceas 1 Munga 5 incoación 1 Orsogna 1 ISOM 2 lampistaría 5 MWP 1 papyros 2 luogo 1 invertíveis 1 fruar 79 Immanuel 29 minorizadas 1 mutabile 1 Kahinu 3 focalízanse 1 Funsai 49 herdadas 2 Matmar 1 Gacira 82 pictórico 1 Gallblack 1 pidiulle 6 Obdulio 1 Mecchi 1 Jarafuel 1 ordénalles 2 Frække 5 Nichole 1 halífatu 2 Nicolosi 908 Palencia 2 Meritneit 1 Gualgano 2 Favola 4 Jarana 1 Fusilatuz 1 Faramana 1 Pertarito 1 Kennis 1 kreñv 1 octaedrita— 10 Gosen 1 Húsareyn 4 minga 1 Faroé 1 Nechâtel 20 Pitia 43 Molins 1 Paltin 1 Michincha 43 Midlands 1 Feteiras 1 Gymnomoneren 4 Harrisia 2 leaved 1 Ninlile 1 kvinnen 1 Jayeong 1 oclúe 1 Labarrère 20 forraxes 12 lucimento 1 Periastro 15 medrase 1 Gripo 9 MMS 1 oreas 115 motoras 3 Nazg 1 mteli 11 Habitual 9 Finolledo 2 Fisiologo 2 Kikki 1 Ferapontov 1 incensar 1 meterllela 2 Frink 1 limpiase 3 Kenzaburo 3 Groussard 41 patrocinou 1 Khalisioi 1 fixaronse 6 penduril 35 incluíanse 41 Parade 3 mesodérmico 6 Feola 2 Perelhal 1 Photosynthese 1 paraórticos 1 idEspacio 3 Líquidas 2 Koen 3 infidèle 2 nodulada 1 Perpendicularidade 1 Komura 1 Kapurush 1 PHotoEspaña 1 Petropoli 1 Kharabali 6 Longone 1 maritá 15 Lamparilla 1 manipulara 3 Fomiñá 6 Paguroideos 10 Freighter 1 padrenuestro 1 monguer 7 Fratello 4 IBD 2 Hungaresa 1 Olsalazina 713 pescozo 2 Nephilim 1 nipitella 2 Hexum 1 governance 2 GRUB 1 Megaphotocopie 2 Hiezu 505 Fondo 1 Hiperónimo 1 introduire 2 McCrae 3 lampreeiras 4 Infantev 1 Geniosporum 2 naufragan 1 micacita 15 mapudungun 51 Milicia 1 patadón 1 Guionne 5 GNZ 9 floreiros 9 Nua 1 makth 2 Grundlage 4 Klingenthal 16 Platon 2 Llorell 14 parainfluenza 1 Krusher 9 Jyesthadeva 1 lugarteninente 11 narratoloxía 1 fusulus 1 KSh 1 gràdh 1 Freidrich 1 Fazañas 2 Iokohama 10 Orhan 6 Hitchings 1 modernízanse 7 monomérico 1 KOIFMAN 1 Malachovicz 1 Orejudín 2 multipropiedad 2 Lebail 5 lotarías 2 Morgovejo 1 Gudillos 1 pizzarías 3 missing 2 Ordovicico 1 fragmentáronse 1 Oclofilia 5 Nguna 705 on 1 Galguduud 1 maioritarimante 3 Fasch 1 Litzén 1 Montserratina 1 Musiquinha 1 individus 1 Fuencubierta 1 Mamagal 1 Oxofosfinos 1 Mercaptopurine 5 Kotthaus 2 Icefield 2 Frotis 1 Holler 1 lét 1 Nelsestuen 1 Forschungshefte 2 Hoffenstein 1 macrosceles 1 Inmetro 4 Louvet 4 Fitos 1 metanarrativos 2 kurjuus 1 galilibro 11 Friedkin 1 inmunoreceptor 3 panamá 2 Griess 5 Mairos 1 meneh 1 Gordiñas 1 Nelarabina 1 Hjertén 2 galpinii 2 incriminala 1 Junji 10 Plantel 1 Hunghli 4 matres 2 mételle 1 gründliche 1 logarithmic 3 Kihoku 1 glipicanos 1 Graecum 2 Mekons 2 Oltina 1 kheer 1 piemontesización 10 Lograron 1 Oliventinos 1 orchidacea 1 Márcia 30 Merced 1 Fribergensis 1 forestado 2 IPAD 3 Nuc 1 Macarisiaceae 8 interrogarse 1 Olai 1 incitentes 2 Nietzche 1 Meledor 7 FedEx 56 fusións 1 Gartenlexikon 1 Kapsias 5 Leonidovich 1 Labeone 3 Gugliotta 1 Girt 2 Hupa 8 involucráronse 4 laosianos 4 pigóstilos 1 Panaghia 3 malvinense 1 Güven 1 igrexarios 2 Isomaltosa 4 Lemmings 27 Gea 1 Friões 6 inexpugnábel 2 Lemosin 2 felandrenos 1 Mancunian 1 MacKewen 3 perforaba 5 oligótrofos 1 imperatrix 2 kamo 1 KSAKUSTI 20 isoflavonas 2 Gerundio 7 Importacións 3 Ourselves 1 pírricas 26 Fitzroy 3 Glubb 3 Michavila 1 Panghorn 18 isotópica 1 guisen 1 kurro 25 inhibidora 1 Mongil 1 Ghiratsuka 1 Moreh 2 Nortecoope 1 Paisage 1 Minguillar 1 Houb 1 —Fredric 1 Pajareando 1 GazaImperio 2 Migenes 1 Humprey 5 monoteísmos 1 Mahasaranon 1 Hipocrateaceae 1 pechengos 1 instalanse 1 Geggis 1 pixacà 247 mudar 1 glosofrarínxeo 1 Petroquímicos 3 Lamu 4 Meats 5 Fillobal 1 lubelskie 3 Holliger 11 Indulta 3 Neverwhere 1 Hutnik 1 hulhangu 4 Mewtwo 31 Jodorowsky 1 Nudie 1 multimáxicas 14 Malmedy 3 lilac 1 Ferramonti 1 hoho 9 Osteíte 1 Kamakahonu 26 Lúculo 1 Königskindern 7 NOI 4 Khárkiv 2 Molarotto 2 Ínsuas 1 Juyol 1 Galaso 1 Fotografico 36 Huerga 2 Ottman 1 patícase 1 fötter 6 foia 1 MotherJones 221 fluviais 965 Guitiriz 2 Panóramica 1 Longing 1 Hereclean 80 Perla 1 Kenchela 1 mostrexada 3 multimedios 39 Panero 5 Macina 1 Ijira 2 oktou 28 incontrolada 1 Islandiae 4 Incerto 1 Panegiricus 28 Luang 1 Graxos 1 incomodáballe 4 Kinghorn 1 Khudig 1 Keser 1 paroxítonas 1 întîmpla 1 Kawalsky 1 odoodem 1 Morch 2 faltarían 3 Kerpen 1 Induca 1 mercándollo 1 homenaxeaban 1 guq 11 Kilkís 1 Occidentale 1 outros segmentos 1 Kongrat 1 Kharkharu 1 Kazuhito 1 Klesiella 1 Marto 1 Orcabella 4 Liebert 4 gangrenosa 1 Ketabe 1 justifier 1 Mueva 37 igualou 1 Iucas 1 Jubinal 7 Lucidio 1 navlinks 3 Gemeses 1 †Imocetus 1 Iovianus 1 Ooxika 4 Luck 4 peccatrice 4 Malilla 3 Grien 55 hipopótamos 1 Laurín 2 Omaya 1 gwenu 1 Hongcun 1 nitrosopumilales 1 immobilismo 3 Ohmios 1 magnifici 1 Nuesse 2 Iolano 158 fibroblastos 4 Fatality 1 ony 1 Irschen 1 kotoko 5 Leimer 2 Nigde 2 Oppel 1 Inoni 339 Keke 17 orzamentaria 1 Ghamana 324 fermosa 1 Koloss 1 Foozie 1 Motza 10 heredeiro 156 malestar 1 kitób 3 platonicamente 1 pelícual 1 Khak 4 Hankou 3 manurónico 1 owimos 1 leattade 1 mostrastes 3 Pancarta 1 Grall 1 lkwerre 1 Junak 1 Nimphaea 14 Mytishchi 1 Olobre 1 Ludoviciana 1 Peonil 12 landet 1 Hébertists 1 Iotvinxiano 1 Fjols 1 Parastichopus 2 INPN 6 humedecido 2 intrudución 1 Iduriaga 1 obrariamos 1 Lavandeiro 1 Perrinho 6 Lzzy 1 goras 42 pictóricos 7 fascismos 3 Maz 1 Ginty 1 individios 1 Micral 2 Kneževina 11 Oulego 10 Freeport 1 Forschungsprobleme 39 Futsal 2 Octha 5 lactamases 1 MILF 2 paneuropeos 1 Luttenberger 1 Orcómene 1 frecheiro 1 Florange 1 Pheofharan 88 filipino 1 Halimodendron 2188 fundado 1 internals 1 Isaccea 16 jp 1 mses 6 Piúgos 1 Mozárbez 36 paradoxalmente 1 Insomnis 12 Gascoña 1 nekro 1 Pirilampo 16 Picassent 2 Hiberniae 1 Galactocele 1 pendulifolia 1 Paumes 170 Page 1 metaestado 8 Maunga 1 Nollendorfplatz 274 Gustave 1 hendriki 1 gangrenados 1 Iliupersis 2 Petrochirus 6 Melastomataceae 1 nasutus 2 Grota 1 negoció 1 matsuiama 1 MERCEDE 1 Kurenev 2 Lombillo 1 Kittil 1 muscularizada 2 imbroglio 2 Panajachel 12 Nightwish 2 investigarán 1 kárate 11 IDR 1 Omanaito 1 oxinio 2 fotónica 2 Paeria 1 pencha 5 fracasaren 1 Morineau 4 innatista 3 lampinas 1 Madelaine 2 Ingonda 2 Peranzanes 6 Patitiri 3 Hicorius 5 interurbana 3 JO 1 Gwraig 1 joyeuse 1 fibrogastroscopia 1 Leucopetra 1 impressionas 1 Ofiolatría 5 Iraqi 4 PADs 1 magnesiiphilum 1 ludujemo 10 Parisina 218 isoformas 1 novembo 1 krappaSteud 2 Glebionis 1 Malnati 1 marcala 1 Jakobselv 1 Folgerø 9 inflúa 2 Ordovices 1 Ortucchio 59 mates 1 Piknikte 8 nyulnyulan 2 Insería 2 Pasteiros 1 Mirate 4 marquetería 1 Marciniszyn 1 o búlgaro 893 orientación 1 petaurista 1 insinúe 1 máikl 1 Innervación 1 gjumë 2 Margalla 1 Gondole 8 Laycoe 1 ordovícica 2 Gullah 7 Librero 2 Kraljevec 7 Lenine 2 Ghiacciai 2 Hogeschool 2 galeopitecos 1 IASSW 2 Patassé 2 Permisán 1 Morroquies 2 galactosas 3 Licópolis 2 gradulamente 1 Inedito 2 mutino 1 obedeceriamos 13 Houphouët 1 Hervilla 1 Hemofiltrados 2 Firehose 1 generationes 1 picolitros 1 Finiquitados 9 fíxo 2 Neorrealista 4 Fantastichini 2 fortalecela 3 Gudiashvili 1 ?I?mat 1 Papoúlias 1 Lhaviyani 1 Lorain 2 Pawnbroker 4 Mette 9 patris 3 Luxación 2 germinal 10 Libertade 73 OHG 1 granulita 13 ore 1 felicitábao 2 Monographies 4 Jauja 1 Minoritario 1 Mitilíni 2 Lavoslav 2 fantaisiste 3 Madonas 1 Galleciensis 5 Feist 1 Pawan 1 Pajaze 3 Levanta 3 miya 1 Moola 1 Khórtitsia 1 PBTC 2 Hoogmoed 1 Nercessian 3 Gelehrte 1 otrogaronlle 1 Manigild 1 Kuto 3 Nemeas 1 Lje 1 Glogów 1 hirundinella 28 Peyer 10 Mohenjo 1 Kummerow 1 Joshimatsu 9 Lempicka 2 Paróquia 1 fructum 1 NDMA 1 Mótega 2 Kurstin 1 Pisnulok 5 Pari 15 Panna 11 Onopordum 14 Neyra 1 Pileocalyx 59 Nong 5 IECAs 4 McAnally 21 Holzman 2 inundaciones 3 gard 1 filmalo 1 Hagström 1 larguísimos 1 Jubb 18 Nuwas 1 guenú 1 Fomich 1 Fyodorov 73 Legal 3 inmediantamente 132 Oregon 1 paremolóxica 49 inhabilitación 1 mielinopatía 1 Ioánnovich 2 oliba 1 Najeeb 2 FrancisWillughby 1 Francí 6 Padela 7 Leshan 2 Paulauskas 8 Framework 1 Groupon 8 Lanciani 3 Maternidades 1 Maisha 1 macracantha 1 Feh 1 Olíustöð 4 Lesteiro 1 penando 2 Havren 1 Multilaterais 1 Nilus 1 gesammten 1 metaenunciados 8 PDa 2 flavoencima 1 Invariablemente 10 orientable 1 micrtúbulo 3 italianista 1 nazional 1 Muliar 3 Nóvamente 1 Huiliches 3 Jien 2 perfuración 2 Milco 154 Motociclismo 1 Harutyun 13 laboralista 14 Piago 1 fomalmente 24 figuriñas 1 Finanza 101 palco 1 hellichten 2 jucundo 65 invitada 1 Montemiao 8 Fomoré 1 Lenrie 7 Jenni 1 Mércame 130 Pearson 1 inhumanamente 16 Hida 2 Marabillado 1 Nerakhoon 4 neandertalienses 6 Pàmias 2 Musti 1 Feschuk 1 Piri 8 Platforma 1 Perseverar 3 gyre 1 loureirosref 1 mineralóxico 1 Jourová 1 mataroneses 2 Neutre 1 NFTPD 3 Plauen 1 glabriflora 1 Peidró 1 Kidston 15 invitouno 1 Gazeem 1 geval 2 Phocoeninae 3 Garbiñe 1 Multisports 29 monoicas 1 loitarei 2 LsrR 5 gac 1 gàbia 43 ONCE 2 Ljare 1 paracronismo 1 Liemers 3 ficodnavirus 1 Parkhead 5 neko 1 Nios 3 iAfrika 1 Narratario 1 Mintieron 33 impresionar 2 Finike 1 Ingawa 2 Marisantzen 4 palangrillo 2 Hurden 1 fido 5 Oosterschelde 2 Outland 2 Guamés 6 Jopek 1 panserbia 1 Hypoglossoides 1 frikis 366 instancia 3 mazonada 5 Papoulias 1 manteñades 3 Krew 1 Nasabut 22 pelexando 1 pkg 6 pitch 147 mantéñense 1 Gbordzoe 1 legislaciones 2 Gwyrfai 1 Lepádidos 17 Micrococcus 1 phragmites 7 Newburgh 2 Operadoras 1 neuroinflamatorio 1 gryphos 36 Nuhase 1 Ninox 1 Gautel 1 forxándose 1 Litomyšl 8 héroïque 10 insistentes 1 Interaccion 1 indonésicas 2 niñeira 16 LaMarcus 1 Mirak 2 Lepidobotryaceae 3 Fondearon 1 Muku 1 Mechtrass 1 mushti 2 marzadas 1 Palmaa 60 Mejía 1 Lamswaarde 1 Ilhabela 1 Milanais 5 Korsholm 1 OBSECRO 7 homeomorfa 1 Mogti 56 Graduado 3 fasin 1 KSTP 1 Navarras 1 òneidos 1 grampalas 6 Mafi 1 Moamba 341 Loira 22 oncoxene 1 Knoevenagel 1 hobyot 1 Mitscher 11 Nacente 3 Frater 83 Perciformes 2 Hixem 2 ipsilateral 48 periderme 1 Kapanga 1 Litwack 1 nemigo 1 inhalatorio 2 Liebeslieder 1 oceanodromas 1 levitoni 1 hòrta 1 Faunas 700 negras 3 Miksa 2 Heartwood 199 Mel 1 Orác 3 fornecera 1 galactotrofusa 89 Gallardo 1 Gespritzt 2 Jikishin 5 pioxénicas 4 mercaba 1 maniféstasenos 1 PAMBRE 1 Larburu 5 Lugalbanda 1 Gorxal 3 multiplicara 2 Oprichnik 1 Muqáwama 4 Fritzlar 248 liberdades 6 Jaeckel 5 Lizewski 115 observouse 32 introdutorio 2 Fro 1 hoo 1 glcósido 3 infectaban 1 gacetillas 1 Informationstechnik 5 Maniu 1 morfolina 2 Gasamanes 1 Lagoras 1 Owyhee 1 kawésqar 1 Màbel 1 goteiro 48 Pintores 1 Halibut 1 habere 8 Lallement 1 novermbro 1 haloperoxidasas 3 Mulcair 6 Microchiroptera 6 Gravas 1 gitiónicos 2 impoñérselle 16 Filantrópica 2 liberándoo 1 mume 2 Kamenka 7 Lawler 1 Noméaselle 1 Paraxis 1 Kokkala 159 lipídicas 14 Latinidade 1 legare 2 Masiero 1 formu 4 inmunomodulación 1 Itrabo 2 Lvr 2 Inimabakesh 4 Gòtic 2 Literárias 2 Ondulatoria 1 madecassa 1 Gandillac 2 Malvís 5 Juruá 3 Manterse 1 Marafiano 2 iberorrománica 76 Fontela 1 owi 1 Myrkrahöfðinginn 1 máme 3 perdue 3 Hauch 5 Ibigawa 1 movrmentos 2 Gnomos 1 guziz 3 Mitrofan 1 multideportes 17 Memória 1 organomolécula 2 metasomo 7 Fotogrametría 2 Fuuin 1 Lichtenrade 2 festexalo 1 Ouffouédiékro 1 Fowydh 1 Hermanns 717 históricas 9 Gstaad 3 Pelecyphora 1 LLOM 1 Haploide 9 Muraenesox 2 KOFIC 150 organizaron 1 Peloton 1 intrumentistas 1 Lidstrom 4 Grecobactriano 311 lactosa 1 Muzzio 2 Fazendo 4 Itata 6 Inba 1 IRGM 2 Hollinger 2 lexikon 5 Mian 3 Hakalitz 1 Hints 1 Koolvis 3 Nesgo 1 Kusber 1 Kwanten 1 ial 1 FWIII 18 Laurasiatheria 89 Pidal 1 Natures 2 leão 1 Graveglia 1 Heteroherbiidae 80 gravitatorio 6 Neoimpresionismo 1 kris 1 lobuladass 3 Picaños 30 Lombardero 3 Imadate 1 Gubin 2 manufacturaba 1 Megapaloelodus 1 Pacienza 1 metalífera 1 Omniture 4 Hardeknut 255 invadir 1 Inanahihé 3 inodiol 1 hilliana 1 meradas 54 freado 3 McMillian 1 Naufrágio 12 IIB 8 Laniidae 2 Fubini 23 icebergs 1 Mashrito 1 panpsiquista 24 hall 4 olfatorio 2 Genomica 5 Kunrad 2 Palaemonentes 1 Maai 2 Ovimbundu 5 florón 1 Montañita 16 lucía 1 Macrostelia 1 fortgeschrittenen 1 Houba 24 Mégara 6 Multiculturalismo 1 placental 3 Indignádevos 1 Jehovah 1 lenocinio 3 Inaugurais 1 Leontocephalus 64 insoluble 6 Hiroe 21 Liberté 1 ordoviciano 9 Janina 1 Insónia 2 falling 1 Marañon 7 lords 407 Guevara 1 Jórsalaferð 7 imputacións 3 Pariente 37 Hóquei 1 glacera 7 Paterno 2 Okuriashi 1 Jórge 2 Peribleptos 1 pilicloruro 62 Maureen 3 mangiare 1 Kutejeku 18 plantaron 2 Infoga 4 implantables 24 glandulosa 5 Frage 1 pasionales 1 importalo 5 gzip 64 nucleosomas 3 Fröhlich 1 miyabei 1 Jumalan 1 Materializar 1 Improvisations 1 findos 1 Lambertz 1 Inactividade 4 Malzieu 2 Kolectivo 2 Josaleta 170 glicoproteínas 1 Pindemonte 1 Moerstraten 1 pecina 1 hacheros 2 Mezlocilina 1 Hakenbüchse 2 Penthoraceae 3 Königshausen 3 mediaren 1 Fontouria 3 Hwyl 1 minicampionato 1 Güres 1 periprostática 1 Inadvertida 1 nedocromil 1 Llende 1 Italienischen 9 Gazules 1 levítica 2 HONDARRIBIA 51 iranias 1 Permutou 1 Froha 1 ferriñas 1 musulmanica 1 kunne 1 Khroma 1 Iseijin 3 Indecisos 1 grítalle 68 papais 1 moralia 1 Goddodin 1 Opaeophacus 3 Læsø 5 Meigo 1 Paignton 1 menb 1 Limitone 1 Mhaoil 1 Panjang 2 heros 2 Mard 1 Klytch 1 Henvelidigez 1 intercambiano 2 kine 2 kudaki 1 Improvisatoren 56 Negrín 2 Olympiska 1 Mamouros 1 Gutxi 64 felinos 1 lloyd 2 photography 39 Oratorio 1 IOOC 2 Gureto 1 límnico 1 Nijnevartovsk 5 Més 1 Paróla 3 Magar 4 Innu 1 Mylod 12 Oreca 1 Lebenswerk 12 lobuliño 1 paixões 2 Halosimplex 1 McNew 1 k^ik^er 1 kilder 5 Novae 4 Marcharon 2 morión 5 fidxiana 1 Labirintulomicetos 50 Kharkiv 1 hexadequenal 3 pauluccii 1 Hoimo 1 Kalloc 1 Kudoa 209 Leandro 1 Kairosu 1 plantei 1 Javadzadeh 1 Faloulles 9 Gojo 5 libertarianismo 2 Matafelon 1 fiscalizou 2 lito 2 genet 1 Fontus 2 mummia 5 materializados 1 farinosum 8 intraflaxelar 1 Orikon 1 Kinbara 1 particularemente 9 Mendoia 1 galotaninas 1 Milanos 1 Nationalökonomie 16 Kagame 5 menorquino 1 Iginio 2 Mauriz 11 Kapchorwa 2 parete 14 Mendilibar 2 Frigia 3 Leonessa 21 Kakheti 3 Maximianus 4 incestuoso 11 Ogooue 2 macabeos 6 ordenes 6 Khelifa 1 Heterolamium 1 Neuroendocrinoloxía 19 gravedade 4 Geng 1 Nagorny 1 meghalayensis 7 karla 1 Haiboku 3 naši 6 Menu 5 intuíu 1 Isquis 1 Ispiker 4 Lancara 14 individualización 1 macacae 62 pincel 3 Nereis 3 Ghezzi 1 Kalatozishvili 2 Impressione 8 freaba 1 Philocrenaceae 2 monade 1 metahalinos 2 Pereiaslav 1 indépendantisme 34 Komai 1 Janovich 1 kronike 1 fushima 1 läck 1 Iabu 8 Martinazzo 12 incrustación 1 Nescidia 2 graban 1 MICHELLET 2 Finnian 1 Kollaps 1 Miljenovic 2 FILMOGRAPHY 1 Memorables 58 marketing 1 Fosc 1 Graubbden 33 Olivetti 10 obliqua 2 Fitoren 1 Montagnolo 1 Montoito 4 Inacabada 1 Kuusjoki 1 himenorrafia 5 Paguroidea 1 glc 1 Koutsky 2 longtemps 1 pandorina 4 KMPlayer 2 Neurofisina 1 jacuticus 1 flavissima 4 Maleïts 1 Helsingkronaspexet 2 finalizarase 1 myrae 61 GPCR 2957 frac 188 Nature 1 Infantizado 18 impartida 4 monistas 1 Kalipha 880 orixina 2 Humus 56 Mateos 1 masturbatoria 1 naturaies 4 Noisefest 1 Paximadha 1 Nabalco 1 finland 15 Habitante 6 Naja 2 liberalizador 1 Nuara 1 MacGillEathain 6 Pefferle 26 persuasión 1 martyrium 31 Petunia 1 Oldenzaal 2 Merkle 1 Parro 1 Kazajo 1 gwenenenn 1 Objecte 1 Outernational 1 haemastica 1 googlepages 1 Maycock 1 ionízanse 12 gobernará 7 Insuachán 7 Paton 1 hispanocaucásica 4 merozoíto 1 Nordkraft 1 Kantamu 1 Glicérico 2 Nere 255 nomea 1 Paphlagonias 1 Gleoudis 1 Malliot 13 ordénase 2 latir 15 figurada 1 plaisance 1 GIBBSBORO 1 Parquedelebro 3 Monnegre 8 gaurus 1 Mårlind 5 glutamilcisteína 23 goleadora 1 Greshman 1 ferendae 1 marinonascens 1 marchándo 1 obnoxiae 1 ginsburgi 1 Japalura 3 Montazeri 4 minne 3 marrom 1 Germanus 1 mirapakai 10 Gradiente 1 Menyanthes 2 Orlin 1 kant 1 Miani 1 obstinatos 2 metrolóxica 2 Inxectada 1 histolyticum 2 Metope 1 Pancrazi 1 moliñeira 10 hipóstila 1 Hovedbrannstasjonen 2 Nanllou 2 Leonídovich 1 Mirmonsef 3 Jublains 9 Gelashvili 6 Natan 260 goza 2 Finecke 1 Inscrito 1 pidschian 2 omnipotens 1 Llendequintá 2 monódicas 1 lanzárona 5 gabro 2 frotando 4 ostentárono 2 Garfagnana 1 Konoval 3 Malazitis 54 Hatch 1 Physiographiska 2 monge 1 piscatorias 2 motivouno 27 opositora 1 müstaqdir 1 Glynnis 1 lémola 1 Myrurgia 1 Okneys 2 Íyotake 1 Hiparqía 2 Mortero 2 Historyes 1 funffzehen 2 Millanes 1 luh 1 Medetsiz 1 Perillis 2 instándoos 1 grafouse 1 Montagné 1 pellucentibus 2 Pepephone 16 Hradec 1 Pelantaro 2 GLAS 2 Micolóxicas 1 korngadzim 2 Isakovic 1 militarizaban 1 †Morrillia 1 luou 2 llelas 12 maravillas 2 Grigorievich 1 Lyova 1 Mombaerts 1 Felnac 1 Joaquins 9 Muñeca 1 Krantzita 5 mitigando 1 Metafísico 6 pDCs 1 ocluídos 1 Magariño 1 Neusa 1 Mikkey 1 Kitchourian 3 Pitaco 1 Petting 1 Nerds 2 fitoestróxeno 15 obrigándoos 1 Fonogramas 1 Jewboy 1 Herrema 1 Meensel 2 Myslenice 9 pacendo 2 malamute 1 flameante 1 krynicki 1 LIBERDADE 1 Gräbe 1 planetmysql 9 Montagut 4 Meoni 3 Joliat 12 pasea 2 Ferrez 2 infrec 5 Olocau 1 OPAQ 1 Kisen 608 mantívose 1 Myslowice 1 Kulturkrampf 2 Microsporidios 3 mitólogo 38 incompletas 1 pelagonicus 142 pensado 1 metilciclopropeno 151 Orden 17 inmunidades 1 irrenunciabilidade 5 oncosferas 1 Papinio 2 passámos 1 latexados 3 Kodoe 2 macrorrhiza 1 Mállon 1 hokkienmee 2 Kelmis 3 Infografía 1 Nowodworski 1 mennino 1 Optimistique 11 Jónsson 1 Ghostbuster 8 forzándoa 2 nomeábano 1 Haggag 17 hiper 4 Persuasión 9 lávica 1 Navigaters 1 Ihnat 1 juto 34 investigan 1 Gohring 1 Hirosaqui 1 Indjilindji 1 Fortuniz 1 Hypnotoad 2 Pernet 1 Fhionain 1 Karula 3 Pelada 46 fragmentado 1 hemoglonbina 1 Neulovimye 10 fotografadas 1 Köchin 1 Kotogwanda 13 funículo 1 Foglino 9 Ligada 5 Petromyzontidae 1 Freyjugata 1 hitoria 1 Júr 2 Gülagaç 2 IBm 114 opositor 1 Kalicharan 2 Lamos 1 Irthes 1 Helén 116 inundación 3 Funcionais 1 immaginario 1 Naknek 1 felicem 4023 nunca 18 Munín 6 fototrofia 1 Köprübasi 1 originando 1 Herculine 2 organizándoos 8 integrábase 9 ostíolo 1 ItalyPuglia 9 kärlek 13 Placozoa 1 flocossus 12 mucilaxes 15 Maakonnavalitsus 2 Hanggi 1 Isaacszoon 3 Hayami 574 Liña 1 legalizábase 1 Lugarn 1 HPM 1 Guillow 2 MOLINA 3 Kaznyk 1 multiplicaría 4 institut 8 mutaxénica 1 Ondansetrona 63 Herodoto 1 íllao 1 Joquim 1 granuja 5 obtener 1 Guzamala 1 occhiello 3 Kuwashima 1 Mosti 1 Iniezione 6 Isherwood 2 lisoxénicas 1 Meetia 1 Ferraniacolor 7 Falto 20 libriño 1 Guteberg 43 lila 1 Lundia 1 Loda 1 Magetobriga 3 Gungnir 1 Michalon 22 Nazismo 1 perfeición 1 Ginuciai 3 Hipoglosinos 1 Maglie 2 Jassans 1 intrapolar 1 Liboton 8 lambendo 4 Once?ti 2 marciales 6 Perafita 2 neurosífilis 1 Lucht 1 Nadur 1 Iblussom 2 Nikolsky 1 nijesh 1 Goplo 1 paraná 1 Gaffurio 2 LibraryOfCongress 1 geogràfic 1 Fotoheterótrofo 2 limburguesa 5 hematose 3 petrificando 1 Otjiherero 1 kumdo 23 íntegramente 2 möte 1 Parçalanma 1 peraltés 20 moldeo 2 hê 1 Intrahepática 1 mastoideas 1 Parkkonen 1 placent 6 Isole 10 morfología 2 Halta 116 globulares 3 Formations 1 Hick 16 llorar 6 koryu 4 Louisiane 2 paxareco 53 paran 2 Massi 7 noruegos 1 Pitufar 9423 Para 1 Jii 11 Micromesistius 1 Hansetag 3 Johanniskirche 16 pannexinas 1 pedirávo 1 Meendo 1 Ouvriere 11614 Manuel 7 Integrados 1 Paramecio 4 Jutaí 4 PDIF 50 planalto 1 Monoftalmo 1 Ichó 1 Hesburger 2 Moneco 9 pilórica 5 Kanariya 1 litigado 3 nonámero 3 Hemostase 2 Pannetier 1 Nagorichino 1 frechada 1 Islamcevic 1 Maconochie 1 Kultzen 2 gondi 2 mimodramas 1 otokotachi 1 monilata 1 laguerraenlaantigüedad 1 HOMA 1 kilemanjaare 3 Ormaiztegi 1 Knezji 1 localNotas 1 leses 17 Medik 1 naxerense 1 Hurtere 12 lascaris 1 Incrementaríase 1 Ibaret 1 FLORÍSTICA 6 izquierdas 1 Javaloyas 1 Outfoxed 1 oscilas 1 Macsó 1 miúdass 4 linnaei 1 Pärttyli 2 Lavardin 1 Languet 1 Iheldo 1 farti 1 opisy 2 macrodon 3 Minkoff 2 Increíbles 1 infracta 2 Nikolov 38 Hobson 9 Muguerza 1 Ixii 9 Navallas 1 Miroslove?ti 1 habititantes 1 incrustans 1 funcionba 17 Huahine 1 Oovoo 1 Gravenmoer 2 Iqbal 2 piedadeosmo 3 Palama 1 Galeolemur 1 imi 1 IllinoisLeverett 1 Ideologien 3 Leitura 37 incrementaba 1 océnao 1 merceiros 1 Outórganlle 1 MLI 544 impresión 50 Gwyneth 1 ingegnere 2 ligaturas 1 Ladrús 14 Neoconcretismo 1 Omblivicus 1 Impostura 1 Marijampole 1 Luada 2 heptneri 1 forénsica 2 Follando 1 ozamento 7 pirosecuenciación 3 Pejë 1 goleo 1 metafases 3 Lycoris 8 Nimitz 1 Majona 1 Nitriansky 1 Granach 67 nationale 7 Festspiele 1 Netipert 1 percibes 1 Gbako 1 Inventouno 1 higginsii 199 móstrase 1 maturiedade 3 Parhon 12 lisar 1 Myeongryang 1 Olliia 2 isoalcanos 1 hansoku 2 Mxxx 1 norrland 1 Idí 1 împreuna 2 isomerizción 1 Itacos 5 pataqueira 35 glomerata 1 Kilchurn 22 funcionaría 1 mostrábao 1 gueti 2 Nalguns 1 platanistidos 2 Ichijo 3 Grochowski 1 Maleventum 33 Heliogábalo 1 Françisco 1 MacroMind 1 Limena 12 nazo 1 oenzas 1 Leonero 2 oxidadoras 1 Latran 1 Nomak 1 Kreislaufhormon 1 pentacampións 1 Galleri 3 faltoulle 1 Mûrissent 14 Pilote 1 liceísticas 8 Joensuun 1 infrinxiran 5 palinoloxía 22 Loves 1 fondamento 1 Guineée 1 métrologie 3 Jutlandia 1 paleográfico 1 Khallikan 33 Penacova 18 idae 1 Nesser 1 Granadera 1 Metanotiol 1 Nílson 17 Furado 1 Lepyrodiclis 3 Lamarosa 1805 filósofo 1 OSw 1 personificándose 22 mergullados 1 Oraniense 4 Gamsakhurdia 3 Pilotado 6 Gateshead 1 mizrahims 2 Palar 1 katholische 168 Genista 1 Kiplagat 1 gatillazo 1 Metsanurk 7 paratexto 1 heteroplasmia 6 Plati 1 Koidu 1 hidroximelatonina 1 Michler 2 HONO 1 Fauquié 5 Halas 1 Mashegu 1 Gienson 8 Meshkov 7 Kunlun 1 PADE 1 Hoplitomerycidae 6 marolo 12 Pendleton 1018 Padrón 62 Mezonzo 1 ourizados 6 jan 3 Fitchburg 1 Flateyjarhreppur 2 Hamacas 1 ommunications 1 iacere 2 monarchia 75 Hippocampus 4 Hidroxenofiláceas 7 Mattarella 2 personnalité 1 hucho 3 Hedberg 1 Fassardi 1 Franzi 1 oraasiat 1 LTTE 442 Jeff 1 misticidade 1 Máshreq 4 Husain 3 Leupold 1 meravelles 1 Jousilouli 15 Lick 5 lahars 3 gigante 8 lantionina 1 Hissatsuwaza 2 Perreau 8 Parlons 1 Ortorrómbica 2 Leucojum 1 Margary 3 Kourkouas 1 Lüdenscheid 1 Norweilemil 2 orzados 2 pavieira 1 khanjar 211 fito 1 nodosáuridos 2 Lufrei 2 PICC 3 investigalo 1 Minguín 6 Grez 6 furosemida 3 Parenti 8 Lacaci 2 Hoenicker 9 guego 1 figurativista 1 Megaloplancto 1 Lupercalia 3 opacidad 1 NADI 4 Molinas 1 Guardão 2 levantaos 1 Gigurtu 1 NBAPA 4 fuscescens 1 Nasrid 1 Hushållsost 1 Ilustran 4 Lop 1 pachorrento 3 planifolios 1 Neptunus 1 Kopfnerven 1 Horákovi 1 noLoop 3 Paea 2 fólleme 9 nobiliar 4 lamentan 1 libértanos 1 Klopoxid 1 perfluoroalcóxido 53 Montalegre 6 Filatova 1 Olávia… 4 Fentanes 1 Fraguouse 1 impreparado 1 Olivelawn 2 Khachadourian 6 Isley 4 Marvo 6 fonémico 1 olinda 2 Gelmini 1 Neménzo 1 Inceptivo 1 IMeira 1 inpirouse 1 Hepatico 1 Peloña 18 octano 1 MaL 1 Melsisi 7 Gozaba 1 Grigorevna 1 Ooda 177 larga 1 nascentium 11 Moen 1 kamanita 1 hospitalis 1 Melanges 1 Lotterman 1 pilotaria 2 hidroxenofiláceas 1 inserimos 1 Ichibi 1 Kaleikini 10 KZ 1 Mártin 2 Fallet 1 Gardunha 1 herborística 1 oreto 1 Lewington 2 Neram 1 Gyaros 236 Perderon 48 foino 1 Nunga 1 Grandvallet 1 Mugaldekoak 1 Landsburgh 1 Haemateína 2 hasídica 4 obligouno 1 Foetes 1 Misbehaves 1 Pheronema 2 Muzak 1 Monín 1 namaqua 1 manómetros 1 homodimeriza 2 liège 47 formidable 2 Nummelin 2 microminerais 161 impulsor 2 Neocodon 1 Gattico 1 metildopa 15 lamber 1 Kabarore 5 Ideáronse 20 iz 1 MCMXXXIV 1 Libassi 15 Joji 1 kazetaritza 1 LABRA 1 hesti 3 hausen 1 Meszaros 3 Forticula 1 Oaklee 2 Morirá 4 Hematócrito 1 Hilleroed 1 Mantoño 2 Montesdeoca 1 morfooxía 2 Hvammshreppur 2 Jabberwock 1 GdLL 1 gairi 1 intramembrana 1 —mediterránea 4 fenitoína 1 Opperman 2 intolerables 1 pedíaselle 1 Garzigliana 1 Gwilun 3 Leontina 1 Mikhi 1 Gokburi 26 Mondim 2 influe 1 Imembuí 2 Mouhamadou 4 Oita 1 LxxxLxxLxL 2 Nickson 23 plató 1 movimentada 4 insustentábel 54 fascículos 266 Mursilis 1 Permanecerán 3 Nimbostratus 1 Gilolo 2 Hercegovia 1 kwspub 10 horríbel 2 hundra 1 JungleMojyamon 1 Loxocalyx 2 otorgamiento 1 mesosaurios 2 Nonpareil 1 Iluminati 1 Leonides 6 ouverte 1 farbige 1 fenilacetileno 1 mendicorum 1 idilicamente 1 ozenzai 6 KIO 1 Nanaloricus 1 Nachträge 1 garala 1 mariarrosa 1 Oulli 1 Nitaia 140 Florencio 1 Feciales 1 parauretrais 2 Monthlery 1 hipoxicos 3 nidio 1 Gusteau 2 Mencionamos 18 melloraban 1 IrisFP 13 galvanización 10 Iraizoz 1 Fundear 8 Mandala 12 kin 2 hominini 2 Gaurhoth 1 Pelle 22 niñadas 1 gatoz 1 nervosus 1 padeceran 1 Lagranxianos 3 Kennel 1 hexadecanol 46 miocitos 1 Nfat 1 fantasmagórica 1 Hewick 752 lightgrey 1 Picadinha 3 Kicking 3 hata 189 lactato 1 isoprenois 9 Pescenio 2 GalpEnergia 1 nuautri 65 leñosas 2 Lebak 5 Palatinos 1 GÊNERO 1 Illiciales 1 obbstante 2 machucou 4 frealos 231 nacionalidades 1 pastaran 1 Filosofi 1 Goldwine 1 myrobalanos 3 Kalo 2 Lamparetes 20 palmito 1 Fontjaraba 1 Guáimaro 1 Ocnitei 36 Pin 1 Kiboo 1 Flavia e 1 incisum 2 MUSTANG 1 permanecia 1 Mariquiñas 3 Littlehampton 1 Gueshe 1 ga?ju? 2 Pandigueiro 1 Gracechurch 1 Follatos 1 patentiza 14 Himilcón 2 Plasmodesmo 1 Ganijosa 1 Madouni 1 Othanel 1 methylenetetrahydrofolic 1 omnai 1 Loanhead 1 Gasana 2 Gowin 35 Páx 1 Itui 1 Kurnewal 8 Mokuton 1 laaksoa 1 Letrínidos 3 Indigènes 1 Hontoba 1 Henseleit 2 felicitada 1 ii 24 Hel 1 Gaudry 4 Observamos 5 fixéronselle 3 Hatchan 4 Huitième 1 Huracanes 1 Kelulau 1 oíches 2 gloriós 1 Kitabi 1 Ngethe 1 kraij 1 Flateyjarbók 1 Hofner 2 Paratí 1 Pennina 1 NPHS 2 Islamar 10 garçon 1 hamam 1 JohnCalabrese 1 Parastarte 1 glicerofosfátidos 3 paracristalina 8 Huellas 1 Farsala 1 Ocuparía 2 fusionouna 1 Olginate 8 Niñóns 1 periodificación 41584 nos 18 identificábel 1 Numismatic 8 PCCh 1 itia 8 Hilal 131 Knight 3 leucogenys 6 Mulk 3 hibisco 1 Knulp 1 orgaizara 1 FIDELE 1 Hikon 1 methemoglobinemia 3 Mamers 1 Finto 1 Medinaveitia 1 Gwreiddiau 3 Malamute 3 Overhauser 21 hermana 1 Intersticial 154 Hubert 1 Nargó 1 Hjalteyri 1 Olecko 8 Jortikka 1 hairesis 2 fotolitoautótrofos 1 mamífeross 15 inconstitucionais 3 Horezu 2 Gamzigrad 2 genins 78 ON 1 Hérodias 25 Lagar 1 Kathoura 5 Moxos 1 Melanosuchus 1 Pelexan 1 makhadjires 1 JewelBeemon 1 Odonatos 1 Funahashi 12 ferroaliaxes 1 Jysk 5 groselleiras 1 Gobernacións 96 Ibrahim 3 llueva 1 Koord 17 Morrissey 1 jechelianum 1 nicobarés 2 penales 2 Koshien 3 lige 1 Fluoroalcano 1 gitans 9 incalculable 10 inverosímiles 1 Incurável 2 massacro 1 matsubarai 1 moschiferus 1 multialfabetizacións 5 fornecerlle 2 Ngatuny 1 hexadecámero 1 liofilizadas 2 Oakmont 26 melíferas 1 Oxyloma 2 Kilos 1 grampositiva 1 Osteuropäische 2 parvimaculata 3 Helgueras 7 patés 520 humor 7 gabros 3 patu 2 incompetitiva 10 ibuprofeno 3 Mihanovic 4 Nisyros 1 Kirimochi 8 Orúe 12 norske 1 kekluus 1 Gnattali 1 Naty 1 Lindell 1 Fukamaru 2 Laparoscopia 6 Manetti 1 Parta 1 MacGarry 13 IPCC 3 Necrofilia 69 mañán 1 Narlidere 1 obedezo 2 Girgis 2 mahr 1 maquisas 9 pirrois 1 FTTx 1 Namberguán 3 MEDIA 7 Maskelyne 1 Kaigyo 1 Pentazol 5 Guilfonxe 1 instars 6 kitsunetsuki 1 IFAB 1 Hemirhamphodon 3 Illou 1 Leptalix 1 fetival 1 Munisa 3 Fuma 161 Ille 1 hemifacial 3 gamblei 1 Iemej 1 Forrou 10 Homínido 1 Informantes 1 Kneer 1 Fioritures 1 Kibuuka 1 felicemque 1 Ictiogeografia 2 lagi 10 Merici 1 Gardonyi 25 heterónimo 2 limiti 1 habotantes 1 Framgång 20 Nobleza 3 Participaban 1 Józwik 3 Kattowitz 3 Keverich 2 Gobetti 112 Marguerite 1 Hedwiges 3 inh 1 Fleischner 1 meristemáticos 1 Henrque 15 nemertinos 3 Mazara 4 pasarlles 1 Früh 4 Mecânica 294 invasores 3 morcela 4 Oveto 1 Hidrussa 2 lisará 7 parisienne 4 Lechuza 99 Garza 1 Patrocinium 2 Orgullosamente 1 Hadxaifong 404 frontal 1 Income 25 Microstomus 1 Liswarta 1 Nius 15 piacentino 1 Levure 2 Goerler 1 Focara 1 Gwilavez 1 goteaba 1 Neihardt 2 Lukos 1 meldh 4 Lasiesta 140 liderar 1 maintenant 2 Nemureru 1 Kovarik 1 Foyers 1 Gboguhé 1 Ochazuke 46 fusiónase 4 fuliginosa 52 Mainz 1 Hochegger 12 Maniféstase 12 necrolóxica 1 nuristanesas 4 Liliane 1 Ilustrouse 3 Nieuwerkerk 2 Geboden 2 Lozi 1 heliográfico 2 Michahelles 1 Mustero 1 Montfaucon 4 Lindoro 2 Grandaux 1 mullar 1 komunikatzen 1 Glucksman 1 ordeala 2 Gemälde 1 Kaupert 1 Hollygrove 2 GasPak 1 Otadia 1 Kandinskyren 2 petalodontiformes 1 Morinigo 1 Kamagaia 1 Mataguerra 1 ISTOÉ 1 Gorordo 3 hed 2 mensen 1 Namotu 1 friquis 1 Maldições 3 Financieras 1 Mo?ca 2 Piange 1 Kirolgi 1 Lucoubus 3 ingria 1 marullu 1 ounga 1 Magadi 1 Planeadores 3 fosemos 5 marcadora 1 Hygienická 1 grotta 1 nazaríes 1 Marithiel 1 Kibish 3 Finster 1 Parta 2 Katundi 2 materializaron 1 Mucugê 1 patefaceret 1 Hysgjokaj 1 mastigacións 12 Jayavarman 1 gastronomíadas 1 mawlà 19 Giorgi 153 intolerancia 1 osixenases 1 HLR 4 Kärkölä 1 onderricht 16 Mentuhotep 1 Kusayla 1 inxértase 30 Mutantes 1 Pauwau 1 Kanawolo 4 Heliozoa 1 firmándose 1 Peeter 2 Jòrgi 1 Oulo 1 Planhoogenradia 3 ópalos 1 mandaya 1 fezer 31 intercambiables 2 frebreiro 1 Kearsage 6 HISPASAT 4 Hosey 13 Feathers 1 Gherghesti 1 Hörgslandshreppur 1 Mucrosquama 57 ordinarias 1 friður 74 Garcilaso 1 MRes 1 Gallinacées 1 plantsas 2 gramaticalizarse 3 Meão 7 inalámbrico 164 noces 1 Hvn 1 IOVIANVS 42 Feltrinelli 2 ofendeuno 1 hadaka 2 Hellbound 1 Feynsod 1 Kamemon 1 LaOtra 7 Hermite 1 Lysiosquilloidea 17 Manteñen 1 monoúmenos 15 LF 4 Ibelin 2 inanimadas 452 Jenson 1 Laeca 1 Nyctiphruretia 1 Lesnica 1 Jagic 1 peneirábanse 31 opóñense 1 Johnstons 1 Gölova 1 Newccastle 7 Halliche 2 Iglesiarrubia 4 Gmünder 101 Heaven 1 Lipinski 1 GEAS 3 Nemetatos 4 Obedecer 1 Hyosho 2 Magusaiai 1 mensurandarum 1 flâ 1 Fermain 1 iahrseit 1 oculocefalóxiras 17 Gaitán 2 Hermanni 1 Mudjêr 1 juglandis 1 Mihailovitch 14 guaguas 1 montederramesa 1 lanfrancoi 1 hierolóxica 2 Oravita 7 juan 2 Lefler 1 Lusofonías 1 Foofle 5 loculicida 1 îdos 1 Haskens 5 Lestrade 2 Mediopensionistas 1 O PLE polo 5 Mosonmagyaróvár 1 Ocellum 331 Nevada 1 Hindanu 1 freddo 2 Hipsters 2 mirakel 204 informativo 2 Kostazos 1 léxeos 1 plasmal 3233 natureza 5 fashion 1 mirades 2 Junjo 2 ORACLE 10 fotoeléctrica 103 padecen 18 Olesa 10 Igeldo 1 Hipokresia 1 mosche 1 fortificaba 1 Meframmutosis 1 jackii 1 Khazaran 1 pairamos 7 fuegos 1 Pcelice 1 frontons 1 KOO 2 FUFOSE 18 Mandarín 1 namag 1 horomoas 12 Fugger 2 motivaban 1 Iliciáceas 1 Pervomaiske 33 opinaba 2 HDM 4 Filtros 7 Huitfeldt 1 Pabaiskas 4 Luto 1 mineirales 1 Osvobodilna 1 gorski 3 Ismet 3 ICOMOS 1 ONDC 1 micrognatia 4 niners 2 Miragolf 1 parvipuncta 1 newe 2 glutmato 2 Ichthyologique 1 Kagoshimae 4 mégaron 6 nha 4702 municipal 1 Newendyke 5 metropolización 2 féculas 1 Googolplex 1 Janjiku 1 gnetófitas 2 Lomello 1 Gumbatei 1 Gradiscutta 1 misericòrdia 1 Linguistich 6 maculado 4 Fonteriz 1 inverneira 1 Helou 3 Garaño 19 Lorbé 8 Kw 2 hippurus 9 mataban 3 Montanges 1 pactase 2 Feuillet 1 Komandiry 3 Ortlieb 1 Pañafort 11 Napoleone 1 oprindelige 1 Percolatea 3 permitelle 1 pihalta 2387 galegos 5 Höchstädt 1 guaruja 1 Ludwika 1 golpearía 1 ondiñas 1 ? 1 Lavenson 6 Gancho 1 moreres 1 Forcella 2 Megamixes 1 muxidores 1 Logr 8 Hindmarsh 7 Mamoela 1 Norrtälje 2 MARISQUEO 3 ?Ficheiro 1 INDE 2 glutamilación 12 Maciste 1 pelópodos 2 Gélin 5 Mordechai 24 Moshe 2 Kutepov 1 merellä 1 frutose 14 Grundriss 1 Kettilmundson 1 imitaciones 1 Hypertragulidae 5 nodiflorum 1 Oestrymnicis 3 inflacionistas 23 MPlayer 2 foliis 1 interrumpeuse 1 gaussiano 1 Niulan 15 ofimática 2 laiábase 1 Lorier 1 íslenski 1 gouffres 4 gabonesa 1 morteros 7 Foundiougne 2 Iord 1 Kunc 2 Minin 1 Ouansa 1 Pict 1 Micropogonias 1 hospodars 1 mechar 7 martirizada 1 mntañosa 1 Gobessi 1 Malabeño 9 Íbico 2 Interesting 1 Hofminster 1 pentomino 1 Kathablepharis 1 Grafs 24 Pensando 1 itiro 1 luak 33 ferrovías 1 odaesanensis 1 Habitats 1 Inzigkofen 1 pesqueía 2 Finbar 1 Foka 2 monocristais 8 invadiren 1 Kiigalux^ 1 Listerine 1 medesimo 1 lexicostatistique 1 multilingüísmo 4 Interceltique 1 Ossonoba 2 Kajgavare 1 Pagats 1 mueso 1 Kimila 3 neptuniana 1 nozdrya 1 KuN 4 FBP 1 Hoji 1 Hongyan 1 Lesmas 1 miss 4 Petroglyph 1 masculinase 1 naylon 2 pelúcido 2 Otaola 1 Pentostatina 1 kontekstach 2 nomoi 5 Indignado 1 Mecanizaremos 1 Karanja 2 Memoiren 1 moraran 8 foliadas 5 numerarias 1 manneken 2 Oute 6 McFarlane 35 Gulías 1 pastoreio 1 masticatoria 1 Meitaro 2 nawab 1 ORTA 1 maroon 1 Hematíes 1 Hülshoff 9 Haroun 1 monitoreados 2 Mercantile 1 Fijii 1 Kusawa 2 Oxynaspididae 18 féretro 17 herdade 5 Noëlle 2 Pelleter 2 Nogaideli 1 Kenonic 1 Pinarnegrillo 62 Gall 6 nebuleta 1 Lusorama 15 Germanwings 1 fiaños 1 Impedits 1 Karneus 3 Linario 15 interrómpese 1 Kummelsjö 76 morir 1 honroulle 1 lár 1 impóndolles 2 microfluídos 1 Ortu 1 liros 7 pesebre 1 miliarius 1 hagíos 4 frondas 45 hipotensión 1 ninko 2 Joffrin 2 Miteita 1 kansei 8 glicolítico 1 outorgouselle 1 kapitán 1 mineal 1 LDUSTADIUM 1 Korahs 1 Pingar 243 Lancaster 1 Iacangelo 83 Hess 52 hidroavións 6 Morak 77 Multiterritorial 3 Furcraea 1 occer 2 Ferroviaris 7 lévaas 31 Fértil 26 Mídese 10 Odelay 1 Ghubra 18 molestos 1 Kenikénken 1 kaldo 1 fosforolíticas 5 genius 1 ocntrario 1 Fonterra 3 Meilá 1 groß 1 greiga 1 Gloriod 2 lembrarlle 1 GOLPLUS 1 Gangseo 3 Folco 7 Oxidorredución 1 Messagero 3 fiordos 1 Nittedøling 1 Motochika 1 nóg 2 Istaravxán 1 Kla 13 panteísmo 1 Guntzburg 1 parr 1 pahi 1 Itoshi 9 onsen 575 ían 1 HIRUNDO 1 halophilum 3 læra 2 Paragus 3 ofrecelo 1 Nypaceae 1 Jokoic 1 Nobonjad 2 Notícies 1 Oboler 1 KnowWonder 2 Paoa 1 palestrina 1 Kade 1 Gastropsetta 2 Paradanova 1 fitadas 1 Korvat 1 maharaxá 1 kosei 5 Forcadell 5 Kuh 1 neohistoricista 4 Glez 1 Naourski 2 paseíllo 4 Friestas 1 Pitkät 1 Odasi 6 Galato 1 Nichet 1 perdooulles 9 Mermaid 1 Meko 1 fendoscopia 1 kokanica 1 Ijsselstein 1 Patthama 1 Kalety 3 Numael 1 Heynh 1 Oshiokuri 2 matabas 1 Merom 1 Keppie 1 Kheraza 7 inmunoprecipitación 12 Melanoma 1 Leuchs 7 isotónica 1 oleifolia 2 Lavours 2 Gunnery 1 filodendros 1 penh 1 Metamacho 1 maldí 5 McCaughan 2 Lawgoch 5 liquidando 2 glutarredoxinas 3 Khudzhand 2 Madroñal 2 fumariáceas 1 OUtros 1 Gruszczynski 1 peroi 1 Midcourse 78 Namentres 1 Hidrotide 1 halógena 1 Papilionidae 3 Otakara 1 patinet 15 Metroloxía 1 HME 1 Garwin 30 feiticeira 1 inmunodominante 27 història 2 fhuil 3 Pengtoushan 587 Lucio 1 mucegaiul 1 hibernáculos 367 Moisés 1 Nesiller 2 Lofsöngur 4 Mbytes 8 Lophocebus 1 Hazem 2 Loholt 1 Gunjibidji 24 paleozoico 1 flamingas 5 Greig 1 hild 9 gastroduodenal 1 Pendencieiro 2 Occult 1 Natuna 1 Palanga 1 Gitanerías 1 Mýrdal 1 pequenio 1 lipes 4 Gabetti 1 Kapaau 3 kazh 1 Ilonggo 1 Listres 1 Kazmierski 1 Nanboku 7 Píos 33 internacionalista 2 juuvah 1 MÁV 1 hilum 1 Ingdesi 1 micorrízico 1 Mutinerie 1 Gouris 1 Lombrosso 36 Genus 1 Pawlenty 1 Notobránquidos 11 mesenquimáticas 1 opúxoselle 1 Hiyah 1 Fione 5 Itaipu 1 NASP 1 farémola 1 Harashi 1 péntalos 1 Graßmann 1 monxe Arnau 3 intrinsicamente 7 Marantaceae 3 Majerová 1 Izumbwe 16 Intouchables 1 Peritación 1 Headloss 7 parecíalle 7 Modificador 1 leks 15 imitaron 28 Orixinaria 11 filatélicos 3 fieramente 1 palermitanas 1 Kikwai 2 microcápsulas 1 HOM 2 mujiks 22 luxos 7 inocua 7 Levados 1 Gilduin 1 johanseni 2 Iscla 1 Interniertenzeitung 51 Freiburg 1 gasconismos 1 lilha 3 Olgas 1 Guranburu 2 homologué 1 Feldsee 1 Gannet 1 Mittelstand 11 feirdd 2 mandalos 1 Nemertodermata 8 livonia 4 natiña 1 laniger 1 Feride 1 fexe 10 Float 4 Lophiiformes 1 homofermentadores 1 Gedung 1 Grænlandssund 1 Homosexualité 1 Jikken 1 Peino 1 Lefere 1 miens 3 influyentes 1 Nacionalegu 2 Gratis 5 moneco 2 ornitolóxicos 1 Napaloni 22 Ombreiro 4 morpha 1 Männerpension 4 Meurs 1 Fuselaxe 240 Pilotos 63 Olímpica 59 loureiros 1 Ichita 8 gloriosas 2 oata 1 Goumenissa 3 hemerotecas 1 Piep 1 pañeras 3 Guézon 1 Ganatsekwyagon 1 papillifer 25 incorporaban 1 Heverlee 1 Lohse 3 Kirkup 1 grausino 28 impulsivo 3 Nagra 7 militarizada 3 Peth 1 Oricare 1 Negriño 109 Marítima 1 Iungas 2 Lucida 1 Pelures 1 Nininger 1 Khwarazm 1 Hipoxemia 15 Fortran 6 Maseira 98 Frentzen 1 Filiations 1 macrogliais 1 Kásás 3 Oben 3 Kiley 1 gwefus 1 Molossia 2 HdB 34 inanición 487 mediterránea 1 forrando 11 lunisolar 39 monticola 1 piqué 14 iberismo 3 peldaños 1 investigcións 1 melanopoda 11 Fixer 1 pertir 1 Hrusovany 1 Pierrefond 540 parada 1 Mefistófeles— 4 Liaodong 1 lechosa 1 Ifesa 2 Lorite 47 infusións 4 Melga 1 Ghirano 2 febrícula 6 FOA 14 Filosofia 1 habichuelas 3 header 1 interdentarios 2 fortalezan 1 Masochistes 1 kalbeti 1 kvarh 2 graciares 11 metelo 1 Hakioawa 1 marxaleses 1 obovoideo 2 Kajan 1 ininterrupta 2 Kagau 4 Melanophryniscus 1 LIVIO 9 idgá 1 Fishkill 1 metíalle 1 Negotiator 3 Jahanbakhsh 1 Grámea 1 Ooguimi 1 interlaced 1 Lüscherz 1 Jiangyou 4 Gaiteru 1 gouvernador 2 Hideharu 36 Kuro 6 oz 1 hx?k^u 2 Karimé 45 frescura 18 Linnaea 1 homotetrámera 1 hypocotylus 1 Gibraleon 2 gaioleiro 12 Fantástica 1 inestino 3 Irna 1 Ggandin 1 LaCouture 158 mollo 2 Monye 1 Goryeoguk 1 Penitenciais 9 garantiza 3 merecente 1 Ibsenism 4 Kamenny 2 Kabatina 293 Marca 1 NEGARE 1 Identícase 1 Kiwicha 10 Gioura 10 Gattaca 21 Klenze 1 Macar 2 gaoshan 3 Lateinisch 18 impregnación 13 muscarínicos 1 monoclámideas 1 Møllerstufossen 1 Meri?ani 4 Micheloni 35 levantados 3 Metapa 3 Kastner 8 ornear 1 Pegarlle 13 markgreen 13 Pilosa 1 GCR 1 Gürich 28 Felices 1 instantanemente 2 Guelaya 6 Moçambique 1 Marzilli 16 objetos 4 Mexelo 3 hedleyi 1 Peroxisoma 5 malfeitor 1 muxkarra 1 Invesitigación 95 Morán 1 Hexatrygonoidea 1 FENESTRA 47 German 1 glicirrizina 2 Phueng 15 Merseburg 1 Mivacurio 3 literalistas 7 moduladora 5 Highgate 2 Halò 49 fecais 1 Kenethlegk 4 Norstadt 1 Maroun 1 Filenis 34 Libertaria 1 Giannelli 1 greement 583 last 1 Fréval 8 FDD 1 odontoloxicamente 1 McVaugh 1 Kaltblut 13301 Francia 1 Germanborders 1 Küeni 10 paraguaias 1 meyeniana 1 fällt 2 legos 1 Pathio 1 Nylandtia 1 Moriizo 14 Male 1 modEncode 11 gardaría 1 hamvvedre 1 Neoarca 3 Nonino 156 macedonios 1 Hermini 1 masculinizadas 63 inquedanzas 1 paldamentum 15 McFadden 2 Merodak 112 perihelio 1 Lactima 1 Katara 1 magnetizando 1 Kolom 1 Mikhailichenko 10 Moy 7 Kostroma 2 pileni 10 Murénidos 1 Gitam 1 imadurez 6 Ladislaus 1 mantenso 1 liberalizados 21 impresionados 1 insistíndolles 13 Incorporated 1 Kozova 1 Mehal 10 minimizan 1 laetivirens 3 Hedl 67 pancreática 2 Kirioroshi 2 Merkerson 1 Garandela 1 mollea 2 Monsagro 2 Kobiet 1 Kulvinder 1 Irús 1 panjabiano 8 impedirá 1 Panambi 4 Howitt 3 gastrites 2 nudibranquio 1 osbeckiifolius 4 Morty 3 pérolas 4 FLB 1 Hotcakes 33 Pellegrino 1 inèdit 1 FICE 1 Lio 2 Kapllani 1 faran 5 intuitivas 2 Laukinis 1 Lansingerland 4 Grenn 1 Panas 3 Mohedas 1 Kanien 5 Mirar 1 Jaho 1 Fesceninos 2 khutbah 3 Kalininskaya 2 hranimyj 29 INDICATIVO 1 OklahomaHistology 1 mufassirun 1 intelligam 589 MC 1 malversador 6 orientales 21 Lacepède 13 Hungary 2 Jacobello 1 Kunsttopographie 6 Gorzów 1 microanxiopática 2 pigmentosum 1 furadeiras 1 FeardotCom 2 habitalas 1 nítica 1 Gutios 3 Oenococcus 5 Fana 8 pasei 1 Gesetzes 1 Fauqua 1 necesitaredes 1 Gandak 2 Kamuzu 1 gonadotrofinas 6 perseverar 1 Initia 3 Meerapfel 2 Folan 1 Jasson 1 Pigem 1 passeé 2 Ixcateco 1 Laiminga 2 incidirían 1 Ogadenia 4 Francamente 2 Pigmeos 6 Mühlhäusler 1 Kusuman 46 Parella 5 IFIP 1 organophilum 1 Molenbuur 1 ioxida 1 Musiquísimos 3 Leekens 1 Hodcott 2 Phosphatherium 1 GDZ 7 impóñense 3 Petticoat 11 Nini 34 Istoria 7 Llyr 1 Jerrry 15 monoplazas 6 fogatas 1 nevídimom 1 Hydrobiologia 20 melampus 2 inxeniería 1 Iníciana 24 Nagar 3 legendi 2 metafosfórico 354 monumental 16 Metastasio 4 Konopka 1 llegaba 1 luddita 1 Kooperativa 1 obvallata 1 Nigérienne 1 Fiskirir 1 Hidroxiproxesterona 10 Miniño 8 Goethals 2 maas 4 Ieu 4 manexador 1 Lumi 2 Lebow 1 Geere 1 Kelani 1 Gippeswic 2 Pincelo 1 Neorrenacentismo 1 orthoepeia 1 ligulada 1 marjalería 1 Fjallahreppur 4 Frroku 2 làr 1 Koloneias 1 Palka 83 medioambiental 3 nigriceps 3 Focal 1 Fenty 1 jany 1 imaxinándose 167 particularidade 1 Lottus 8 Plácida 4 Navona 164 gaitas 1 Insmouth 1 Papermac 6 item 1 hinchan 20 gastrónomo 61 pedían 5 Nauka 2 hodophilax 9 Higashiomi 3 pingües 7 Hashirama 1 papaios 3 Outgunned 1 Marrs 3 fenilpropan 1 Hongjian 1 neuropaciente 3 importen 1 MIKROPHACUS 1 inscricao 1 Pagliuca 2 Mioveni 1 MIMO 1 gravosa 3 Gústache 5 Leid 1 interista 1 Pertencendo 1 Mettlach 1 HOXA 1 manaxer 1 kere 6 Observable 3 koster 1 Incommunicado 1 Libertários 1 Heilbronner 10 Pilsudski 1 neurotransmisións 1 Koku 35 MO 17 microdominios 4 Lalitpur 1 hidrolisilato 6 Hepadnaviridae 1 Oncólito 96 Patrice 6 Milosz 2 Nenkin 2 integranse 4 Hingham 4 Lactación 4 internacionalidades 63 Palmou 41 habítana 1 Genevilliers 2 infindade 1 Olvar 1 ocípase 1 Kendeigh 1 inima 2 moradias 4 Genèse 1 Kompozycja 2 númerosas 1 Fundaríase 6 Haslam 4 Haemoproteidae 5 parranda 1 noguery 7 pei 2 Kakushite 352 hábitats 1 maige 1 Innisfree 1 matta 1 Hamatina 1 Fucecchio 1 guindándoo 1 Pholadacea 2 mulime 2 Kivilinna 44 namórase 2 Helicella 95 Nations 10 interpretase 2 fitoquímico 2 Imputados 2 hasme 1 Hoback 1 permanentecmente 5 Ganadores 1 papio 1 Knowth 1 Kuriyan 9 pegamentos 3 Noyal 1 Inuits 1 Mekuryut 1 Farcasesti 2 felos 26 pins 2 Gentofte 3 picaron 9 Frou 2 liviandad 1 oxiuros 2 flatulenta 4 interdits 6 Guaiana 1 Lapenna 47 Johnstone 8 Marano 3 Nowtilus 3 Leontopodium 1 †Oreodontoidea 3 Pašman 3 montábanse 1 metilsergida 52 haplotipos 1 Intervet 1 Leucade 1 macropodum 1 llauraor 1 Péhé 1 Mogege 1 LaFabrica 1 Feldmeth 1 paddae 1 Ophioscincus 1 OmpW 1 Ginglymostoma 1 PaRiS 142 live 4 mesozoic 6 gazpacho 1 musicaren 30 Geri 1 marqueado 1 kadæn 32 Gamal 2 Humiriaceae 1 himne 1 Luskentyre 199 Kepler 18 izquierda 13 fosilizadas 1 Hummelen 1 Nationalfeierdag 2 gustáballes 3 Norval 2 IGAFA 66 isocitrato 1 marmolistas 1 Gamenson 16 impulsaba 5 Perronet 30 interesan 1 HaMoshava 2 Fosgate 3 LORAN 1 Lindera 11 óblasts 1 fermaj 6 KRA 3 Gothel 42 guillotina 5 Iqueda 7 petroquímico 1 Lacadé 9 pineno 1 Fossilien 3 Maddaloni 2 Heur 4 leiperi 372 Obrero 1 oligomórficos 130 libérase 4 percorresen 16 HDZ 1 Olávia 1 Gurd 25 Moniz 1 Metalurgica 14 maná 1 Pannonios 1 Forrenta 1 Lucja 1 pemyi 1 oEMMsf 2 Ijaye 1 Kurtbogan 5 Finitude 7 hundred 2 Koskenlaskijan 8 ocultada 1 Inspeccionan 3 fermentaba 2 intercambiándoo 1 leiho 1 foraminal 1 foan 53 Hermenegildo 1 guójia 1 lernen 1 Kipot 2 Fatals 3 Muzika 3 Hveragerði 1 Monárquicas 3 Iriano 1 kitaguchi 1 ortuguesa 1 longneck 1 perarcuatus 1 pipixcan 1 metilamida 3 Gurabo 13 Mação 1 Georgslied 3 pelasgo 203 Inicio 2 Lerezana 2 Lúcuma 64 Matrimonio 1 Inaguración 19 infatigable 3 interromperan 1 Lavocat 1 persuadíao 1 Nduindui 1 Marplot 1 Leptomyxa 4 matre 1 hocicio 3 Investíganse 1 Philotrox† 2 Marabo 1 Întemeietorul 6 fétido 2 isomerízanse 1 Kretzschmar 3 moupinensis 1 istoriia 7 Mbini 8 Pateira 4 marza 1 Juyá 1 Mochokidae 4 Mafeking 3 Ilim 1 Motufoua 3 Guarducci 1 hørg 6 galileos 4 Kambei 16 Katyn 3 Ingman 3 Kalamu 708 Laura 1 pairos 1 Novorcherkassk 1 outrabanda 2 martelar 1 intrahospitalaria 12 Juanfran 1 miricáceas 2 kowalewskii 1 Mendian 2 líf 2 Insieme 23 involucro 4 microvasculares 3 laten 3 piranosil 2 fenestrada 6 Gardarríos 6 noria 1 Gerges 1 Noblet 3 intimidad 2 Luceiro 1 homoenxertos 27 Oín 1 Hantavírus 1 knyttet 1 Imrédy 1 Halfnonagon 1 Isolane 13 hixiénicos 5 penden 1 Lifesblood 3 Nordhausen 10 Friedland 1 Krraba 2 oucalito 32 Palatina 1 Muzi 3 monocálcico 28 Gower 1 Impersonal 2 Khalili 3 Kencho 1 Monduengo 1 ostreiros 1 pentanucleótido 2 Lsta 1 fulxir 1 piridínicos 1 Laskers 2 Ilustrei 1 Giteranyi 1 Pecorar 10 Pasatiempo 2 Leobotes 7 Ochaita 6 Judkins 2 Lucullanum 1 maculiforme 1 mimedes 5 intensificaba 1 LNE 10 Lukasz 1 Kokhand 1 Kooler 1 Lobbæk 1 manju 1 Nabais 1 Nadym 1 metateatrais 15 Hab 8 linezolid 2 Pelekai 11 Heyer 1 Haiao 3 pilonos 2 Middleveld 1 Kotche 1 kafala 1 Lacumbe 10 Phillippe 1 Mandiola 1 Graß 2 Furnila 1 Partíuseme 33 Hialeah 1 Gavrilovskoye 11 Peronismo 1 Langewiesche 1 Pinošeni 9 jets 2 Frautschi 1 Kadada 2 lisinúrica 1 Megalastrum 1 gymnota 2 matemos 2 Leevend 2 Oomicota 1 Nesse 1 ligniperda 1 Fredrikshald 1 Kongi 3 Ganzourgou 1 neth 8 Langella 2 modelízanse 5 Feydeau 1 Novemail 1 Garesbidea 3 malquerenza 1 longueza 2 Gossamer 1 Invaden 1 Normanni 1 nonaria 2 gutturalis 1 fronstipicio 1 notation 33 fervido 1 hita 1 Nsinze 4 momos 1 Pholadomyidae 1 Jönck 1 Melnitz 2 Instalar 1 Guriscasdo 3 motti 1 monooxixenación 2 heol 4 multímetro 1 FAVB 1 ghiarmi 1 Perversos 5 Oliana 1 Ikwuano 2 Irmandamento 5 Picavea 1 JVAN 1 Picromomyidae 1 ideacionais 2 Guarico 1 Kallah 6 inventouno 1 obxetivado 51 Muertos 4 inxustificadamente 2 mencionen 2 Heteralepadidae 1 Gricignano 2 kurzer 745 Nico 3 ghato 233 Meca 1 louzana 1 Kaizou 1 ngare 1 paséase 5 pentarradial 1 iniciarce 3 lacrado 9 Neeskens 1 Oyuki 1 Munoa 1 Gautrier 35 gálatas 1 píceas 21 Parrote 1 Luciferidae 2 lauroide 1 Miroculis 1 hipnotizan 1 Grangea 3 Hainault 14 manés 1 obeshyau 1 olvidaban 1 pedicellaris 9 médiéval 1 harubang 15 Leksands 1 Gassama 3 mucronatum 52 Pinkerton 1 jellies 6 Nighthawk 75 gañadas 1 Melaniparus 1 mercis 1 pjesme 2 gustas 2 MODELO 1 Jimador 1 Nietzscbe 101 lido 5 INEC 1 Gweirfyl 1 kumamotonense 5 odiosas 1 hastigt 1 Petiot 1 inhabilitara 1 Gerima 11 Greece 1 Patrocina 3 partiredes 1 itremensis 1 Pijama 2 Miralbueno 1 Italiensk 1 levadeiro 2 Jachmann 1 genkendelighed 2 lobeto 1 melchor 121 múltiplos 1 Kampmann 5 microtubular 23 Mágica 3 fis 1 híper 1 leudante 1 inconcevable 1 megaherbívoros 1 Futuroscope 10 Forli 2 Ódiame 505 parecido 1 hoernesii 4 Lambaesis 20 Ganador 1 marroco 1 Lokayata 80 nocivos 1 ISZ 3 Ignición 1 Hetep 1 Iberagentes 1 Oniscoidea 1 garvieae 1 PCMD 1 organízanelle 1 gänzlich 1 krepidoma 1 Mexamormo 1 Mly 3 Intégrana 2 Hyracida 9 micronemas 1 Panchi 1 plasmadora 2 Flatfish 1 Mošna 9 module 1 Maqellara 2 Ofrendas 2 Landrecies 2 jê 1 Karabulaken 1 Interte 1 glava 7 Parchís 2 kibdéza 7 irrespectuoso 2 Madri 4 OSVVIO 7 Noshiro 4 Nue 2 mäkcen 12 pentatónica 3 Frailea 1 onesta 1 Johnsgard 4 intepretada 2 Gabble 1 Hallmark 3 Incrustación 1 pfannkucken 1 Pararexemento 6 Maltin 2 Navaho 1 IGR 1 Öxará 11 maquía 10 Marchesa 2 Lateinschule 1 jmorata 2 Mastanabal 1 Iaosi 1 müllerianas 1 NaturaLista 1 frecuentadoas 2 guardas 1 Obeso 1 MRf 1 Olvídate 4 Pawtucket 1 Munnik 114 Kaunas 1 leváronnse 1 Fornecéronse 1 Gatu 3 Mikio 9 filigranas 1 m?¯a? 1 insulinoterapia 33 petrolíferas 1 MCMV 2 maniática 1 Notocacteae 1 mandinka 17 llibre 3 Mogois 1 oligyrtia 7 infatigábel 25 gu 1 grando 4 Impo 2 juro 5 Nanak 1 Huro 2 Fredrikshamn 1 mayat 1 Mirjo 68 Gambier 1 Herrljunga 3 Kruspe 19 Mornington 1 nanobiotecnolóxica 1 librarlo 8 Higo 17 palillos 3 Ohwi 1 percuten 11 homocigose 1 neorrenacemento 6 Irrati 1 literatrura 2 oye 31 Photoshop 13 nervadas 2 odontoblástico 2 Gueye 14 Padrós 5 Operado 1 permítanlle 1 Hatsui 3 flavónicos 11 Mo 1 furriqueira 3 nGall 2 Itinerantes 1 Odyssées 1 Halliotis 3 Phylogenetic 1 Harmane?ti 1 Northumbia 1 Metieres 1 Gallopade 3 Lancelotti 1 houenon 1 Oane 3 Höfn 1 Gorpley 1 Maenam 1 Matronas 1 Orixinamente 1 Nikkaluokta 1 hongkongense 2 kapok 1 koreshiki 13 multiuso 302 interino 3 Lorengar 1 Luget 135 favorita 1 inmemorialmente 10 formaliza 1 LABORARE 5 Kilburn 1 Pavetta 5 Newington 2 jawidan 1 Matsoukas 3 Juarbe 1 mustaceus 5 Ortosia 1 Haral 1 Gruiu 1 Nariz grande 1 Geimu 388 gránulos 3 Leavesden 4 Fletch 1 Kotzé 2 Ipsen 5 Furt 1 HABUI 3 PEREIRA 1 Paternotre 1 Labanakt 1 nicapan 9 Leica 2 madrigales 1 Hele?teni 1 fortius 1 LXdetalles 1 gandi 1 Gudhraedslunnar 1 Hailiang 4 interpretables 1 laboraba 20 Mošovce 25 Mascareñas 2 Mckee 1 linfoplasmocitoides 87 manteña 80 Kami 1 Leontium 2 Morfoxénese 1 gHz 2 Ketzer 3 Historía 5 Gorter 1 Kristuslegender 3 Martiis 23 Joanot 1 innân 3 penlas 1 Marcellinus 1 Genesende 17 Paraño 1 gadovii 1 nuestre 2 Gretna 1 Neotanygastrella 2 holm 1 k?w?l 18 lettres 8 ferretería 1 paiolo 1 Gwillimia 1 Monosacáridos 5 intercambiáronse 1 lycopolitano 2 Numicio 1 Mazra 3 neumas 4 Hast 1 gccRcc 1 Fompedraza 3 Geba 2 metillitio 2 Nightly 1 Havaran 2 Hussa 1 Maeso 1 Oftringen 1 FEOPE 1 galindio 1 intracellulare 1 orofecal 1 Kaved 1 Merwilla 1 Meißner 1 Fátt 4 Flaws 25 Maioría 1 Helmreich 1 Gedko 1 Mung 1 Lasarre 1 forEach 23 Pawa 4 NREM 3 Jagten 4 Muffin 4 pictorialistas 1 Gavillon 1 Lelewela 1 farver 4 Leirón 1 Fuches 1 LemnaTrisulca 2 mesturarían 2 mackerel 1 Hogeboon 546 Georg 6 gozaría 1 mystacium 1 Kodo 1 Ostfriesen 4 Manuhangi 1 folistatina 1 merecerá 2 Musur 3 Levodopa 2 korax 2 peneque 1 Nyaromon 2 piscos 2 levedado 17 madrigal 1 ortografados 5 optimizando 4 Panoramic 1 Iselín 1 Macroglosia 1 —Libro— 7 Pholiota 1 importane 1 marzipã 1 Hagon 2 madiante 1 Fómeque 2 organiación 23 pagarse 32 Merleau 7 noster 1 Integróuselle 1 Naukati 21 irreversíbel 2 grooming 3 interferométrico 1 Oltenita 1 PEBD 2 Höfer 3 Florina 1 ggw 1 fanghi 1 goose 1 Illustr 6 Pertegueiro 1 Óseo 1 malumnalu 1 Jiangzhou 85 Heller 2 Militsiya 1 fhele 15 Nadadores 11 Mid 1 Lbm 1 Lonne 4 Nastro 1 ínferas 1 Miesch 1 Merikare 1 Lixelas 1 llengu 2 Penamor 1 nasrí 1 Hidroxenofosfato 1 klattii 1 Isoleucinopina 5 Magnetic 3 matívose 1 interromperían 1 Kamiyamada 2 Fermente 1 miañador 2 Kaesong 3 Femmine 1 Ivukula 2 Kurbski 5 ganoides 1 Olkolo 1 Hippia 1 odpuszczamy 2 Iztapa 347 leve 3 Herpestidae 1 perxudicarse 3 namoramentos 20 Neandertal 2 Galacturonopyranose 2 lucirse 1 hosrticultores 1 Gdudei 3 mauretanica 633 Norteamérica 5 Indefatigable 1 kasas 2 Indispensables 1 Konstamonitou 1 Knetch 4 Ídolos 40 filtrar 3 officina 1 gency 2 Ishiro 1 fiticia 1 Lampantín 1 Paralízanos 2 Keyon 141 incorporan 1 Phibes 1 Kárpathos 2 mobilizábeis 13 oviducto 4 Kauraka 6 Mouras 1 nelumbos 1 Lapataia 4 hondo 1 Oktyabrdan 12 MRI 48 penetrante 78 magos 1 haulouts 5 maldicido 1 Meerense 5 melanesias 3 Hospitalis 1 Kvaran 1 Ferreria 1 inmportancia 1 ?it?i 2 nodularina 10 Iles 1 inandensis 1 Kompleksi 16 Interaccións 1 km? 1 incorretas 1 ndziko 4 Pants 2 Kwisatz 1 metenamina 1 fjouru 3 Glivenko 40 fundamentada 1 Interplanetaria 2 Giannoulis 2 Orugooru 2 Morgenlied 8 palmeadas 3 holoenzima 1 goblins 1 Menashé 1 NGTU 1 Legibus 1 Plasseraud 1 Hugonet 2 Mutiloabeiti 71 frondes 1 KFormula 1 normalizadora 2 Petrosani 1 Maratka 1 Nagab 1 indirecion 4 ideación 1 Guillèn 1 Howellia 14 oceanográficas 1 Filiki 1 Gifle 12 Nacía 2 Pamphylius 1 Gakusho 1 Pescetariano 1 hipeuricemia 3 metanio 4015 organización 1 Observó 1 hippo 1 Îndreptarea 7 Pinnipedia 1 introduccions 1 Pakanha 5 hexa 1 pigments 1 Plaga 2 heterofermentativas 142 Filo 4 Koenekamp 2 febreirea 1 llinosa 1 festejant 1 Particulazona 1 PECHADAS 306 Fl 1 Ndithudi 1 Ostaijen 2 Gewerkschafter 2 hordeivirus 3 melidá 38 Folgar 2 hemerográfica 101 Hartford 11 nomearan 2 Loteling 2 Fontesanta 1 Nouhak 11 Leino 1 marcharás 1 illeo 1 no Walker 13 Gorea 1 MORTALDA 1 HfN 1 kudu 2 fumegante 21 Lautréamont 1 filomarxista 2 Ireen 88 Krajina 8 Lorius 1 Galesauridae 3 Hagios 1 Molyvos 3 guitarrón 30 galaicas 11 IVAM 2 Kalat 1 Lissom 2 Margen 4 interceptores 1 Lieselberg 5 manequín 53 inclue 1 Figueirinhas 1 fure 2 klukk 15 inocuo 1 Frishberg 1 favorecerlle 1 Kelonia 1 mitín 1 ngw 4 longicollis 2 Myricales 1 multiprogramación 1 hjelmqvistii 2 lapote 1 Mikalai 1 Kereus 1 Ortho 1 Magallum 2 LUZ 1 PersonaConMascaraDeHugoChavez 1 Knospe 9 Mencey 3 Historiográficas 3 Gorbunovs 3 Lequi 1 Mightysat 1 Godefro 5 mesana 14 inamovible 3 gasgas 1 nuttallianus 5 grandor 1 foucaltiana 1 impactarán 1 Gobiesox 15 Piana 2 haran 2 homónoma 1 nanobola 1 Keluo 1 grástico 1 inibido 1 kri 8 massacre 1 minimizarán 395 Liberación 10 Gears 1 Paluezas 2 IPEC 7 Luksemburg 11 lamelares 1 Perini 4 Pantanos 1 Orzorrotz 3 muler 41 fotorrespiración 3 knowlesi 1 Feminal 1 handbikes 2 Hagall 2 Mouseketeers 1 fotodisociarse 9 Knorr 5 piróxenos 14 lunetos 1 iambicis 1 juguen 2 Istoriya 1 laman 1 jada 2 Fluixá 1 laxantes— 1 incultura 23 Goro 2 Pioggia 1 Helmiopsis 1 fusionismo 1 mentals 1 Penanjong 2 hathu 2 imitala 1 Minbar 1 parabole 1 Perkovic 36 Lutz 1 marquista 1 Hamamelis 1 hjalpi 1 Murrdi 1 negariva 1 Phasmida 1 Iantzi 1 Pépère 1 Noidala 2 perido 224 Jefferson 1 Odontólogos 74 Ich 1 LLON 1 losera 3 keiskei 5 kamp 1 nubicus 5 glicolíticas 1 Francest 3 logoteta 1 Mucrín 2 FlagofBohemia 1 FORÉS 1 omnnívoros 1 Juanola 1 obsequiaba 8 Imager 1 KILL 1 Nanbaa 1 Lolas 8 Malherbe 48 Passion 1 Piestewa 1 Mendle 13 ofrecerlles 3 mutaciones 1 leannáin 1 Ghara 1 pitio 3 Ichikai 15 Merak 1 kisho 2 inigualables 1 Philbert 22 funciones 1 fotodímeros 1 mielain 1 Juusi 4 parido 1 franz 2 Lecumberri 1 felatrices 1 inclúei 1 geomorfológicas 2 Ormazábal 1 Lecrux 4 Louÿs 4 Hsiao 2 nupe 4 Higashiyamanashi 1 Impressões 2 HAc 6 Hitlerum 1 Lamazal 2 ocludentes 1 Marigney 1 Hostaleira 1 Nagis 3 Lepori 4 parkeri 4 Montañana 1 Houberon 1 mexasen 1 Isaquitos 1 Pekinška 55 malaios 1 Jamshyd 1 inframembranoso 23 inerva 1 Milosesti 10 lap 1 Leptolepia 2 outórgalles 1 Nandasmo 4 Ljubicic 3 Kuusankoski 6 Persegue 1 ferdios 6 negadas 4 Jelusic 2 Mézin 1 Fundúlidos 2 periplásmicos 12 HTST 5 Maithili 1 fisiolxgicos 1 namák 1 Jieyang 1 Ionosférica 4 Mafeteng 1 Lipinia 4 Maloto 6 momentáneo 1 Manzhou 1 IJdo 1 Loiti 1 Oldcorne 11 imprimindo 12 impetuoso 1 Iberis 2 Hexaplex 1 opposita 4 Midorikawa 3 Phocoenoidinae 18 Madness 2 graminifolia 1 interpunción 1 granaínas 1 Jémérie 2 Neumünster 14 hidratar 1 ingleses— 9 Kanuma 8 Grundy 1 lecciontaxidesp 1 interconectaban 5 Irlande 12 Patri 56 manso 1 Kashimadai 1 nétamente 1 libidinale 53 Horcrux 9 pendello 1 Nokinja 1 Loiscthe 1 jernov 1 Fonteformosa 1 höherer 4 Kuššar 1 Mouronho 1 Ludowski 13 Gundisalviz 1 Ohtar 1 kiyombe 5 masturbándose 1 Filopono 1 Londoh 1 núemro 6 fogueiros 1 lagu 3 Petermann 2 Nutter 1 Páganos 1 Kyosokyoku 51 MAR 4 linolelaídico 1 gritándolle 1 gruodas 1 neurosporaxantina 1 inceso 39 oportuna 48 fracasada 2 obverse 1 Heliospirillum 1 Grethe 1 jolgâdâsâin 1 Fernón 1 Ixcaximiano 1 lodigiano 1 Frustalupi 1 Llanrwst 5 Holde 1 Gabhi 1 Golovinomyces 11 Pacal 1 Novium 1 Leukozoa 4 Pernilla 2 melodramáticos 1 Magzinc 2 Hornsey 1 Having 1 Guynemer 1 offender 7 Kisuke 1 Giaguari 6 Josette 3 Paschal 1 Moneypenny 1 Mendunieto 199 intensamente 6 Laudan 2 Höfe 4 Laune 69 Ove 1 legoullos 2 Koero 1 Fumic 1 lecticanos 41 Maredudd 4 Mícheál 2 leucoblephara 1 Lemma 2 ganacias 8 Phys 13 Loterías 1 frolecidos 28 Leros 1 Neš 1 nyha 65 intrón 1 guþ 1 Namhan 1 lavannara 1 ime 2 nárranos 1 Haemophylus 16 Merriam 1 gennnaío 1 leonardo 1 kagoshimanus 1 hosteleira 1 pariter 1 khymós 17 JV 1 picapedreros 1 Guttentag 3 Ollivander 2 Ginarte 18 Fincher 1 Fouches 2 Metzgar 10 Oberland 1 fotobranqueamento 1 Floralia 6 Flogger 3 mallorquines 1 Kopstein 1 Nemetz 1 Parapandalus 5 liitto 2 legislativas 2 OTSC 1 gèsta 1 paño 1 Narration 2 Meycom 1 Naturwissenschaftler 4 fisicoquímico 9 gatiño 1 Havoline 2 Fissore 1 InternetTV 741 Ligier 4 Homeward 1 Nostoch 25 Paradores 1 Gomà 2 Hyaenodon 2 ignorabimus 1 leptoidea 1 Micel 2 hematólogo 1 Kopfkissenbuch 1 Glazebrook 1 Liena 10 Kabupaten 1 fogosas 1 Koeu 3 millennio 4 Hovasse 2 Moquiniella 21 Hokuto 1 Ikoods 21 Infant 2 Oxano 217 Júnior 19 Irian 1 nurui 1 HULEBEC 1 juu 1 McMurtrie 1 Macromicoloxía 1 ñeve 4 Plastos 3 Hietanen 3 Mammalian 1 Nectocarcinus 1 Pedrozo 1 originalité 1 Ogrobre 28 Guimerà 1 larvares 26 Kurtz 1 Ornithodoros 11 ill 2 Murhum 17 grilandas 1 Nerli 2 hiatus 1 Mocta 1 Maillères 98 Mannheim 7 morfosintácticos 13 Patch 1 hazát 1 orai 1 Lankascincus 1 Horticultural 10 Gherardini 1 Olissiponensis 12 Fonts 8 mandarinas 1 Multifunkcní 1 MCML 1 habituaranse 1 Lamtoquadrula 1 ósiños 2 Hadobacteria 8 limar 1 nomedado 4 Moffo 2 Mastercard 3 Neferités 1 Nimrodel 1 Nocardioidaceae 1 Hiparquia 2 Pieiro 1 negárono 1 louvábel 6 Negrita 1 Mendefera 1 miniecosistema 6 Hinomaru 1 Kirbac 15 perderán 1 Nodrizas 5 papers 1 Hylotelephium 1 Glauconomidae 2 frigida 2 Harmful 4 Khumbanigash 39 internamento 13 maltes 1 Okurimono 1 MuseumOfFineArtsBoston 11 people 2 kerbo 14 menisco 3 Nazir 333 pioneiro 2 Kevork 1 Interinos 5 lamaísmo 1 Loganville 5 personaje 1 Neomysis 877 fungos 4 goji 2 Medwick 1 Fenici 1 Garabaya 1 GENISTOSUM 21 globosas 1 ka?e? 1 Olden 1 Mazquiarán 6 Gradouse 3 musgosas 6 habituado 1 Meeuwen 4 gbe 1 monometilada 1 kakimasu 14 lacazán 838 mozos 3 Galceran 25 malaquita 5 fenestrados 2 integrábano 6 Laulu 1 Luigne 2 Galdana 2 Paporroibo 1 fenderduras 1 Madrugadas 4 plantares 1 OpenCage 1 noushidan 3 Lascasas 4 Kahveci 52 Margulis 1 Pandros 1 Pilnik 3 íbex 1 Nonno 2 Igresias 3 integerrima 2 hemitórax 2 Gesserit 1 petrina 1 Passuth 1 Oruchuban 1 ganymyz 7 herzensteini 2 Grandallana 2 Kornél 1 Hausierer 2 Leiche 1 Mateesti 2 Hecox 1 Gurgenidze 14 Môquet 1 obturárase 2 librescos 1 Familiarizalos 28 Olimpico 2 Fernandaño 1 flagellifolia 20 Laboa 1 Paicordeiro 1 memóries 1 falouno 33 Landon 2 odocos 1 Festivla 1 itacense 14 McDiarmid 2 Interesoulle 1 plamenei 2 huertano 1 Hohenzollerne 1 Hirlas 4 Pets 1 MetroNorte 1 neorococó 7 Perihelio 4252 metade 8 magic 1 Oplopanax 2 Obstáculo 6 fondeadas 29 McClintock 11 MSI 3 Payens 1 Jabril 16 ordenarse 1 gelatinilyticum 2 Gratidiano 1 IADE 1 limitala 211 Leiden 7 Ferrás 2 FUR 1 galería Pierre 1 Paquda 1 Kapen 1 mélódicas 1 illábase 6 Mining 1 khorasaní 1 Marseilleveyre 10 Haji 3 meem 2 Nickerson 2 Ivánovo 272 Horas 1 Maquíavelo 1 plaxialo 2 PKL 2 Obstacles 2 Ouenza 1 Herakleitos 9 including 1 newtonismo 1 Llanfachraeth 9 Lorde 1 Olivito 2 Gorny 3 Odobesti 1 Geraubtes 4 mauriciano 2 Fregetta 1 k?etwr? 2 Pasen 2 Nouellae 2 Oulujoki 2 Icahn 228 periodista 1 negror 2 Hemblen 1 Frostia 24 ONGs 17 Oresme 4 Misasa 28 Nuns 2 incentivadores 1 mahu 1 jangma 1 INCOTERMS 5 Lill 1 Jaymon 5 Lansburgh 16 musicoloxía 1 HomeGroup 12 Pesc 7 Llámame 5 Hopi 1 Louçia 1 líhun 1 Milestones 1 Gallud 1 Phakdi 2 Moschi 1 Ilonbé 1 Perne 8 intrincada 3 madeirudo 5 paradoxum 5 Halimium 1 lyset 98 Módena 1 Koguev 1 incorporción 1 lekeitioak 10 ingen 1 intrincarse 2 Gwich 1 Mourhit 1 Heteromorphidae 1 jueu 2 Guilarte 2 hesperius 1 OrderOfCristCross 3 Madagasc 1 Lüdtke 1 planificara 4 Interpretan 1 Morré 8 insaturación 1 Leahu 1 Lipouskaya 1 Getsuyoubi 1 Nankang 1 käsä 31 Fluxo 1 kroppenstedtii 2 nomotéticas 1 Megatherum 47 Fiore 5 Peutingeriana 3 novæ 7 onomatopeas 71 Lucense 3 Fibratus 1 Kobi 2 intraalveolar 32 Osman 4 nucleocápsidas 5 Lopéz 3 Mambotron 1 Oxixenado 2 Haemosporida 1 flexibilizacións 336 Linda 1 oswaldii 1 luxemburxismo 1 Florentinische 1 invalidados 12 GFR 47 Orient 2 Pivnovka 1 Maariv 1 knizního 2 Monleras 1 Fentonio 1 Glaucosomatidae 23 Macabeos 1 Matrënga 2 medinenses 1 fotrma 2 kirkja 1 muralístico 1 maleado 1 kanai 4 Maruoka 1 microstigma 1 Perete 1 heteróclitas 1 Incoming 1 Gonaïves 1 forrarse 116 Mujeres 37 Fiódor 5 Jünger 1 metilformanilida 1 jmer 1 Germand 1 navengante 2 Hottest 1 Jolina 2 Ipotesti 1 pervivan 2 Ornithurae 2 gachas 1 Furstenschule 1 Masakazu 1 —materias 1 influencía 1 Laverstoke 2 Magallánica 1 hipoprolactinemicos 1 Guarrizas 2 Lannerus 2 Pediculidae 15 indefinición 1 heterotetramérica 42 Insírese 1 Obschye 1 handicart 1 maliana 3 Missina 2 fantasmagórico 1 oílos 6 literalidade 3 paratomía 1 gonggashanense 1 Maissiat 28 Heike 1 gastrofrénico 1 LAA 1 Honrase 4 MeJA 1 Ooguchi 12 Neoclásico 1 leucostachys 13 glaucus 2 Moilliet 1 miniaturizador 2 fornecerán 1 ludere 2 finalizounos 1 irresolubles 3 kapa 1 Hagreaves 1 komediateatteri 2 Guerrien 1 floxisticado 1 ítalos 16 halobacterias 195 perfección 1 Matís 1 Gudthaykudthay 3 Lodhi 1 Lomaco 2 Giyani 1 fufu 1 Mellingen 5 Lenga 1 Ichitaro 1 Liveaufnahmen 13 ileocecal 1 hamídicas 3 Jaione 2 LET 1 Percibiuno 2 obstetra 2 parenquimatosas 6 Niveiro 1 Hipervolemia 3 interpoñerse 1 intereuropeas 63 Medusa 2 Pálffy 1 Katomeri 1 Okul 1 helmínticas 2 Heterosexual 2 Laliostominae 6 Goriziana 1 Fitomedicina 6 Paréceme 1 monitorizaren 2 FUNK 1 Mosasaurios 3 Okara 11 maxestosa 1 Odisseia 5 haga 3 Kromowidjojo 1 Niñera 6 metanóxeno 733 modernas 1 hafiz 121 infectada 1 Isang 1 loupežníku 10 fermentadoras 1 Martis 2 gordechos 1 Meimixe 6 Gazzetta 2 Massalavés 1 FEROCE 1 plasmidios 2 Llume 1 Geister 1 Maxhunaj 1 PAUCU 99 fosfórico 1 Ouwerkerk 2 Obeliscos 34 JC 15 Persuasion 1 Flukiver 7 notifica 2 haddock 1 Leverrier 17 Gallaeciae 2 Kohlberg 23 FORA 7 Meret 1 omegavelocidade 3 optimates 2 melloralos 4 Firuzabad 5 fiz 5 Nochebuena 3 Hollein 1 Khitrovo 1 jila 1 nacemn 1 Passini 33 Gaitelgrima 266 grosas 6 Noddy 2 lemon 3 Lígures 18 locutora 1 guirigay 1 Minotarumaquia 38 Macon 1 Negreiresa 9 impulsión 1 inconos 1 Munhall 1 helga 1 Fardet 1 Gulosa 2 fucoides 1 Guyette 2 Ordinance 1 Nutrition 3 Opiter 1 ocludente 1 Micranthus 4 Metropol 5 Innocentius 1 Lafokpokaha 3 Kawanehon 57 Miden 3 Kindergarten 1 griva 100 percorridos 1 Lepoeder 2 orígen 1 Picatoste 1 Gandantegchinlen 2627 minutos 39 lichtensteinii 2 lorises 1 Lloaces 1 kavalersky 2 Ondarribia 1 Koako 1 Kracheh 1 Habsborgo 1 Mallahan 1 Hofdahraun 34 modificarse 4 Miñosa 1 Particularmete 6 meristemático 1 Iakovlev 2 Lämmlein 1 nhf 1 pacedores 1 Gregarinasina 1 Machoke 1 Mahomets 1 oxiclozanida 7 inxectou 12 Gmail 1 HQA 1 Lemarchal 2 Latia 2 indiferentismo 2 Futrono 1 Feiss 2 Hacendado 9 neige 1 herbimicina 2 Leopoldinia 17 omnium 17 Glicerio 1 Futurity 1 Houlbec 1 Jacson 2 Frerichs 14 haloxenuros 1 Linaza 2 Keralite 5 Listo 1 ortodoncista 35 Gap 1 Mortoares 2 Jeta 1 Hellal 1 lamproíta 1 Munki 1 Lotbinière 54 Mute 1 PADIE 4 Patrulleiro 4 fraccionado 2 maltoso 1 Gatwik 1 Iamatsuri 11 parasitadas 1 Nitetis 2 Furtibo 77 finlandeses 15 JAZ 1 Kaartinen 1 leptopodum 5 LEV 1 Floatzel 1 Kyrridven 5 oracular 1 Mandoul 2 PKG 1 Moritsugu 1 Gambita 52 Ferry 3 Nukha 1 kartografiju 134 matan 8 interpretes 1 Lignasan 1 Kawee 1 Neuroectodermo 5 Heparina 851 incluída 28 linfoblástica 2 honral 1 IVECO 1 Pilularia 1 KykNet 1 Palestinian 1 Lautphysiologie 49 fisionomía 4 Finance 116 monofilético 1 Illustrazione 1 kumyks 1 Kilcrohane 1 Novissimos 1 GHIJKLMNÑOPQRSTUVWXYZABCDEF 62 mayo 5 oncle 1 Mostaq 2 Kadan 1 isabella 2 Incretina 1 McCaleb 5 Incontinencia 2 IEEC 903 nacionalista 13 neuro 1 kost 12 Lourinhasaurus 1 orthoptéres 1 Nehilawe 1 NADA 1 Fámulo 38 Penso 7 Jaap 2 Juramento 1 heliotropio 559 Oficial 7 Mystics 1 ganjah 1 imparábeis 2 Lucrécia 10 Paranoia 1 pacatele 34 fracasara 1 Mathhew 8 Kasey 1 mirror 1 h?rb? 1 Helbronner 11 Hodson 133 mergullo 2 ORL 9 Hélio 1 Kustsnäppa 157 fíxolle 11 Kamphaeng 125 otra 14 Lupario 10 passum 2 Perusia 1 Kaarela 1 Harrijasotzaile 1 Garófalo 2 Multiplataforma 1 fastigiato 3 Geographical 1 Kollumerlandés 1 jocale 9 Petrovna 2 louzanía 3 Karimnagar 1 feición 1 Kintai 68 Namek 1 Gluringen 1 Foglio 5 Pansy 1 obedeciamos 3 Golub 2 GARI 1 Laespada 1 könyörgés 48 Magda 1 parwe 5 Pange 4 lidaba 3 Montechiaro 3 incosciente 128 Jerez 1 harmandiana 8 Inconsciente 4 Lozier 1 Jurídics 1 oíph 1 Herzing 1 OCN 2 Lotho 1 Hanowski 1 nocomun 51 murciana 1 Mosk 218 fundamentos 1 lierne 2 Litueche 12 Marinus 1 gabeou 17 luce 1 octenilo 1 ostiarii 1 Neocueva 2 Grafenau 2 Marial 3 lophantha 5 Inigo 5 Guli 1 Norteumbría 1 Pasquim 1 graph? 1 Ilulu 1 FERIARTE 1 Orientals 3 leptos 1 herrerasáuridos 1 localizanse 5 fiscaliza 2 lawsonii 2 Mtscheta 1 Pasárono 25 Iznogoud 1 natelis 1 Pálpebras 1 KSIÑIQUVKJÑG 1 Nyary 1 McLeish 1 Matisia 1 Panday 640 iniciouse 1 jibbali 2 flex 189 Mentha 5 míllaras 1 Kalmius 58 Murder 1 Naissaar 2 indostánica 2 Fario 495 orixinando 2 Integrarían 1 Matrox 1 Phragmoteuthida 1 Japonochytrium 1 moviliario 2 oïamos 1 Optevoz 2 Gianetta 1 Hyenstrand 5 Ismos 1 lucifer 1 Nelliyattu 8 paliativo 1 pasarías 1 Mediterrania 80 Markus 1 nulidad 3 Manol 1 fráguanse 6 ilusionistas 5 mucosidades 1 KNG 5 lait 2 Hitza 1 headache 1 gornizón 4 Lemnoideae 1 Kamchatcka 1 folkis 1 Izštekani 1 Kínzó 1 H?mr?yliyi 1 Kontrolle 1 LOGALIZA 2 Meridià 15 Meubook 1 Kashiwagi 1 MARC 1 oubykhs 3 hagyd 1 Ngasaunggyan 56 pita 2 microproxectís 156 Pinochet 1 Mesikämmen 3 Palicki 7 heurístico 3 Goodwill 2 Jusep 3906 ningún 1 huppé 1 Howik 1 Golovanov 4 perfeccionamentos 1 Panida 1 jarre 2 immenso 1 Gorchs 1 liberalizouse 2 nutricionales 2 JACET 1 Petrobrás 1 Moldoveneasca 2 mantuano 21 Ferroi 4 instruía 2 Hrímfaxi 1 Omakase 15 Oy 1 Logorño 1 indexaron 2 Khalatbari 1 pathach 1 orixinalidad 1 Petrense 1 Jussac 2 orgullos 1 Fáridos 1 Menélmacar 3 multistriatus 25 hexoquinases 10 monocigóticos 1 maintien 1 Konkordiaplatz 3 Owners 2 Johner 1 haploqueílicos 3 Livezi 1 hepatotóxica 1 o grego 1 Kamesenryu 1 Harmilia 1 Habo 2 Meathook 2 McBrayer 1 Opitutaceae 1 mandúbula 1 Organoclorado 1 Impós 450 Oroso 2 limona 1 Latitud 6 nebrodensis 1 pachygaster 1 orelludos 4 itan 1 Piguet 1 minguaban 7 hung 1 iturri 163 nulo 4 hidroxil 2 Malephora 1 mâgh 1 Fellemberg 1 megreliana 5 Morshower 34 merda 1 piombo 1 normandorum 1 Orfne 1 microblogging 1 nyingchiense 2 pandora 1 fúa 1 Philles 1 IMPAc 25 manía 3 macrobiótico 1 Mentidero 1 Khedrouche 2 Kyffin 1 Nakanojou 1 Marianismo 12 Irmo 1 Giesteira 30 limóns 1 Fodom 1 Meerestille 1 Ninfeta 122 ornamentación 2 Huizen 4 Homofonía 15 Petróleos 7 Ledgard 1 Kerhuon 6 Lagerbäck 49 Jyväskylä 2 Miraña 2 Martan 1 Pandoracea 1 Guncín 4 Galoa 2 guarir 4 perderase 1 Levstik 7 paludicola 1 Herdadiña 1 Nozik 1 Mauas 2 Intanto 3 grifos 1 Ialysos 2 incrustouse 1 Laou 1 galvanotecnia 1 pequeiro 5 hidroperóxidos 2 LAND 1 IUKOS 1 gerundivum 1 mastíns 1 Kaschi 1 Kusarigama 2 innotata 19 Hardware 1 HOCKEY 8 Grondona 1 Jeni 1 Papiliolebias 1 Kranebitter 7 Maxima 6 Fuciños 1 Kouroukan 1 Neobola 36 Paidós 1 Inujini 1 invertirse 1 HELO 6 infiltrou 9 Gamlebyen 6 lignificación 2 Malina 1 Gíslasson 1 Neuchâteloise 2 Mendeleyev 1 outubrode 1 lamtunas— 1 Gazmira 33 indefinidos 8 obsérvese 1 kdiss 1 marcianismo 21 haplodiploidía 1 HuangXianfan 336 frescos 1 instructores 1 Igelshieb 1 Passait 2 Latim 1 obstruírense 5 Owensboro 1 Mutta?ida 1 Juiandaí 1 Haminu 1 Krystle 2 Nheengatu 1 Gyerk 2 organizouna 1 Myrrhidendron 18 Gaumont 1 Mauriciano 1 Lamarchea 1 naszym 8 mellorará 3 Knüsel 1 FETEN 1 Opasnye 1 Lavara 1 Harpocración 4 Feelies 1 inaugurárase 2 Paradoxides 4 IXPDOS 1 Hosszú 1 ficifolius 1 myrtilli 1 interclubs 3 Montescaglioso 1 Giraf 2 Lilus 11 Flitwick 1 historiaan 3 Padronés 1 Nydau 2546 obxectos 103 iogur 1 Hadanish 2 hiperbilirrubinemia 26 McCormack 5 LPP 1 funbari 83 numerais 1 jimmy 4 Partisanos 1 Filotaxe 9 monodia 1 LiVe 1 Nixmi 2 Mélnikov 1 merónimos 63 Flower 11 lavadoras 5 ousar 1 INETI 1 occidentalizarse 5 Kounan 4 Fungorum 1 Perimediterráneo 3 Guarita 10 imprimen 3 Odrzanskie 5 ortograficamente 33 Membrana 31 Oceanográfico 2 Kasgar 1 mesofases 1 huecograbado 1 maioritàriamente 1 Khazhonkov 1 Malthodini 5 Noose 1 gurea 1 librase 1 naceranlles 3 Namoreime 1 glaneuse 33 Kissinger 15 partenoxenéticos 1 Ossining 5 marxa 4 Papaleguas 8 frixios 4 Lampas 1 hockii 1 Grenoblo 20 perdurar 1 Minhas 8 Osatinsky 15 Jef 8 Llánaves 10 independizada 3 filol 30 hierro 1 inluírse 1 pachysanthum 1 Öxnadalur 1 pechóuselle 1 margosa 5 patagónica 1 lealdader 2 Jugs 404 Kent 6 Gradoi 1 Glissements 1 Freemwurk 1 Nazmul 1 Grammitis 1 h?i 1 Kravis 1 Jappeloup 3 ozenki 1 Marysa 18 monotonía 1 metatizan 2 Layout 20 Mones 1 Hrušica 1 oureois 1 medicions 1 Gurumes 2 Milímetro 1 heluno 1 JUM 9 Hutchins 3 mamisi 1 kinema 1 Luetash 1 Flowklorikos 3 Mm 2 Jurokugo 2 Majiagou 1 Millice 1 Landils 52 incompatibles 2 fóille 1 fotorreporteiro 10 Leoz 1 ofuscados 1 Kitshoff 1 Osede 2 lourenzo 1 LUMBU 1 mizdho 5 nami 3 Martensz 1 lachnophylla 2 Moixina 1 percloroetileno 1 hemáticos 1 Oursler 3 Geheime 1 Noudjeu 199 Lexislativo 1 Morquintán 7 natrón 1 liliaceus 8 Parisiorum 1 Heteracris 1 Müzesi 1 Macadores 4 heptasílabo 44 infierno 36 Icíar 2 Giganotosaurus 1 giunto 6 miocina 4 OURO 3 Limnocharitaceae 1 jfsacavem 1 Lémbrase 2 Gallionella 1 Musac 2 LaMolinara 1 Hárið 1 fotoeléctica 2 Filmpreis 1 Hipotónico 1 Peitiu 1 NATA 1 Flieder 1 múltunk 1 perdunammu 3 patch 3 impartise 1 Hijosen 2 magnificat 31 hortaliza 5 PGM 1645 pista 1 Fansite 2 famentas 3 Pilsudski 2 Fentalla 1 Mesna 7 Guarnizo 1 genevensis 76 lituanos 1 Pidjiguiti 3 Histiocito 1 Helichrysaceae 3 Kélétigui 1 foule 1 Identitarios 2 peralteses 5 Kingson 1 Hadhramaut 1 Favray 4 heeft 1 Matkowska 1 heneng 2 Hipogrifo 1 miotóxicos 12 Madres 1 muricego 1 Përmetit 2 maracujá 6 monoxénese 9 gornecido 2 mirlos 1 Ghil 5 hemostático 2 ipso 1 Nechaev 1 fceqyn 1 lisoxeniza 1 leinguaxe 1 limandula 1 Grumiaux 2 Gebirtig 1 Ladrero 4 Picart 1 melibiosa 2 Fenomeno 82 Frederico 12 introduciran 8 osiños 2 Mallah 1 misjats 58 Moench 2 inalterábel 2 Kotukutuku 39 Hölderlin 1 partigo 9 incaico 2 istriano 12 finalizase 1 frecuencioa 1 parecéronlles 40 György 1 gué 2 Karpova 16 Nemesis 1 Lavadeiro 1 frowen 75 gliais 1 Nordgren 2 Mehmedbašic 3 Holenstein 5 Muñíz 1 Lamborn 109 inventada 2 gilipollas 7 fanfarra 6 LRR 2 Imangali 1 pezpiñeiro 1 Invandindo 6 Jomon 4 Kean 1 Kitakanbara 1 Krýmskoye 2 Geofrey 1 Pisadiñas 2 kristne 7 oxixenados 1 Noboto 122 Narváez 1 glicoiberina 1 igualouno 1 Fishtales 3 membrna 1 gábalos 2 Fontellas 17 lonxevo 1 Koraru 1 HUDSON 4 Gibin 2 Mayas 1465 meirande 1 negándoa 1 Máiandros 1 invasorias 1 Manyi 1 Fremstilling 1 nichese 2 Krabadin 6 Petalas 1 Nakimushikun 1 Katzman 5 mitoticamente 11 Organum 1 Farragoto 10 Kadic 2 firmatarios 1 Juridicum 1 Oxhorn 1 maltasa 1 glandicaulis 3 llegenda 1 Héspere 1 Knigth 3 Ganshoren 1 papuasica 1 Petryshyn 3 Kanjeriense 3767 James 1 Penavella 2 Malecho 2 Malembe 1 importande 8 Luteranos 4 FFmpeg 2 Jeice 1 Leilani 1 Krotzenburg 1 Jauko 2 Oíndo 15 inacabadas 1 Hpg 2 meterolóxicas 1 Koukounariés 1 paduán 1 platynota 1 fosfopantotenoilcisteína 1 Palaeotaxodonta 1 miljónir 1190 fondos 2 Introducidas 3457 igual 23 Fleetwood 10 ladrar 1 Morgain 1 Milhais 2 Khaldji 1 Fatter 49 guanosina 5 Ostras 1 Personennamensippen 1 Hilwan 2 Magnette 15 Mestras 1 haban 3 Intégré 1 NSR 1 multisegmentados 2 Parmar 1 Mogadischu 2 leuconedys 5 Forzáns 1 patner 7 Hefestión 2 o Partenón 1 Meciberna 1 Ozonic 2 oyster 1 Girella 7 Huesos 1 ledaeformis 2 gahuku 11 Flensburgo 1 kasvot 1 findaid 2 LNC 1 isänmaani 1 Maudan 1 muluensis 1 Howwood 1 keyangan 1 odorizantes 3 mellorándoo 10 manufactureiras 1 Genrus 14 GEiEG 2 Maurizius 1 lixereza 1 Glaubern 9 mordeduras 2 Fulah 9 Hermópolis 8 Ginnungagap 59 Klebsiella 14 hobby 1 Owles 1 Haukkavuoren 1 Koinski 11 Gavião 4 Oughtred 1 Hohn 2 Matellán 2681 Festival 3 Franisco 20 ferina 4 Hatem 1 Foerschichthys 1 Kulturbund 1 oporlle 20 lisofosfatídico 5 neuroepiteliais 1 Maryla 1 Mazadoiro 1 intellettuale 70 glicosídicos 1 Kuraioshi 1 Lepcis 1 Interventsyya 2 mediastínicos 2 Goas 3 Manono 3 fermiónico 23 intencionado 10 Palmae 2318 inicio 2 incompresibilidade 1 Isophyllum 1 Paramo 1 Manial 1 Nunta 18 MPP 4 Natali 3 nesgados 7 Kiarostami 1 formeterol 1 lyratifolia 13 Iork 2 Funston 1 Orjas 1 MaPat 12 Mantell 1 Narugo 1 INDEPA 1 garantizándose 206 parlamentarios 1 Lubrificantes 83 florecemento 3 Phish 22 Kalimantan 22 levantase 4 Mildio 8 Glaucophyta 10 iteracións 1 heroni 13 menoscabo 3 molasas 7 Murla 1 neuroeconomía 217 nativas 3 Hvor 5 Mikulᚠ1 fragiles 1 MarieCurie 1 Plateresca 22 grupal 3 OUT 1 Flirteando 1 Halér 1 Heptral 1 fenny 1 Garibi 1 keithii 5 Lebel 1 Penhall 2 Fatás 125 Morre 9 FAQ 1 indicándonos 1 Longnon 1 Koroma 3 isodon 2 Pilgerwege 12 mesodérmica 1 Jamanta 1 Loias 1 maubèche 8 Mugía 1 külon 1 fonsagradina 14 nossa 2 Flyweights 1 Platforms 6 Pericardio 78 jardín 5 ortoéster 3 LHB 3 matamata 1 Lenogue 1 Ortúkides 2 Outlaws 9 Leones 1 integrárense 1 Järnvallen 3 Largus 7 Metamonada 34 mirador 1 paixes 1 nolite 15 Fanconi 2 Lordosa 1 fechtende 3 Laur 2 Heteropoda 1 gobek 1 Ghoudatsuximizu 4 Kiprop 1 inmolaban 1 Imberto 1 Florula 1 HYZ 2 Julióbriga 1 JUSS 1 Minguar 4 Kym 1 ouais 5 Mimo 1 Manninee 1 patienter 3 Jojen 3 Micheltorena 4 Palmito 1 implícaa 3 Percorridos 3 normándica 3 Frenesí 1 orizabae 1 Malchárek 1 Kopisch 1 gnosne 2 Granák 4 Gryg 1 longearistata 1 inseparaveis 1 Glauconnesus 1 Kamaldina 13 Lousã 1 KUMGM 1 picking 1 Galeen 3 Khefren 2 fausca 1 gráns 5 Houma 1 mestranza 1 Georgiou 89 Livre 1 Khoy 3 NJCAA 1 flâmula 1 Maatkare 1 falsetà 1 Mpfumo 4 Madetoja 1 Gerthide 3 Orchestia 2 Norteño 3 memorizasen 4 Garrucha 1 Missio 2 parmi 1 forbesiana 1 Neiberg 8 Inferiore 3 Oteruelo 1 Joshuatree 1 Kovacevac 1 Irizubieta 5 novicio 1 miracolo 2 Melchora 1 Lynceus 3 pilum 4 Minakami 1 Nuaimi 7 geográfica 1 Fardella 4 Nishiwaga 2 Formularios 1 Parnon 1 Glimpy 12479 outubro 1 Mamini 1 nucleaba 1 mutihilos 1 MMIX 1 Midouze 2 PENAS 1 Feacía 1 Oldone 1 GOELRO 1 KARITO 1 informico 1 Fredegarius 4 fláccido 2 photographe 12 Huffman 10 parti 1 Lamorisse 43 fecundados 10 mancomunado 2 gennaio 14 Lingüísticas 1 Kniplová 1 narodniki 10 Hochelaga 1 Masrocs 2 Helvio 12 Marcote 8 HLAs 1 mammeata 1 oxibwe 1 Naumaquia 1 FcgammaR 199 Narrativa 1 Narodnichestvo 4 lascados 2 Pastko 9 Hirata 1 lacune 2 moralexa 2 landgravine 1 obturacións 4 Loman 1 orpónimo 1 Malgrange 1 Motivan 8 perso 3 fruticulosa 3 Maquetas 1 Paggi 1 Nâ 2 musnad 1 Kanapitsa 3 felo 1 móstraselle 1 Greben 143 Harper 1 kloman 36 k? 968 Johnson 48 Infancia 2 Guadar 10 Lollobrigida 46 patólogo 2 intoxicaciones 1 Onandjokwe 1 Feraye 1 Nuriootpa 2 Hematita 7 interrevolucionario 1 gives 2 Pandalina 6 nanoescala 4 percibíase 2 Phantasia 1 Nefast 2 MDZ 1 opcions 2 Insubrica 2 Guiarat 3 nacarados 7 Ocupando 1 Menciñas 1 Lovelady 25 fermentos 1 Kalafer 1 Negativista 2 Maliseet 608 Montevideo 2 laudón 62 Ferrán 1 MarsellaLiga 4 Lauburu 32 PCA 1 Molestos 7 instigar 2 Oruanui 1 leiv 1 Manzin 1 intraceluar 14 Nicéphore 1 neuroespecífica 1 Merzaq 1 Mozgov 1 Introterra 1 Kaitaia 362 foros 1 fyd 1 Mediambiental 1 harzaraguí 2 inexpugnabilidade 2 Fontanilla 6 Fomin 5 Leir 75 Pirro 17 pittori 3 lámhach 4582 interior 1 Keos 42 homínido 1 Paleontólogo 10 hibernan 1 Muntsó 2 Guarinos 1 Mapakï 4 Keynesiana 1 Luthier 1 maximizan 1 industría 1 Muttaqi 1 orjenii 1 Philarmonía 1 Malmstedt 3 Mombello 1 insertala 1 Lishchuk 1 Glicerotetrulosa 4 megalito 29 MacLeod 1 marisca 1 mesonéfricos 3 Nichita 1 Ozalba 1 NEURO 1 MAdrid 8 menoridade 16 parqué 74 hidrofóbicas 1 Gatxo 43 Larson 2 finitude 3 gassánidas 280 indoeuropeas 2 norch 1 g?nsk 3 lideralo 1 JAC 1 Jugon 1 Helicoprion 3 Feinberg 1 Javan 22 Hospitalaria 2 gei 2 madona 1 orixinaríanlle 203 perigos 1 permítalle 1 Internés 1 ontrol 6 Gillot 14 flúa 2 Nojiko 1 Helgren 11 Koh 12 Lalonde 1 fomentos 1 HSST 4 Holscher 1 indefensas 1 parrhesia 1 ph?n 8 módems 16 hipócrita 1 fuscociliella 1 hilft 2 insomniu 1 Gardevoir 1 piquillo 3 Naifa 2 mínar 2 Langedijk 2 Junca 1 Guéguen 10 perimetrais 5 Nemunas 11 microcontrolador 1 GIOE 1 monounsaturadas 108 inscrita 1 hematoquecia 2 muralles 2 mbira 2 Pierolapithecus 11 Kerk 1 Montecassiano 1 kirgisischen 8 Panerai 1 gweilgi 1 Formilación 2 MAGRAMA 1 Koshevatskiy 9 Nach 1 Kasbek 1 hussard 1 nyingchiensis 1 Naš 15 hoteleiro 56 Leucemia 1 Perseguidor 1 Ferroukhi 1 Methylobacteriaceae 1 indochinensis 2 Pirimelidae 3 Marshak 1 Feais 1 fretes 1 Loroxo 1 MUPUS 1 Nimeh 1 gustedes 11 ocupacionais 3 Miopithecus 1 gravsten 1 Macheiresis 2 incorpóranas 1 Nahapet 1 kibas 1 maqal 6 instalárense 2 masalit 4 Giura 1 Kurag 2 Ichirou 2 Feldheim 75 marroquís 1 Mingallo 1 Orphanotrophei 6 Gaeaf 37 Lezo 1 gieshueblensis 3 Nodier 2 Pincheiros 1 oligotrofia 1 perturbativa 1 neoasiria 1 nasi 92 Nevis 1 Jailbait 2 Phyllodocidae 21 Heroica 1 Moorhof 1 MMAA 1 haiwaiano 30 neoliberal 1 octabas 1 planning 4 morodo 3 lexisla 184 neerlandeses 2 Koun 3 Fidenas 1 leuceemia 3 laurentii 1 fonilh 1 Milliyetçi 2 Mottelay 3 froitiños 1 GALLICU 5 Graziadio 1 médie 88 kitsune 1 metanefridio 2 Gisugisu 1 Galits 2 mò 12 Muspelheim 2 iltcen 1 oricui 1 Gahagan 1 helpem 6 Grisén 1 Hipocerca 4 paratión 2 PATRICK 20 Indochine 10 irritábel 3 Migoya 1 patognomónica 5 Gnädinger 3 Galarhoeus 2 filantrópicos 1 Gallaicos 1 Piuhola 1 Nebelidae 37 osmótico 127 mirar 1 Kerckrin 3 partín 1 ordenarlos 1 oviforme 1 Jnumhotep 1 inducíndoo 1 Plagiopyxis 1 Ordenes 4 Oramo 2 Pampani 2 Mardivirus 4 Ludopatía 2 Hadeloge 1 Gomulka 1 Metamatemàtiques 2 Hakahau 1 Intruduciuse 1 Karigu 2 HMGI 1 Pasemos 1 Maestrophone 1 Leuconoides 79 Kowalski 22 fluoruro 1 Hornbaker 8 Pewterschmidt 8 Pesado 1 Mandenovia 5 parietariifolia 1 llonja 1 periurbanización 30 fils 3 mülleriano 5 Persiani 1 macrocomarca 1 JATP 1 metacarácter 1 Jahiz 1 Hicorieae 1 Madurodam 1 Pañcha 1 Nacionalrat 2 FHC 14 Hors 1 Picrato 1 MushroomMania 5 Ladraremos 1 Liepsky 2 Friedrichswerder 1 Monferro 6 fechando 3 Hedningarna 1 PATRIA 6 Kray 50 licenciarse 14 isola 3 Orsza 1 Harsewinkel 9 mineralocorticoide 3 notizie 77 Kareem 1 Perifèric 1 ores 1 filoloquinona 1 NeBo 4 Melchester 14 Ichinomiya 16 Morocco 1 Meghaier 1 Heróico 1 galopa 1 Labagu 1 LLargues 2 Naide 1 Magnac 704 organizada 1 kabul 72 Olaf 2 Formulouse 17 hipnótico 23 Palleiro 2 hova 1 Hypotrichia 2 Le?nayin 92 Oda 1 ordovicos 1 gostará 13 Nelumbium 1 Iñantes 1 moretonensis 2 Groban 82 Genil 2 palico 2 huseinita 1 Hafniae 1 Lanchóns 1 mensura 1 gastroientestinal 1 Kvinnor 1 Maccerata 13 Lucientes 1 limpen 1 Mayorazgos 2 Likame 1 Kipyego 1 Mokranjac 1 Nikolaiviertel 6 Mazi 1 Hiwaki 3 MLR 1 Kancho 2 neumogástrico 39 imagen 1 Odhin 48 grade 1 Jeronymus 10 Mikado 31 Hermoso 1 obsesiónao 1 Kiptchak 1 Graena 2 Laina 2 Laminariales 1 masti 51 pezuños 1 GRHPR 2 Lunatic 1 Muzyki 2 Lobelos 1 organisé 2 Oxyuris 1 interferring 2 Koncertas 1 Fosfatidiletanolaminas 1 Gothenhafen 1 Kitaro 1 Laurente 1 Pertusio 5 Pahlavi 17 Mulino 1 Inhaladores 1 Perforina 4 Pajarillo 1 klingonaase 3 Implantouse 1 pescándoas 3 Pazzaglia 4 MTR 3 mux 1 Majnó 5 Memoir 1 Kárhozat 1 Khrut 5 Pavimentos 1 intentounas 7 Gogue 32 Mahmoud 6 numerosísimos 102 marchas 1 Nabukeru 45 Meta 1 nádvorí 2 LanguageTool 6 Margens 2 Locuciones 1 localizarmos 1 Golshifteh 1 planario 4 Lieutier 1 mútuas 1 ICIS 1 Killea 2 Khosr 3 o FC 1 Mavrogenous 1 jb 1 inmedita 1 malcriados 11 inmunizados 4 Lidl 10 Hovet 1 Grite 1 maravillosas 3 inhabituais 2 Luksenburg 3 Náhuatl 1 Gerstaecker 494 Linné 1 Fonetiker 1 Perches 1 HHCH 2 Jermy 1 Pélégrin 1 Middeltown 2 Mirorde 4 Grassman 3 Oroz 1 Paranense 6 maq?ura 3 inflation 2 Grafias 1 MARTIS 1 ~Heartful 4 interactions 13 multiplicou 580 navegación 4 Mosel 1 Fesch 483 Filgueira 1 Gohaiden 2 Lovey 1 Gracindo 1 Parmenius 1 Pétalion 2 Innovar 1 pinnipedos 4 Gendai 1 Flöte 1 homeólogo 1 IIPoppo 1 mercáronlla 1 Landbote 2 Largent 3 Meerzorg 1 Mustafayev 47 Forlì 84 Hórreos 3 Merzbau 3 lacerata 2 Imperieuse 1 Hongshui 1 lantau 2 Hikami 1 Hierosolima 3 Italianamerican 23 Parcialmente 90 Neve 5 Malkin 2 Hábitos 13 Mayday 12 gn 1 Hurlock 1 gwanwyn 1 Lenardo 4 Izel 17 Papaloukas 2 ilumínanse 3 Martiánez 1 Negulescu 1 oligomerus 5 PAMP 2 Montejano 3 Jidaigeki 6 gar 1 Honza 1 glires 83 hidroliza 10 Futari 1 Olyridae 2 Massai 1 mitoloxizado 252 maiormente 3 mataríao 1 Pietila 2 Insomnes 1 Marbe 154 Gifu 5 Hartw 1 Omniglyptidae 1 Fitzhenry 3 herbariae 2 Gakken 60 Monterreal 322 investimento 1 Hörnefors 3 Fisiognomica 1 Obon 9 Fs 4 introducirlle 3 peregrinaba 125 Nebraska 1 obstruínte 1 Planctomycetales 1 hiperlipemias 1 Inkwilersee 20 Gibb 3 noméalle 4 MacCulloch 1 Llamara 4 moquete 2 Maelduin 2 Joulupukki 2 Piyamaradu 1 Naialma 4 Moli 41 filetes 7 peptonucleico 1 Patod 1 Inteface 2 investíndose 3 Kjellvander 1 Guillame 6 macrocíclico 1 Kompleta 1 Horseman 192 Feroe 2 Lakin 6 otoniana 34 fiábeis 2 oñacino 1 Haenianthus 1 Maritimis 2 Hottie 1 goliarda 1 kalamita 1 Pedralaxe 40 mimivirus 1 Kongsbert 1 Omusati 1 fuèlha 1 Gaerog 1 LEBL 1 Goscinski 1 Litzlberg 1 Korbell 1 FUCI 1 Gonchí 18 Juez 1 matraquiños 1 pertencerlle 3 Indaco 1 Longuyon 1 Googleplex 1 Menidae 1 Katsuhiko 37 Morella 1 humeralis 7 mude 1 infarto— 1 Morenaca 7 Forskål 2 Markwitz 1 Kazurinsky 18 Natália 12 Paffett 1 liyangensis 1 Justicialistas 1 Fusionou 1 logras 1 Platamonia 2 Heautontimorumenos 1 Parsimu 1 Pegea 1 Filibuster 4 Parsífae 3 imunolóxico 1 FAZER 3 mondes 1 Kits 3 Gullweig 102 imparte 1 Hønen 1 gyne 4 Límits 119 pilotado 10 glacé 5 Lavrinovic 1 Jodenbreestraat 18 Hela 2 neboeiras 1 Gapinge 1 Guácaras 1 Lukowiak 3 Nicotinamida 147 ocupantes 97 gana 1 MAXtv 3 internodo 3 Pickups 11 NSU 2 Minnesang 6 hercules 237 pesqueiro 2 Malapaga 4 Nabor 2 inclén 1 Maaie 4 PKGBUILD 2 Petrovski 7 Moissac 1 Maddi 3 Kristinn 1 ?Islam 4 imprimis 16 lingala 1 NgoMIV 1 Kilcomenty 1 Ilovaisky 2 Malolo 1 kasoense 1 Feray 3 Gook 8 Garo 2 Genshi 1 neuropáticas 1 Loritz 1 nonminación 1 Hespicio 43 morno 64 Groso 2 mendigoizales 1 Frústula 8 Hernan 1 lentén 12 modernidad 3 hiperlaxitude 7 mars 1 machucados 6 norn 2 JVM 1 Kyatwa 2 huichol 14 Liiga 4 moine 1 odontoloma 1 onstrutore 14 levoulles 1 Legouvé 1 hokusai 1 Luttinger 3 musschenbroekii 1 Pai?ea 1 ma 6 folles 1 Klavierwerke 1 MotorSport 1 imóscapo 4 frutificacións 6 perfeccionan 1 paroral 2 Madeirã 1 live~ 4 hornos 2 handheld 55 lu 4 Perviy 2 Philosophisch 1 Jurdäkitämä 3 Fraisse 4 girondica 88 inactivación 1 Glocóxeno 1 Hanukka 1 fiende 4 geodinamiku 1 hidrolimpeza 1 Fusiladora 42 lanceolada 1 Milisauskas 9 Lohman 7 Hafen 2 Langas 1 mobilizase 6 Myslivecek 12 Pascoal 19 Forcados 1 Nyaban 1 hopirru 1 mazelii 3 Iakob 1 incenciado 1 Fascinouse 6 Herbicida 1 Pezza 1 perxurias 1 Hemigrammocapoeta 2 Mehmandarov 1 lípìdos 2 peizoque 1 mañanceiras 11 FLAVIVS 3 neuropsicolóxicas 17 impresores 1 nanofluídicos 1 Heptacarpus 1 macronovela 1 Hammerburg 6 Kastamonu 8 milfollas 1 mentados 12 horrea 5 Odi 6 friten 2 Goujoim 2 Hartekamp 2 Kiakimé 2 incorporarlle 1 Luchtaine 1 Goldenweek 12 Nedda 1 Paellada 2 Godes 14 Imperador 45 financiados 3 Lužyca 1 Nymphaeineae 3 Khafra 1 Hualaihue 1 Kristie 1 Lukunga 1 metalización 1 Mossuril 1 Lanie 50 Helmo 10 paradoxais 1 Nishinippon 1 gazal 1 Pedioplanis 2 intratimpánica 1 lamarquista 1 Petrol 77 nitroxenadas 3 Necator 1 Linepithema 1 Hamoaze 2 nysa 1 Nidorino 1 oldtimerservice 21 horto 1 mansarde 11 hidroxilisina 8 Gomelsky 5 Imprime 12 manus 1 frecuentala 7 invirte 2 fríxese 1 kraeuter 2 McDevitt 1 Grosdeteste 1 multicopista 1 iFP 1 Kittakh 4 ocorresen 6 irai 1 Grootstedelijke 3 Magistral 1 hipoplasticidade 6 mazapáns 13 Helmántico 4 Kash 3 geduldig 1 Maroneia 1 Négase 2 paradiña 1 laria 2 pania 1 Inicis 44 Paxton 64 interrupcións 1 korkeakoulu 4 ISAS 1 Haymanot 2 miotubular 1 Holsteins 3 Fotis 56 Foros 2 Hierba 1 Gnago 6 planimetría 1 nakanokeikoae 5 Mencionada 2 Knochen 3 Juda 1 Guggles 4 iterativos 1 Lousá 1 Johnius 1 Majoratsherren 3 Perpendicular 3 introdúxose 1 Ipsco 5 Lignocarpa 1 imdica 1 Lebt 22 Lazarevic 1 Hunks 1 Linaro 2 Neuenburg 1 pentanodioico 1 miragrosa 2 lanzábeis 6 observábase 65 Im 1 ipsis 1 Orten 1 opulentamente 2 feijoo 1 Pennantiaceae 1 metabole 1 hidrostáticos 1 pequenss 1 OprA 1 orphanos 1 Mamati 28 Gaby 1 ovacionounos 1 marylandicum 1 infrarvermello 1 patellina 5 Hyogo 2 lwyd 116 mutante 2 Kopet 1 Nemzetet 1 Mneiae 1 optimizou 20 Fía 18 Gorm 5 odontóforo 1 Lempicki 2 kyanos 4 Oberge 236 Hokkaido 1 Malladas 1 Libérate 5 isodiamétricas 9 Kurri 1 Niederbottigen 1 Gwynnog 2 Hardanger 294 marcadores 1 Nessia 2 Khurri 427 imposto 1 Krenatööritark 4 Invencións 1 Kiteto 1 Limenas 1 Martinich 6 Frych 1 massif 1 Labarces 3 honesti 1 Koromzay 2 Nezami 3 Kyrgyz 4 Irtich 1 lenhos 2 Lazaré 9 Palantír 1 GOYTISOLO 4 febreiriño 1 pdes 4 Leopoldovna 148 Osetia 1 lexionareo 95 federados 1 Leao 1 Garthok 2 Llibertat 2 Keenleyside 1 Feréstecs 1 Gardians 7 nitruración 1 Misántropos 1 katloan 459 intervén 3 Kuttel 4 plausíbeis 1 Jabaliyah 1 nisu 1 Hoceinia 2 GHOXRIN 1 FLEM 56 mácula 4 Fellig 3 jako 44 libere 1 Matermare 1 Larrieta 160 plastos 431 matemáticos 6 Pásase 4 Kailash 1 Mishra 1 Gymnasien 1 LiI 1 Platysace 2 Istriano 1 Jemas 1 Hibbing 1 Megacorp 1 kingfeatures 1 Macripodari 12 Mear 1 frigoríxeno 1 gatiñas 7 incultos 1 Mayone 4 necton 15 permítenlles 1 haddiem 4 miragre 35 mag 2 Musolini 2 metastásicas 19 Giovani 1 Njala 1 guoikkaid 1 pasaitarra 3 Iocundetur 257 Irún 13 Molay 1 ocularis 1 LERM 2 Macallan 2 GaliNova 1 Magydaris 2 identidicados 1 Kangxhix^ 1 grandiglumis 1 Musinin 5 Nanporo 1 Ilfitu 1 óllaa 1 Holguinensis 1 Kalifornia 166 Gottfried 260 ferida 2 Garbe 1 Örkelljunga 1 Majal 1 Lesionouse 36 Kolmogorov 1 mnáis 1 Hamamelididae 2 igrexaa 1 pandebono 1 lumpo 3 Planudes 1 oostgevel 2 Lesh 1 LINTEA 1 Halmasd 4 osmoprotectores 9 mezcla 2 Orzolek 2 Fuagea 401 investigar 1153 infancia 2 Mediña 1 paze 36 intrusos 16 incesantes 1 Joab 1 Nefrectomía 5 informaría 291 formarse 1 lapponum 2 mathematisch 4 Malfadadamente 1 malaki 1 nasgh 1 Permafrost 911 Foron 4 marxinalismo 68 levas 1 Panticapaeum 1 Penouces 1 Koete 1 Fremiot 1 Hydrastidaceae 1 Haizearen 12 Magnoliidae 1 Karadjordjevicu 3 Granulado 1 piracatinga 2 Piyadasi 1 llanura 2 kono 1 Fontarriba 2 olimpiade 1 ichthyophaga 1 Histopathologic 2 mellorábel 1 nutroxenada 1 fitobentos 1 idiosincrásicas 3 guiris 1 mantérse 1 felísimo 1 Kay† 3 hydnum 42 Medicamento 1 Izaba 1 PetionVille 2002 inclúen 36 indiana 3 Lovrenovic 2 mancillado 5 osen 2 Naruk 20 fecundo 1 pampanga 1 k?etwar 1 FCR 1 gavota 1 Ghisolfi 1 matalahúga 1 Kowel 2 Malacatancito 1 Interferómica 3 fundarán 1 Monferno 1 Monogyna 4 Montella 1 Iraquis 27 Maciej 1 Johnes 1 Hidroxipropilcelulosa 1 fristelse 3 m?m 1 huilana 1 inhíbena 7727 momento 2 intimo 1 magnánimamente 501 Heat 1 Josquinus 2 Pairaud 1 Lindgeren 5 irresponsables 1 Iniki 1 Pesimismo 7 HFE 1 Maqamat 1 Krachan 9 hooligans 5 orbignyana 24 mouvement 6 Parapluies 1 Galeommatidae 3 Frankestein 1 pincheiras 4 fog 1 Hrisopií 1 gomphíous 3 Nanumaga 1 impedirlo 2 FTPd 3 Kalimanci 1 kljatvu 40 laude 1 Nikolett 5 Lungharegi 4 Leitariegos 72 kgs 1 Firat 1 Ilyra 2 Hvarf 1 Izbieglize 3 Montesilvano 1 Pagurodes 1 oroit 1 Merilán 2 Fotakis 1 Pelussin 1 fixándoo 1 Oroña 9 Kaoru 1 interacraneal 2 Fareham 3 Kaarlela 74 Galiñeiro 1 moéndoas 4 fortalecidas 1 mailaisiana 1 nascere 1 magnolióspidas 1 farzandeš 1 Junkboy 2 masticables 3 oporá 2 Febrífugo 1 Mirutanku 4 microfichas 1 Maetkara 1 Konkichi 1 fomentau 1 multifármaco 7 Nasional 19 libacións 2 fortalecéronse 4 Grønkjær 1 italoarxentina 1 Malfaiteurs 2 heterospóreas 5 Nuts 1 Figurando 2 Leixaprén 1 Parelelamente 3 Monolaurato 1 Girar 15 montarse 2 Gamio 1 Motosicleta 1 Intimi 13 óvalos 26 Investigador 1 Pepis 4 Orphile 2 Greenhands 1 obsequioulle 1 Heusinger 1 Mauler 24 Mâcon 1 neoántropos 1 Fresnéu 1 gorrotozko 3 pizca 1 Gabanxo 7 Olle 2 Pf 1 Forbin 34 murciano 1 Pinterete 8 Miau 1 lloros 1 Khayanu 1 Fangeaux 1 Mangorongaro 1 Katsuchika 2 metaliterario 1 fidelísima 1 Guékpé 1 Gabrels 2 Muz 1 Kilmastulla 3 hipodámica 1 Golban 2 manteñemento 1 melanocaulon 1 Gwlyget 4 Passengers 178 Pasa 1 Grandhotel 3 Phila 2 Loefgrenia 7 Pitarch 2 Photomuseum 43 Perdidos 1 Normalizados 1 Kwidzyn 1 NetOverflow 53 inspira 1 fansubs 1 focul 2 MULLERES 1 Parlementaire 2 Glennan 1 Haplovirales 2 Hildebrandslied 1 Kirzhach 2 Lert 1 galegoasturiana 1 Iduaria 1 Omagá 1 Khilafat 1 Gysbrechts 7 Hatutu 1 miado 25 interrompen 2 HGO 173 lámpadas 2 irónicamente 1 narbasi 1 Micoquiense 4 nak 10 inaugúranse 1 Kokkini 1 Kankyaku 3 Fataga 32 Inmunidade 1 fotocromos 4 Perforación 4 ORIM 1 longinux 1 operabase 18 haiku 4 Grisones 8 Fragment 2 lenzuola 21 Glorioso 6 Fanon 3 IBB 1 melanacantha 1 Gliclazida 2 Kajika 5 Kellett 1 kwen 2 Galgani 2 MacIntire 1 meténdoos 2 intergrupo 6 habituados 1 obtusángulos 1 instrumentalízase 3 hiza 1 getElementById 1 oftalmoxerose 1 osynlige 1 leuro 1 Kiezegem 10 Osh 1 itai 1 karas 1 Nepirastia 13 Hausdorff 51 óboe 1 microimaxes 31 homoxeneización 1 Kagi 4 mioxénico 6 oradora 3 Halorhabdus 6 FELIPE 1 Hifter 2 geopolítico 2 Jugendgedichte 1 Lymbraya 1 Guervós 7 Khoisan 4 Hidraúlica 3 miela 1 Imapro 1 Gungunhana 1 Imen 35 Mestura 5 guanicoe 1 Ingwy 1 micósidos 2 Neixon 1 Lexió 1789 obstante 11 mostraría 1 JULIAN 2 Namentras 1 interferirá 1 fols 1 Gronios 11 freadas 6 increíble 1534 favor 1 Kaabse 1 Phönix 1 Groten 3 Galaheart 3 Interceptación 2 oxalilo 1 nursery 5 homeomerías 2 MetropolitanMuseum 1 LIMC 2 Nowogród 2 Feloidea 5 Paleface 3 naquele 8 géiseres 1 Laryngale 1 foil 19 fly 2 Minnetonka 1 Lilaeaceae 1 Læwwæm 8 perdus 1 Kickstar 1 Jörgl 2 Gobantes 2 Pengin 2 muticus 1 Peruxia 11 Misaki 6 lagarada 1 Guci 1 MERP 1 Muidumbe 2 Lwanga 1 mestrescola 1 flambées 1 InfoPath 6 nordmanniana 1 juncifolia 3 Mook 2 Hermon 4 Gilels 2 limítaa 1 impolarizábel 1 peroximonosulfato 17 Moments 7 petequias 1 Lastrange 81 marsopas 1 i?arakoit 1 Gourad 1 Hydrilla 2 mercenaires 6 Ficoloxía 1 interligadas 1 Interni 5 Notaris 1 montebelloensis 2 Larocque 1 flexionables 1 gnidation 5 Kibuku 1 Oberbalm 1 Hipertimia 9 Paranhos 3 Kilner 2 Pdx 1 narezushi 1 intraaórtico 2 Phytosauria 2 nucleando 1 Palacopas 1 Grafarkirkja 2 Muciano 2 pensaches 7 paraninfo 4 Îlot 1 Himbry 1 feofíceas 1 Lautenbahs 18 iberoamericanos 1 penibético 1 piogas 1 Nikal 14 Nishiwaki 39 látego 3 Heureux 1 Libertyland 1 katesii 1 mósuo 1 Gachalaemerald 6 Kojiki 2 Fuzeta 5 Operazione 5 maudit 1 Maniáticos 1 monofuncionais 7 Jóhannesson 1 hipoaxensia 16 patoxenia 149 ocupaban 3 Gingras 3 Musker 15 Filipino 7 Mintireiro 1 pasaríaa 1 interrede 1 Hufangalupe 1 Osaekomi 1 Kemball 14 Marthe 3 labradíos 1 glorifier 1 Leacche 1 namu 9 ICQ 4643 irmán 2 janeiro 25 Folio 1 Mezzotinto 2 Lanini 9 Paulos 1 hidroxenótrofo 1 menipeas 1 Mercio 1 Isolaverde 1 Ocln 1 Mangercratie 1 omildade 1 hidroximiristato 5 glaube 1 fraxiliza 6 microtopónimos 1 inmortalizó 4 Piqueira 3 Kircaldy 2 heliciario 3 hidrosalina 2 garfio 8 Ismaël 3 Numhauser 36 penitenciario 1 Gwellañ 2 MÁIZ 1 Manthey 1 nomenativo 1 Límpate 1 kerp 1 incarum 2 Lobaye 1 oustaleti 1 Lembrábao 1 oshieyo 414 Local 5 pelellos 10 Fundaron 3 flavoviridis 1 Lovelita 2 Fillipov 4 intramuscularmente 3 Jehnna 2 Gabinetes 1 Oosumi 1 Ironbar 1 Morgenländischen 118 inspección 3 neurocisticercose 1 Jaunkemeri 2 Peba 2 Krill 9 Pelletier 1 Paramaras 1 Landrú 11 obrigáronlle 1 meminna 1 isopetala 1 katholikài 3 Iras 4 Midhat 1 Geribert 13 furgón 2 Ianevski 1 ?KBC 3 Hilbeck 6 Infância 9 fastuoso 1 Kilde 1 meritum 3 pinchada 224 Montederramo 1 Ixtoc 2 Lipoxixenase 2 helvecio 1 mimados 12 Langer 1 Faurot 1 meixacán 3 Microbianos 1 mào 1 Focia 2 habitúanse 1 formae 3 Friedrichstrasse 1 maxo 1 Kedhammar 1 medicos 2 Hecate 5 fomentaban 1 onorevoli 1 paza 3 Kogorou 1 Glasinac 1 Lourioux 44 nocivas 1 philologica 1 nasuse 1 omesos 7 perilla 2 Karakalpak 1 Jañona 70 Llanelli 1 Heimfeld 1 Metlife 1 Fiúnte 96 Olimpíada 1 mamuquiñas 1 Omkoi 6 Mararía 1 Ouropimente 1 †Megalohyraxda 1 Piggies 16 Hylobatidae 10 oligomérico 1 Massakory 3 Haarlemmer 1 Lakedaímôn 36 himenópteros 2 Imipenem 1 Limés 4 hipoestroxenismo 1 pivmecilinam 1 Kariyarra 1 Lompnaz 1 Klaberia 4 Ístria 8 Lüthi 4 Palopó 36 parapetos 2 GGWCC 16 Jardines 3 mottetto 1 honestae 1 jarri 2 Gaolainn 3 fyrra 1 mustangensis 9 Periferias 1 nucler 1 microscópio 1 Logs 19 heterocromía 30 interóseos 1 Graviola 2 Pénsese 1 meldollon 1 Misaka 1 Fureria 7 Mahdia 1 Náiades 1 moviola 71 Nolan 4 hoacín 4 hemimastíxidos 1 Jedburg 2 habilítase 1 Loukou 18 papeleiras 1 palanquinos 30 mill 2 palmitoleoíl 7 floreza 1 Marimermithida 183 nyunganas 11 granum 8 Fifi 5 Gregis 1 Momrow 1 namaste 1 Neurotrichus 1 GACACCAUGG 4 mastiga 1 Fontanetum 1 Maríña 1 hipotéses 1 Fontanil 1 Jannacci 1 huisse 1 kallaikoi 11 Fonollosa 1 Konstitucinis 3 Oitabén 5 Indro 3006 Nobel 1 festinatus 1 oaker 3 meu² 2 Lemkin 3 Merrifield 1 Mandukya 34 Malas 1 Krusevac 2 hipersensíbel 3 Ioannou 1 Inishnee 1 Kalajoki 10 materializa 1 MahasenaHuvishka 2 loligoi 1 Grandmasters 74 Matamá 1 liutaki 43 Harley 1 Mohaan 2 Haberse 1 palangrees 1 Ma?czynska 7 obrigadamente 1 Morgantia 2 Hangchow 238 hay 2 Humlebæk 2 Haeger 1 ghar 4 indeterminacións 2 Golosina 1 Goeiemorgen 1 Osterix 1 Gaufresenque 16 pechara 1 NZTrio 1 MglA 1 haso 1 Ies 2 Guatraché 1 hu?ng 1 Monush 2 Hayama 2 Patarelo 11 miocardite 3 ljudi 1 Holdfast 1 pendenciero 5 Kreator 2 Nitamono 3 flowering 3 Kanaderu 2 Fenais 1 Hrimthurs 2 lingüas 1 LTM 7 patrocinadoras 5 Kenseth 1 opfert 1 maenianae 919 Mestre 1 Lexica 1 Pereiópodos 1 obtívo 1 monnati 2 Hološko 1 Katomic 1 Irestedt 238 Ligue 8 infraorbital 1 Jattemasu 1 heterodinámicos 1 Krystof 1 Materita 2 pessimismo 6 Inherent 1 Gynge 1 irixoés 2 Peltola 1 Oitbi 7 Nadeau 1 Haymerle 1 Ostannya 5 mixoamebas 2 Lurch 1 muzgeno 14 Óptico 1 Konaseema 1 Gernowyon 1 Lascutana 6 placentados 1 Formicinae 1 frommi 1 Fariseo 31 latentes 1 guaxas 4 maragueí 1 Jerdon 1 MacCaig 1 meteulles 2 Içara 2 Pintelos 112 Palais 2183 filosofía 1 LifeStyle 1 fêmeas 1 nanmin 5 fingers 1 Lichtenberger 5 flabellata 1 Jimma 1 Llanstephan 1 FrameSearch 1 Goidanich 1 Grimwig 4 Imperatoria 3 fotoblanqueo 1 Ladybrand 3 incubadas 1 inductista 3 Karthala 1 huava 1 Nixikan 1 ginecológicas 3 Geballe 10 istu 1 Photokaryotes 1 Fiorrancino 1 monopolizasen 1 indivisos 1 Philosophía 1 inervir 1 pedicura 3 Groupes 2 Noui 1 lather 1 pirulo 1 Masillacolius 40 gremiais 1 germanistische 4 Grosella 299 Lema 2 mecanocuántica 2 Lumieiras 1 Forxaron 1 isonzofront 1 pisoteados 5 Guiñazú 5 Flavobacteriia 1 merostomafos 2 Nasrallah 1 Neuraminidasa 1 gwela 11 Neman 7 manteno 10 Pementos 1 Mokdong 3 impídenlle 28 fisicoquímica 1 Passar 2 Motivaciones 69 Haute 24 Jarque 1 Hairway 1 Llibreter 6 Pennsylvaniano 1 lajta 6 peroxinitrito 2 finanzación 1 hilalianos 2 Guédès 13 Großwallstadt 7 Goeppert 1 Mancebía 2 maxwellii 1 girbão 27 Machos 1 multiconxunto 204 FAO 3 Mikkel 1 Kaskinen 3 Liais 1 Guardizela 3 palpar 2 Hubertusburg 4 museolóxico 1 LEVC 2 Octano 1 metonimiaa 1 Filmfest 1 Hidoussa 2 Nasalis 15 Jerusalén 1 hillul 4 LeFlore 18 Lindy 1 mahas 2 NERVA 1 Gubernatrix 10 Nunivak 49 Mántaras 1 monachorum 3 Limbach 1 Lekiskochiton 3 Interrexional 8 Morane 1 Halinard 1 Pircas 4 Hypatia 1 Metrodo 1 fluorimetría 1 nsire 18 kMTs 3 Lagizarrak 21 Linosa 1 origina 1 Kurzrok 7 Feder 4 hidroxibutanoico 1 Heteronormatividade 7 Muprespa 10 Homarus 122 GDP 2 Guanacoa 1 Melicerta 11 microbiólogos 1 Geographico 2 Phaenicophaeinae 1 Foixá 2 Opened 4 Finlaggan 3 Guanapay 2 Osdorf 1 Negrumante 3 Móbel 39 Gallagher 1 hippomene 3 Kobun 38 minutes 1 homalophylla 1 malwani 1 neuroinvasión 1 Mshvidobit 1 Grauet 1 Feital 14 Fingal 5 Parasito 1 Heredera 1 iscariote 3 operculada 1 Iguazu 1 isoparafinas 1 Golive 1 percibiran 1 Lepelley 1 implicarme 2 massaicus 1 penicilinasas 1 Masculine 1 iut 2 mojarme 7 Patua 2 latinizar 10 identitarios 18 personificada 1 Myarn 3 Ilírica 3 fricativos 4 Gwendolen 1 inesprimibile 1 Ostrozac 7 Parken 1 gasterais 1 Micobacterias 1 Fusis 1 garxola 2 Fernsehsender 1 Parathropus 1 ICEP 2 formateo 38 heterodímero 6 Neophocaena 1 lineage 1 grandísmo 2 Olvan 1 Mitsima 1 perseguibles 1 Neviges 1 Maléolo 99 Kubica 1 Lopadea 26 Movies 1 Jughead 90 Peneda 1 Panchoy 8 Friederich 1 intranasais 1 Gadatazul 1 Permaneció 10 Mastai 1 gou 33 inadecuado 3 Genetrix 5 Menxeviques 1 Grobe 3 Gubaidulina 1 Gabréa 1 Knirr 1 Hupeh 1 inmunotinguido 4 Iulii 4 Furuta 1 heliocéntrico— 1 IMPATT 2 habibi 1 Finarolli 1 manqué 2 outonizos 3 liliópsidas 1 Mogincual 1 neworleansense 1 Kabang 8 moros 1 hidroxílico 1 Pitama 3 montanum 1 nematófitas 1 Paralpheus 1 Perseguen 1 Magiclown 1 Nidios 3 Pediocactus 1 Meduse 1 Illagona 2 Lazpa 1 flavoconia 9 petroquímicas 2 Lezgui 9 forxando 1 Platone 1 implicativos 11 Hermíone 1 Fandila 2 fatado 2 Motorcycle 1 Hasuburero 1 'pi?sa 3 obténdoa 1 Laubmann 136 indicaba 1 Fanshaw 1 Marcomanos 1 Impulz 1 Meisha 1 lonrgo 9 Lavín 4 flectores 1 Isshiki 181 florais 2 Pallamallada 3 Ievgueni 2 modificadora 1 nepalense 13 Keefe 3 Mowbray 1 Gemistus 1 Micenei 1 membranifolia 1 Luckhoo 1 kerdwr 15 plante 20 islas 1 Heroux 1 Marlothielleae 1 Lall 47 fúnebres 20 perestroika 1 nonos 1 Paraceraterios 2 Lastelle 5 Noxa 322 intoxicación 2 —Johann 1 Kanzel 3 Mayrata 1 Inspirational 2 Nejaki 2 Kheng 1 Mrózek 1 Kjøbenhavn 2 Lovick 7 Omihachiman 1 financie 1 mexedor 4 Hillingdon 2 intelectos 1 octanil 2 Hilja 14 Hoa 11 glosemática 14 GTA 1 impas 1 Joussef 1 Nebhepetre 7 microdon 1 Koimale 1 loxíxtica 39 leucemias 80 Isaías 1 Ofalia 5 Matsushita 3 Juver 1 Izaak 1 Karumbé 1 Méixamo 18 hipercolesterolemia 1 parapluie 1 fluctúen 12 Ipatii 1 percheiro 1 merecio 1 Panaewa 1 muruti 4 Labine 59 Lund 11 panadeira 1 Fueran 1 Narraganset 1 Lanzenauer 13 Gees 22 metalcore 1 Juanico 2 Perfectae 29 Giemsa 1 Netty 2 Nunggubuyu 1 Mitsamihuli 2 moneduloides 1 me?enyi 32 oncoxenes 3 iracundos 1 Maroilles 1 hendersoni 1 Ibarluze 6 limia 2 Moha 1 financiamrnto 9 integralo 3 incidiron 1 Huyssteen 1 hetkistä 3 níscaros 101 Nervión 1 MKIII 3 Numerarias 5 Ninian 1 Mausbach 1 Karabah 2 Moitessier 9 invictos 18 Lehtinen 1 Ghrous 1 Kornat 1 nuevu 1 Novokirghiz 13 Inundación 1 FKM 1 Khas 1 Grazán 1 guddick 29 homologado 38 Linkin 1 Haláligában 1 Östen 4 gör 1 Jugendbuch 1 Lafranconi 1 Orchidinae 20 Langhans 756 Lois 34 oligómeros 4 Jayson 1 novrmbro 3 Malocochersus 1 národné 27 Macaronesia 2 Kulturforskning 7 Gritalo 1 Pasábase 1 Girlvana 1 Lateropora 590 lento 3 Ombudsman 8 Nehemías 1 Koigokoro 1 Moncelle 1 inefectivas 1 metschnikowi 1 HIBEPA 3 pigargo 1 ojóm 1 Naziri 4 Gwylog 2 Gloses 1 Osteosíntese 2 Pedíuselle 16 Patric 1 homoxeneizaba 1 Osse 6 loben 1 Haardt 1 IElA 1 Marattiaceae—e 1 macrosintenia 1 Kukan 3 Khama 16 Istambul 1 OCLUSOR 1 Frutopiranosa 4 Ibisa 47 Huntingdon 1 Landoeira 3 krenut 2 ictiosaurio 3 Kalólimnos 1 Filiere 1 megásporas 4 Nimrais 7 McKnight 1 Nürbugring 3 nema 87 formaría 1 Laenkha 1 Liun 4 Pairs 1 MATCH 1 Markeb 1 FBM 1 Keftiu 1 mucher 134 Leibniz 1 notificalo 40 pilotaxe 2 Hersey 45 nus 1 Ljuhijana 2 Mascioni 2 Peccatte 1 gerou 1 Jahrtausende 489 nalgún 1 gulansés 89 peptídicos 2 Gârliciu 131 Lig 1 hibakusha 1 Kolleen 3 Kurabu 1 parecemos 2 metraxes 1 Morgenweck 14 Oña 1 Lechitians 3 Guttaviridae 1 feltrino 1 Maalef 1 Manifesten 6 Holártica 1 mediterraneísmo 1 Feysal 1 hotellet 1 Geomantiae 1 Libatique 4 Miracoli 1 murzela 1 LLÓPIZ 2 Gadner 1 fixante 2 Merecimos 2 Giandomenico 1 minia 3 Menen 2 Nahu 24 Grégoire 1 guerrilha 2 Nemet 1 Maconho 1 Flóris 1 Østermarie 2 Mariama 1 Oficialización 2 mamotropas 1 Hodeida 1 Guillonea 8 Nanao 1 Hordonius 5208 nacional 1 pandolo 1 okrestnostiakh 1 Manalt 1 instarlles 4 Museumsinsel 1 nictare 2 paleoproterozoico 9 multiencimático 1 Lisímico 1 laplap 1 Largos 1 obrígolle 1 Geometra 1 Hemiarthridae 1 Mesona 17 Kattegat 1 Kaïs 1 manexáronse 6 Pedredo 2 iranista 2 McKusick 1 Jordanthorpe 1 Kambui 6 Hakka 2 Giaccherini 110 incorrecta 1 Kerivoulinae 8 pampeana 21 Kishimoto 26 hayamos 3 ISDN 1 moina 1 impondérable 18 Franchomme 1 Inkognito 23 imperfección 8 GAZ 1 Huvar 1 Ichthyophonus 1 Phonebook 6 Noelle 1 Meravelles 3 orbium 2 lícitos 1 girones 1 Muždiv 3 Madilu 8 Ostabat 5 ketamina 1 Piridoxal 1 outstation 1 miristoleato 1 glmgdianthi 1 peyorativo 1 Jamenei 1 Geomorphology 4 Lexislador 1 fotbalová 21 latinizada 1 Gosudarstvenniy 3 Philosophos 2 Oledd 2 nimmt 5 modernizadas 1 Menciñeiros 1 Offoumpo 1 jesmin 1 fatum 4 Figuraciós 5 Lembre 1 inducirán 7 Iseult 2 McGovney 2 gelb 5 Merengues 1 Naftoli 4 Farnham 1 Petroio 1 Miletos 2 fillade 1 fieiro 5 Gontier 17 Oclusiva 1 Ishigo 9 Platonov 170 offs 1 meningococcemia 1 fortosíntese 3 nif 2 Methylococcus 1 LTmanque 1 Indremisjon 1 parnassum 1 Helenor 25 Fonteo 2 Hatefutsoth 1 penétra 1 llibro 26 lamenta 1 Negaba 1 Niillima 1 informoúselle 1 Galkina 3 histopatoloxía 2 Mishin 29 Paisley 2 impoñense 1 JRP 1 Peitau 1 gnatal 75 fémur 3 Habit 1 ISantomédePiñeiro 1 Kuksi 1 Ostanes 1 Gruenrekorder 2 fóselle 1 laucina 11 Filomeno 1 Iddrisu 1 pensala 2 Nyrup 17 Marsha 2 Hokkeinaya 2 NYWTS 41 Mende 1 parâmetros 4 Hernangómez 1 Lesgart 1 Fónicos 2 Goshin 1 MacGuffock 1 Najicheván 1 Njombe 33 Payá 2 IHO 3 platerinas 3 oxyrhinchus 1 Franguito 519 permanecer 1 PDAD 1 Gratski 1 Krahës 1 Figueirón 2 mucopolisacárido 76 Graba 1 Hexakionites 6 hummus 1 Mexido 1 —Libro 1 Plasmalóxeno 2 Outpost 1 nymphaeifolia 1 Matiolli 2 Moraba 2 Piquero 28 Paradis 1 Málaca 1 fimilia 15 linker 3 Münzen 5 intrusismo 1 Gyaruson 2 Hahhu 3 graciosas 3 Laks 1 goitibehera 1 glicorticoides 1 Laloui 4 Nijni 1007 moedas 2 Oceanografico 1 legionarie 2 Lompnas 1 Khokhanaberd 1 Phigalia 1 onderwijs 1 nedida 18 microlitos 3 Parrasio 13 Parabéns 1 Lacken 1 pictorum 145 Mes 1 Isopor 1 Jambos 15 guedella 1 korp 10 meristemo 4 Kaabong 1 Kiélé 8 paracelular 1 Matyjaszek 4 Logrouse 2 Milenaria 2 Herada 5 jupunba 2 Lineback 1 Féroce 1 Kanatlarovski 1 metzuda 1 Oriali 2 Grinspoon 1 Mânastirea 1 Mountaineer 1 kaelum 1 grafita 7 Licín 4 Keinonen 1 picayos 1 ontbait 2 Osum 1 Gaçpóia 1 investiogacións 1 Mbala 1 Laurean 1 guanase 1 Jakac 1 Inmunorreactividade 1 korbán 4 Haunting 4 Muyinga 1 Lampérez 1 kroeung 1 meditados 1 nexeri 3 Grovii 7 pánica 1 Grannios 1 Nafinotoga 1 forxáronse 1 messages 1 Gallen en 1 Inmaturo 1 gryada 2 Jeulmun 1 Gouais 2 Holechek 1 mautern 2 Metrotrén 1 navalleira 1 melloráranse 1 Largitionum 1 Marionetspilleren 32 Higuera 8 laser 3 Gavriel 1 Kabbalah 1 inteferon 1 Grignasco 4 Plaines 1 patrino 3 metastáticos 2 Fereira 2 Okapa 2 Farafra 1 habitaculo 1 paratéticas 1 listrada 11 hiperuricemia 1 Filmer 1 malaxadoras 5 Ferreruela 1 hatórica 1 impermeabilizalas 1 pairades 1 ocasinalmente 1 macrocontinente 21 Maté 1 KingdomofAgron 1 Fjarðarhorn 1 fruito 47 pesadelo 1 Laulani 7 galganoi 1 Hoffmannsegg 82 hipotética 1 Molazas 2 hiérarchie 3 oporto 1 Ilba 1 gotoshi 1 parentelas 22 intercalado 3 Maurette 10 Peñalosa 1 iñorantes 1 Krujës 1 Ichinosequi 1 imbuirán 9 okanagan 8 mesquiño 3 perecedeiros 9 Pernis 1 ordinamenti 752 Monfero 1 Mashyuu 40 Petrer 1 Gidam 1 Hoitaa 17 Lydon 8 Nazzjonalista 1 Painéis 1 funxibles 309 Gala 1 plántao 1 kazak 6 homófobos 1 Massenmedien 1 Germe 1 Laberintodepontevedra 1 Lophognathus 1 kuckan 1 omanita 4 Indestructible 1 Nictalopía 1 hemifrån 1 habitúal 1 pagho 1 Overmans 1 Hervör 1 Lypovets 1 Myacea 2 indepedentemente 2173 lo 1 fehlender 1 heterocontos 3 microcavernas 1 Habrias 1 Grevinnans 3 Koptisch 1 Ichkheria 1 narodamy 1 histatina 1 pargasita 1 orxiásticos 1 Ferratae 2 pentarradiada 1 Gugalun 1 gorguera 1 Makronissi 1 negándoselles 30 panadería 3 Fluorescencia 12 KOOVEE 1 Fenestrados 1 IPCP 1 kettarah 1 Nationalno 13 Mourulle 9 Natchez 2 mordiscos 1 Klinkhardt 1 Ledley 31 hipoglicemia 1 Haruko 4 impedíndose 1 manicha 1 Latsch 50 parir 1 Hoenzollern 7 fiadores 2 Muradelo 14 javanicus 15 Lapeña 1 Montepelier 2 platirrinos 1 Mambro 2 Henslowe 1 Ovas 10 Jar 5 Maneuver 2 MacDougal 15 Halla 9 Montezemolo 1 Krymteplitsia 1 Hellektro 50 Jodie 1 misli 1 mackinawita 1 Harjameraz 1 Manolette 1069 orquestra 13 Loaisa 2 Kapodístrias 1 Neugraben 1 incumbir 4 peregrinando 1 Gardón 11 Lateranense 1 milžinkape 1 Furkan 40 Massera 213 Petín 1 Ongwata 3 naru 1 Pipismon 3 Omniglot 1 phainomena 1 IRIN 1 nokkur 1 gavear 20 invertebrado 2 Plas 1 paush 1 heràldic 1 nukkunut 1 Kosgei 2 harcának 7 Nanette 1 Herlitzka 1 IRG 1 Hatröss 1 Laasanen 4 perno 1 increduidade 4 forra 1 fentalla 1 omentes 1 Odzaklievska 1 Forraxeo 1 kangsmanei 2 investigaran 39 MAN 1150 latino 1 Hoveden 5 Palazzina 2 maximalista 49 Nogueiras 1 maldicía 1 leatrs 3 Labarka 2 isquemias 35 oa 1 mildiou 1 menorquines 24 implique 1 gelatus 5 Krusenstern 5 mensurables 2 ordinarius 4 parrafeos 1 moli 1 Gabelica 1 fartando 1 invitant 2 Pedriza 2 inhálase 1 Ngarinyin 1 Oluja 1 picche 445 nuns 148 infecciosas 1 Mastacembeloidei 1 malefiche 1 hodleri 114 Just 2 pelzelnii 68 ideólogo 1 Marstein 14 kabuki 1 Lops 31 hastas 1 falocrática 1 peirazei 1 Okupa 1 Hnilicka 70 fechado 11 Miyakonojo 3 iar 2 Fulgenci 8 Piñal 3 Mágoa 128 microscopía 1 Iele 1 Matirio 32 Leni 1 negocien 1 HESSER 3 Inakunatta 149 Fuji 3 oaxacana 632 Licenciado 1 Gravenstein 1 Oakla 35 Nightingale 3 Ovogonia 2 martyrs 1 neurilema 1 KGS 1 Okker 1 fermentándoo 43 Ft 1 macrólida 5 metalizado 1 Pizarral 3 Jell 1 galeguiza 2 FNIII 1 Metchild 1 Kolakia 1 Lábia 1 lio 19 indigno 10 mancomunidades 3 Hebros 1 grease 1 Gondarisco 1 PIIB 3 Glossopsitta 1 followers 16 Francino 1 jogades 54 Inhibidores 30 Patos 8 Kundun 1 Ilejemeje 2 Indirecta 1 Forsskåhl 2 Mareco 1 Himmelfahrtsoratorium 1 Operacionais 1 humidificadoras 1 parapoliciales 1 Hurzuf 1 goaltending 1 Montemilone 3 narina 1 Mahmal 1 Iksa 1 mmbronce 5 mandaría 3 Níscaro 1 kumbanom 1 Ilvese 12 Kaiketsuhen 436 mata 1 Haeggochiton 3 Kediri 5 nefridióporos 1 fúrase 29 Obreiros 12 Fassa 140 orografía 1 Mozaira 1 Overloaded 1 ferrireducens 1 Masry 9 paraula 6 Ojanperä 1 Pitido 5 Moltó 7 Firstar 2 Misuari 132 metáfora 1 Kerchbron 1 Mijoska 8 Páramos 1 Kvernes 1 heterotroficamente 1 MERCY 1 feriadelascolonias 2 Iozzi 4 Mugueimes 1 Mariensztat 1 Micoses 4 girasol 1 Moresco 1 Heiremans 1 Lemland 627 Ohio 6 monoespecíficas 1 hayekcollection 2 Lalana 73 gente 1 markt 1 Noémio 4 Penobscot 2 heredaron 1 Hopei 1 miasta 3 Kieru 1 nervosos 45 fixaron 217 mercancías 1 FIre 1 Hampdem 1 maritimidade 1 Faoide 1 Macropaleontoloxía 1 Homenaxéase 1 Paktia 2 mostrario 1 Jääski 28 iniciaran 1 Imja 1 Highpoint 7 fervedoiro 4 Garrigosa 1 Nyasu 1 Noher 1 goreaui 2 incrementouna 9 ilícitos 1 Limacinoidea 2 Hukic 1 paséome 11 hisopo 426 lingüista 5 mordidas 2 Keiserens 1 Pencarreg 6 marinadas 3 Lanos 2 Grisolet 1 Grooss 1 Mopsuetia 43 nacentes 2 natur 1 holmesi 3 Novorossisk 1 multirreincidencia 6 Meloidogyne 1 Housemartins 55 mercantilistas 4 IGC 4 faredes 1 Láparo 255 Häkkinen 7 Insulae 1 languaxe 2 navis 20 folgos 1 Freizeitpferde 1 Orygmalpheus 3 Ivanka 4 Lennoaceae 7 lectionis 1 Intuíase 1 Pacemakers 1 MacMan 1 Pendergraft 14 Naoki 1 foroquímica 1 Peloponesios 3 Phenomenon 1 LUMO 1 padris 2 Glykys 7 panqueixo 1 Mendraka 2 litteratura 1 Juantxe 3 Laem 4 Ornitorrinco 10 Humperdinck 1 Fourberies 1 Imitti 1 jijou 1 IESUS 1 fyddxyn 2 Imaculada 1 láidir 5 Lindrum 3 Nastase 40 MARV 1 microbalanza 1 letourneuxi 1 HASH 3 Gorchakov 3 Helmwige 1 Franconiense 1 Giubila 1 Fidlovacka 1 MYLK 1 Mutaflor 357 islámica 3 Geranietea 2 Mendele 1 gekkos 3 Orinoquia 8 ocupala 87 Funchal 1 Kabbah 1 osecanus 1 Pasitoe 1 Kiritsubo 1 Olympiaschanze 17 inclúan 18 Ferreiras 1 Hidrocefalia 4 hilarantes 1 Naigani 2 hector 1 kentucky 1 grabarse 1 Muligheten 25 Gamoneda 8 Gopherus 2 langostino 1 Gálich 12 Liméns 1 Faltaron 8 Jaguars 1 Peptidil 7 Oxitocina 26 Megalitismo 1 Gríðarfóstra 2 Molonou 1 Interdependencia 1 Liddes 2 Horszowski 4 Pechouse 1 naufragaba 8 Pennywise 1 Kubera 1 oxeador 1 mdiadores 40 Hortas 3 Neubauer 5 Nemtsov 4 Gorro 1 Lla 21 ocúpanse 2 Henne 1 margadh 1 Moushumi 10 Olancho 3 kikuchii 7 percorra 9 Namerikawa 1 masculinizar 6 Midge 6 glutamicum 1 Lusernetta 1 lacanianismo 14 gascóns 1 Lizzia 1 Orzeaux 7 grandezas 2 Medialuna 1 g?ncl?r 1 Magaloff 1 Impaled 1 Opletalova 3 Naturwissenschaft 4 Hermés 9 Mutuos 2 liofilización 2 Fontún 2 Heliand 1 Luiña 21 lesionados 12 manu 1 piononos 11 Izz 1 implantarase 1 Kaotico 4 Pisanello 9 neutralizantes 1 metabolómicos 2 NORAD 3 levinthal 17 Leroux 23 Montañismo 1 Moaulanui 7 Paxariñas 1 Mariager 3 Montaban 6 Fontàs 1 Orties 1 Fruxivorismo 1 Mouthwash 1 iaoue 20 kiwis 1 Konka 8 Laveran 1 Mojada 1 Jikji 64 Killer 2 Padlock 1 inxectará 1 Kompressibilität 32 Metternich 1 mahía 1 Phalanges 1 Pforta 8 Mattison 38 frecuentado 1 laudatu 1 Ocopa 1 Fead 1 pelavas 12 Jutiapa 1 Paraonidae 1 PagePrincipalEs 8 Lappi 1 increméntaos 1 KaS 1 montez 1 limpiño 1 mambiente 4 insatisfactorios 8 incidentais 2 Irineu 1 golpexados 3 Hewlêr 14 Garibay 4 penúltimos 1 Lovins 2 imsomnio 37 FRAGUAS 2 glucurónico 49 Ilustre 21 fritir 96 Larus 1 Fretka 2 Ladislaw 6 Pitchford 1 oblasty 1 Hematodes 1 Pakoszówka 4 Oisín 879 Michel 1 LopedeVega 1 largillierti 1 lanzam 1 indopersa 4 Morfologia 2 impráctica 1 lenguaraz 1 miralas 1 FeAsS 1 Pizarroso 4 investigaría 5 hormone 19 Mercadotecnia 1 fondements 1 Geométrica 1 Godon 1 golondrón 5 fosfohistidina 8 impacientes 1 furantes 2 OPV 1 históricoas 2 inspiraríase 2 Krnov 66 Frida 1 Guacuco 3 Nombrevilla 1 Khasab 9 Gagnoa 1 maldivio 1 letalis 10 Paella 1 Grounded 1 Irmaos 1 Kurumoch 1 MPondomisi 1 ingrio 4 Onazi 1 homoxenizador 1 LiLiPUT 3 ostringstream 1 losqueadas 1 Moreta 2 megabit 5 Mondays 8 Hedmark 4 Kartl 1 Luglio 1 mostacha 1 pastoréase 1 Konjina 1 Harison 2 Madhouse 1 Kašice 1 Keawaiki 7 gonococo 50 Hayek 5 Herkunft 183 invadiron 1 Osieck 1 Moringus 1 Nauplio 4 Mauxi 2 Persekutuan 4 ordenaran 62 grito 3 Geschwindner 7 Hewland 3 llevamos 1 Pingleton 1 lixiviacion 1 Placename 1 neutron 3 Labiszyn 1 Maverik 2 Fileuse 1 genêt 5 masoquista 2 Migha 2 permañece 1 Inghirami 1 Interreto 1 Gangdise 7 learning 1 inmunosupresivas 2 Napola 1 Kimera 2 Pantaleo 1 Lartama 1 Ouguiya 1 Iaks 5 Hazan 1 Laocoon 1 hekatón 1 Mtawarira 2 Mandayona 1 Pilotar 1 històriques 1 Plâtre 1 Generální 4 Mayayo 1 Meidunio 1 Ióbates 1 Flemion 1 Ilergetas 1 köpenick 5 Krymov 1 Hadž 1 Obbligo 1 interazione 1 PetL 1 impeturbabilidade 2 Oenotrichia 1 PhoenicianE 2 Müntzing 2 Filago 7 francóns 2 Peasants 30 Lituana 4 Khaldash 1 Fregelius 1 Neurofibromas 1 Halimolobeae 1 Lasana 7 fición 4 friuliano 1 língüística 24 Maquillaxe 40 MacMillan 26 ornitoloxía 80 Marianne 2 fard 1 Herculania 1 Frasnacht 4 Limenaria 1 ovulatorios 2 Pangborn 1 OBRADOIRO 13 Fleta 1 Ldínkoi 10 inmobilizada 1 Fetch 66 Mein 1 multihíbridos 1 Iasu 1 marcó 10 Nast 1 narodne 16 inchazo 3 Flipendo 1 Gallirallus 146 Pitt 1 Muinha 1 Makuuchi 1 Pilce 1 Jongleur 2 Joacim 1 Fontanosas 1 lærarar 1 GERAIS 2 Mahajanapadas 1 Nitrofurantoína 1 macrocélulas 1 Jalisse 1 Haydarpasha 69 Ferrero 5 Orientados 1 Periplomatidae 1 Haizmann 1 kaldalt 1 Livella 8 irrealidade 2 Jakoba 358 Loureiro 1 herkkäuskoisia 1 libknewstuff 1 MORADIELLOS 10 glosarios 1 Flegyl 2 panchronique 2 fallen 1 Mysowice 3 Lapi 2 ofrecéndoa 7 Narbonensis 3 Frigorífico 1 Heshván 1 Keft 20 millafre 3 Feodora 1 macroquirópteros 2 krajs 1 Parkvall 6 isquiática 1 Hierosolimitana 1 Galciia 1 Llwyth 4 nucleocitoplasmático 1 granica 1 Metaxytherium 1 Historicos 1 Kükenthaløya 1 incian 4 musicalizadas 1 oppilat 10 genes 1 Kotromanovic 1 obxectable 4 Mavra 2 Pinsky 5 Petko 1 Münserland 1 homoeoprophoron 2 Muak 1 Pelješac 9 Niimi 2 FICM 4 ferberita 3 Jran 1 marrás 1 martítimo 3 Jasseron 2 Kornienko 1 Guieral 1 passievrucht 2 Perolio 1 Petio 427 pasaba 1 Membibre 1 kisiskaciwani 1 Faloo 1 Lazy 25 Hespérides 2246 g 2 newFib 7 Igrexia 4 Payerne 1 Fortunus 9 Öcalan 3 Myrmecophaga 1 Périx 5 napolitanas 1 outa 5 multifractal 1 MOLU 1 omilleni 1 Phox 3 Mañara 2 Mellanby 1 hiz 3 noviazgo 1 nomenclature 1 Güttingen 310 india 1 maldada 11 Masquerade 1 Pinjareb 1 meile 1 handia 1 odiáronnos 1 linee 1 Plantou 1 Ferrare 4 phyla 5 Llibreria 1 Finiguerra 1 Lagorzos 1 Grushenko 1 Ichihasama 1 fynyddig 2 LIBROS 1 Mainha 1 particularizar 1 Julianstown 7 Irpa 1 ParisTech 5 ollados 1 Loneliness 1 neurohormonais 1 Mámora 1 Manora 1 Malomyotismon 1 Maiestati 1 Nerdanel 1 incurabel 16 Mieczyslaw 151 Ilíada 2 Geoemydinae 1 Franquean 4 monoésteres 2 Playeros 2 investirá 1 Lozinghem 1 fører 1 militarizalos 1 Plaquemine 2 judios 2 núvol 1 micótico 1 Litoheterótrofos 3 Galdos 2 Grièges 1 menciónelas 1 Leptocéphale 1 flebectasia 1 Grida 1 Pentacefálico 18 neprilisina 1 motio 1 Illustrierter 1 KALOS 1 inevitáblemente 1 Galitsie 1 Huls 1 perifana 1 lep 22 Kusatsu 4 Gnosis 1 Manuscriptos 2 Larsinhac 1 Harben 1 haigü 1 parécenme 1 Laqant 1 †Oromerycidae 1 Gilukhepa 1 Piozzo 2 Melendrez 1 Hemartros 2 Hàn 1 máiis 1 Nanomateriais 1 lamentabeis 1 geolook 2 Petrovka 12 ferrocaril 43 pegados 15 inexperto 1 Kohleninsel 1 IMPRESIONES 19 Gansu 1 öröm 4 ignoralo 16 Gudín 3 lineamentos 5 Marianao 8 monasticismo 1 impartiendo 4 Judenthum 1 Flósculos 1 Pishiyauvda 1 Pharsale 26 intrigante 9 inalienable 1 Microenxerto 6 modificables 2 Muface 1 Hidrológico 1 microestrucura 354 ligando 12 monoespecífico 5 Matheus 1 Hungría— 1 metacientífico 2 infraestructurais 2 Ivu 1 otoe 3 johnsonii 1 Glalie 3 Fonso 43 Nuoro 1 Gypsophoca 1 Naoleón 7 Jørn 1 Hoogvorst 1 Frühlingsturn 1 Gurueba 81 movendo 1 Guarrona 11 ourela 4 lamelibranquios 2 periorbitaria 2 furlane 4 improdutivas 1 obsesioa 18 paralizaron 1 Heuvelrug 1 mostrareivos 90 forraxe 1 Isara 1 Paratomía 353 felicidade 1 Liotard 1 GZK 2 Fritanga 1 Hongkyu 1 Longometraxe 1 gebraucht 1 galapagoense 1 frearían 5 perségueos 1 Moráguez 2 morfoespazo 24 Kundera 1 Kuwabata 2 Mamertino 1 Freisnu 1 mentén 2 Joust 1 Iljibal 1 Katafaga 1 FUSCO 8 Llovera 1 mesturará 1 láseré 23 Hidrografía 2 Leucant 5 mertensiana 4 Gaule 1 PGO 1 parafrontais 132 opoñentes 3 Judía 20 Párkinson 5 Moreniña 2 Fortunatov 1 Grandseigneur 2 oiron 4 Makerere 15 Glenda 3 Heger 13 mortífera 1 Hidromedia 39 Planicies 4 Mišo 2 fúnguicos 7 Foote 8 icosaédrico 4 Penns 1 PírricasImperio 4 investilo 1 Ogallala 4 Intentaron 6 Hopson 1 Guichandut 2 Marchmain 1 Hiruretan 1 konacha 1 Paraty 1 Lebara 3 hipocolesterolemiantes 22 marginatus 3 Karno 8 Menyanthaceae 6 Folc 1 Fútbolista 1 individous 1 Minnawi 1 Marroquin 12 Giovinazzo 1 Labotas 1 mánoa 4 gaivotón 1 Gaelcholáistí 2 membrano 2 Neoproterozoica 1 perchero 1 incluiirse 1 Hoosic 1 Kodan 1 Jociléia 7 MixRadio 51 manobrar 1 Lloraquí 1 organique 1 Graiul 1 mantenndo 1 hidroxenacións 1 lorosa 2 kriolu 1 Hakuryu 1 nigid 30 gasolineira 1 Jadav 16 Lorne 4 HRE 2 Khadir 23 institucionalización 1 Hylpersk 2 idealizador 2 Holloman 1 Pakistanís 1 Huasteca 1 pínteaga 15 fiscalidade 1 Kircheis 2 ndu 18 Legido 3 Harrods 3 mantenido 1 Mulleriñas 1 Mistelanea 1 Ingolges 4 fermentables 1 pachán 1 nuotros 1 Hwasun 1 Khareitoun 94 Gotinga 1 NOC 1 Kitbunchu 2 Höger 2 gambirí 7 Olwer 1 mjaðar 3 Kamptozoa 20 Ochroma 1 Kowalewski 1 Metawiki 1 Idjwi 505 funcionais 1 Ölfusárbrú 6 philosophicus 2 Malévich 1 Lassy 2 piraster 1 Kaserine 1 Montolino 3 mozartiano 1 Penedas 4 Municipalidades 1 fiscalizadas 10 megaquirópteros 1 ktunaxa 1 Hadjeb 1 Moonfish 1 Kalimbo 4 paláns 1 Fronleichnam 1 monorrimos 3 Olimpeión 1 jagged 2 manolas 1 GestureBuilder 2 Orset 1 Heaberht 26 hostaleiros 15 Gose 11 PDT 1 ktha 1 INCHI 1 Janosi 3 guindadas 2 Octonións 2 períxinos 1 Kaduri 7 Hevea 1 grabkatalog 2 Peard 25 Junquera 1 frustratorios 2 Petzet 1 Ilusao 3 Moorhouse 1 Obere 1 Ndlovu 9 jannaschii 58 Mudhoney 1 glagolitarum 1 Phyllomeniidae 14 Leisure 1 Greogorio 1 paquetazo 884 intensidade 4 Lindano 1 pams 1 Macarel 1 glotales 36 Philharmonic 1 Nishioka 2 Hozier 3 Ovieu 2 Oßmannstedt 1 Mygal 488 marea 2 lignosa 2 grrrls 5 Ghan 2 Galrinho 5 Gonna 1 furala 1 Monden 1 Íso 1 inocentadas 4 Gillet 4 Oura 2 Leocritus 2 ludópatas 4 ICIG 1 Menghistear 1 gebbawot 63 Ofrece 3 Fontibre 47 Helvética 2 Kerstfantasie 15 oxiúros 1 Lymbyc 1 latreillii 1 fastigiatus 3 menneisyyttä 3 herpetofauna 2 Montagnat 1 madrealmeja 1 miñotos 2 Pictorial 1 Localizador 1 Periscopio 2 Madremanya 2 mesándose 1 lingüísticas… 1 Ouafic 1 Liukin 3 Monegal 17 Melé 4 Maselli 2 Gardien 2 Helvetic 1 Heydalir 14 Múñoz 52 hospitalizado 1 Kalajärvi 2 Maleval 1 NCPPB 513 negativas 1 Gandesà 1 Mallor 1 Hantsport 1 OLORUM 1 Moma 1 HUA 1 kultainen 1 Magdebourg 1 i'na?jo? 16 palmo 159 Longo 3 Moretta 3 Harjola 1 nanho 1 morte Cosme 6 Majikku 5 Muralha 1 Malasatri 1 n?r 15 Ka?iulani 1 Mohadi 1 inhabilitalo 1 limair 1 gedeputeerden 1 INTIMISSIMI 4 Kristín 1 Fengtien 39 IE 11 materializada 87 Kawasaki 1 Fradamirus 3 Navicella 1 kaya 76 mollos 1 OGL 27 language 1 levantó 1 Killisnoo 3 gyda 22 Mullin 1 Norica 2 HVA 1 gaster 1 paxilline 2 organizoulle 1 mayormente 1 Informatiu 1 NORPAC 1 Kjurkciev 1 megreliano 1 Maasluis 1 Hallebardes 1 kere 2 Gontran 6 Montecuruto 1 Grudziadz 1 opdagede 3 Möxämmätgärif 3 muto 6 Livezey 1 gubi 8 Flush 15 nasofarinxe 2 NPACI 1 Kejserens 26 meditar 1 Hungria 1 Physa 2 Minuartia 1 Maixabel 1 infiltróuselle 1 Nikolskoye 13 Orso 1 Isod 22 fritura 5 Hawái 96 loitaba 1 Metagurosu 1 Marelos 1 Girja 1 kisuku 6 Macla 1 Franzudo 1 Färöisch 4 homocigótica 1 Motamid 3 Ginnasio 1 Lanzán 1 LOOM 1 histotietas 9 Physalia 52 Kidman 2 Lebiasinidae 2 Lügen 83 Hank 1 Pedíronse 1 Jevišovkou 11 MOL 1 Ounalashka 1 Pertunmaan 1 n??o?d?m 1 jednoty 4 Marussias 1 Plaiesii 1 Megathura 1 ofrenen 1 Peraltada 203 modernización 1 intersou 1 Lekoklar 1 Kulechov 1 peridoto 1 PÁNICO 1 Pharmacos 1 kilis 1 Maculinea 2 Liudolf 5 Keir 1 ?Ngg 1 Oromycter 1 lineales 5 Ozanam 31 Palio 7 habia 17 NRL 2 pasarlla 15 niceno 183 Last 2 Hnikar 1 Mehsana 1 Paerangi 1 labreanum 2 ofício 1 Incurabili 17 filón 3 Izéïl 3 pincharse 1 hermítico 1 naturalny 8 foveal 1 Gershovitz 2 Peltapteris 1 Leote 1 nestres 6 Myrsinaceae 3 letteratura 1 Palinura 4 Mursia 1 Nuulua 1 Ganashatru 36 Horford 1 Manics 6 minimum 1 Marrúa 4 MANOVA 1 Medoff 1 libro L 1 panescandinavismo 1 koobiforensis 1 Mesmerised 1 interdepartamentais 1 heartland 1 Hollandsch 1 Hinterglasbild 5 Frawley 1 Kannavam 1 Hasang 2 Kassia 6 hidrodinámicas 1 plague 1 lagártos 1 lampaden 5 Monosacárido 1 Krishan 1 hiljli 1 Marranchiño 14 Penco 2 hidroxipropionil 1 Pallary 8 Kalani 6 Jeno 2 Neherenia 1 pises 1 kariunon 1 hualpenino 1 Koronadal 1 muhurtas 10 Giraldo 16 Pellón 1 Mogiliov 1 forcho 2 maerial 11 labiríntica 1 Lebução 1 Hiatulopsis 4 Pima 214 mecánicas 4 manufactúraa 3 Milheirós 1 kta 6 legada 2 Nussayr 1 pedesta 1 lenogastrim 3 Namenforschung 1 inmunóloga 1 kianolefki 6 maraes 1 Nengures 1 Goaltender 1 Japicx 1 Mhám 1 mecnismos 2 Mazarambroz 2 Kuroshima 1 PIPs 13 Idrisi 49 Interna 2 Petroni 1 Gering 2 gofrado 1 királysága 4 lacte 1 Petergate 4 Lissosabinea 1 Hú?kpap?a 2 hipotenusas 6 Péchase 1 LXXVIII 1 Mitsotakis 1 juli 1 Panayi 32 hospitalización 1 Metacolina 80 Masten 1 mækir 1 Gámir 1 NNP 1 Guycott 1 Philipse 91 Montoneros 1 Houstonian 1 Paemeiobrigenses 1 Hoàn 1 pérsido 1 Montràs 6 ningun 1 Khariboli 1 HEI 1 Immortale 1 Lencouacq 1 Linfoblástica 1 farangullas 1 lipìdica 7 Gares 3 Isóbaras 1 ordenarían 70 Gli 2 Pellicena 2 kuf 10 maiorista 2 Kárahnjúkar 17 Jimeno 1 Glascoe 12 inxectarse 1 marmni 7 infractores 1 iucatecas 1 Mesoa 15 obrigaría 1 harret 1 Lemigius 9 neoformans 2 Henig 47 Montalbano 22 Hushovd 2 Ibicenco 1 meirego 1 marrá 7 Lifou 2 Harshman 1 Neuendorf 7 líneas 2 Oxydactylus 3 Knudstrup 1 khanda 10 Naples 4 Iola 1 Luisetti 1 juny 1 Gustavson 1 Menologitus 1 Minit 6 Gripsholm 1 Nozupasu 1 ficourobililina 1 mmegias 4 laudatorias 57 Olajuwon 3 Guillín 24 lascado 16 hibridacións 1 Morunglav 1 ngkoe 2 hitsu 1 Granyanella 3 Onno 1 Gommann 1 Nicoba 1 Kamza 1 Orangevale 1 pentazocina 2 Kavvadias 1 metiltransferasa 1 lasselto 1 KANNENGIESSER 3 Féile 4 Lapeyr 9 Marettimo 6 Nadaud 10 mitá 4 incrassata 31 Lemaio 5 Ornithology 1 glechomoides 2 Ohayou 2 Maxistraturas 18 Nikumaroro 97 grafito 1 Mariolas 7 gozara 1 Neubecker 3 Murrow 1 glicoencima 11 Pieve 1 Idosa 33 Hove 7 interviría 1 Katheleen 1 Faoug 1 Ferredinha 1 Halligen 1 gewijd 9 Orbetello 1 ma??aba? 1 Kramm 14 macromolécula 3 florae 1 hESC 1 Kitahara 56 forzosamente 1 Manxús 35 MAIO 2 Fasth 1 kadavoor 1 Mariä 1 Foméntanse 2 Fruminio 10 Mukish 2 Pesic 7 Murra 1 Gerste 1 Isenburg 1 Leize 4 Matsuoka 1 globerulus 27 leñosa 2 Geefwee 5 Harve 7 inflixiron 1 Himeda 2 Hringhorni 1 Galvanizado 1 Geniohyus 1 Oregui 1 konípodes 6 lacazei 3 Juvenile 1 Menschenkörper 5 flight 1 Filiais 1 Grevelingendam 2 Kinman 1 Muñogrande 7 Feuillade 7 perversos 8 Latexos 2 Heterosigma 5 Inquedo 27 obrero 1 iliofemoral 1 lasanum 1 lúen 7 llarg 1 Intermitentemente 58 fenomenoloxía 7 muhafazat 1 particuler 1 paeoniáceas 2 onto 4 matriarcais 2 Louganis 1 Micklitza 14 McCabe 2 merodeou 1 iPRuS 1 Manfredy 19 Küng 2 mund 1 microarrais 1 Hargus 6 homeo 1 idylle 1 Hyson 2 fixeras 3 Paneslavismo 1132 Guillerme 4 Jetairfly 2 obrigaran 1 kumala 2 interactua 1 jamba 33 medi 1 Novelpol 1 maamme 47 insectívoros 1 gujaratí 1 Mtkvari 2 Lancisi 4242 forza 1 PEQ 1 ionizadores 1 Iazidismo 1 Ienákiievo 361 informacións 1 Morze 2 Interdata 1 Lovrin 22 Foguete 2 Marekors 1 mesiática 1 Fortificamos 1 Lucevich 1 Osjecko 1 Ghesquiére 2 Finismundi 2 Ganceiros 1 Merquis 1 manumissionibus 7 Kotoko 5 Mammaliaformes 1 kommandos 103 Heroes 1 incluído Galileo 17 Keys 2 HAA 4 LPF 1 Gastrodontoidea 1 fitocenose 1 Josefson 22 paralizada 1 Identified 12 Parazoa 10 ligación 67 micromatrices 2 Hispaniensia 12 Hanlon 2 Koromo 2 Frassinelli 2 Glorieux 2 jaculifolia 1 Odolu 19 Oki 1 homeostenose 3 Nycteridae 1 Isawi 6 ficobilisoma 1 Mizobe 3 FIXa 1 Masdea 79 Morgoth 17 Guan 1 Obledo 1 Marq 1 lexicography 1 Ounce 200 nasais 4 internacionalizouse 1 lombricoides 1 Nucleoplasmina 1 isoxazólicos 1 Marijnen 3 Nationaux 2 Formylmethionine 1 Ogulbek 2 limeiro 1 Jingjì 1 ferbenza 3 Kanon 5 Lizana 1 franciscanista 19 Pinatar 1 Modernizáronse 1 Maschiaccio 1 infartante 4 fervellasverzas 1 Jolap 1 Orléat 4 lanzadora 1 lusacianos 7 inutilizadas 1 mimesis 1 golpéaos 1 Gligoric 2 philosophisch 1 Lurbine 1 IVGuido 2 Macronúcleo 1 maremotérmica 2 lismorensis 3 hierogamia 2 Odilión 9 Nocioni 3 laneira 1 galactura 7 periplasto 56 fermentacións 2 Lassick 1 OlP 18 Graíces 1 finxiren 3 Hatzfeld 1409 pendente 52 file 32 gralla 2 imperturbable 1 grudziadzki 1 Hongxi 2 Ophiologie 66 Juanito 1 fieiteiro 1 Keshin 4 obedecesen 1 Phyllogaster 13 pereion 4 molecula 1 Joapira 1 Metabolic 7 Mansart 1 lyrikos 2 Mesopotam 1 paleopoliploides 1 literary 1 Pityusa 1 Hohenackeria 1 Febrerismo 1 perxudique 1 Garimara 1 Hurraco 59 galardoados 1 limeños 1 Izurquiza 1 oubra 1 Garakuta 68 favoreceron 1 Guerande 5 Norina 2 Lizardo 2 Manyoki 10 intergaláctico 1 ingresábanse 1 Freauville 1 Gênes 2 muestral 2 muxiá 1 Mavromates 1 ?Oliveros 259 Licenciouse 1 Nauburn 2 paxtó 1 Gdyby 2 petacas 1 Oczy 1 Kaxiwa 13 Imabari 2 permeante 48 Fluminense 4 pechándoa 4 Kadettikoulu 49 McCready 1 Hooiberg 4 Houde 2 Kebayoran 12 Gillis 1 Joezjnye 2 Malim 72 Kierkegaard 1 Freudenthal 1 Nawaka 3 Indumento 5 hk 1 lepidorachis 1 Filloeiro 1 Perippa 1 fragmentaque 1 Flensgurg 1 Ibrit 4 paralizara 2 hule 1 fornkonungum 3 Lavradas 1 griersonianum 1822 Noia 1 Lluthu 112 Goiriz 1 hidroxyetilo 12 Faltoyano 2 interconvertelos 4 Himiko 2 Palosanto 1 Ödanböle 6 Naftali 4 Monaca 1 halotolerancia 44 Leblanc 1 Lazzeroni 1 faló 3 Makkonen 1 Marjory 1 Ligadoras 5 Libohova 1 Oustalet 1 Jiyuan 1 fiadora 11 meio 1 Kibondo 53 gascón 1 Imlil 1 Ghoraba 1 notos 1 Platareanu 1 Mahrová 1 Pitfall 2 lodoeiros 1 imbarco 7 melodioso 1 Kaiserquartett 7 Nagash 1 Palaka 1 Onades 3 illándoo 2 habitáronse 2 Generaus 1 ingenieria 1 Nutzfahrzeuge 1 Patawomeck 1 Faraid 15 Freyr 1 karávi 4 Hypsugo 3 Hexosas 1 leucemioxénese 4 inhibition 5 Hiroszimy 2 pampeano 1 Ndemi 1 khamriyyat 1 koloniy 4 illo 14 Hisaishi 1 Kissomaru 1 Pardinhas 2 Pachalum 3 Pagalú 1 gothica 2 Governors 1 MCUV 1 lequel 541 Lola 1 huacas 8 Nausicaa 1 lacérase 1 heterotrofamente 6 parricidio 2 Lanciego 39 Fira 2139 Gómez 1 macrorrexón 2 frecuentara 1 Kalij 1 Lysenstøen 1 inmiscise 1 Khadimanin 1 Llúcia 31 Lyons 1 guerrillera 3 Omiš 3 Paizeis 4 Intentáronse 2 Ignatz 1 maths 54 fotosintético 1 Gaztedija 6 Katarn 1 Négala 10 Kubán 1 Macquaria 1 Iamaxiro 1 Mirziyayev 53 métricas 3 Ganju 1 Huaraca 51 moído 2 pertencíanlles 2 Linazasororekin 2 kik 3 Jamper 112 Joy 1 Lüttich 2 Navazo 11 Llàcer 19 multicolor 2 Lesnie 1 Jinpei 13 Infiltrados 2 naturalizaron 1 herciniáns 1 mísa 2 oraibh 6 pagarían 3 gego 36 Ludovisi 4 Madeireira 2 Ostren 6 Luscinia 1 fornecela 7 Itália 1 Mortandade 1 Momus 1 Fonetica 1 materalizouse 1 Neobisiidae 1 kuningatar 178 fallos 1 Kohi 1 paracelta 3 pianississimo 3 Glencoe 3 obrerista 14 Nicho 2 ourizadas 2 Mahamud 1 insectamens 4 he 1 Lanciensis 3 Lique 1 lid?l 14 Ornamental 1 intelixilidade 2 Llacheu 1 hastulata 22 inviable 1 Nozeda 1 Lagusia 1 morfofonémicos 82 piel 1 IMPARA 1 Pavarolo 4 Onitsha 8 planificados 1 Parcevskis 2 Garó 1 hejiangense 2 Gontzo 1 Paunesti 1 hcp 1 mellorábanse 1 Persidskaia 11 intersecan 2 Maharaxá 2 Kallikratis 1 hinchada 1 Molls 13 funcionalismo 1 MaraDNS 3 Hesperocyoninae 1 ilu 1 Mariazinha 1 Isogai 1 Kazag 1 monosaturadas 38 Novarum 1 Panzergrenadier 1 homoeróticas 1 Foundiers 1 obscurina 1 milleiras 4 Mukawa 1 f?l? 2 Malawski 47 Hábitat 11 Gagarina 2 Lamk 1 Lokroi 1 holmi 1 im 3 Lanc 1 Papasquiaro 26 Planctomycetes 5 Ingemar 1 Interuniversitaria 6 Mycenaean 7 Fenollera 2 momID 1 LIMITARE 1 Lycodichthys 1 Komunistický 1 Köth 3 germ 1 Moltres 1 Fornebu 2 Koidula 1 Gavotta 1 Ortodox 9 gabeadores 160 Ordóñez 81 Malaspina 1 grayanus 1 Pannerden 56 negaba 1 jon?e 1 Gödölö 73 flaxelados 1 Hortegal 1 Memours 23 JD 1 irishrugby 2 Ondula 1 Numismaxia 1 farinácea 1 Gasch 1 Mahanakhon 1 inciciados 9 McClain 1 fetei 4 Hary 1 minkowskiano 2 Fatone 2 interfásicas 1 Obuda 1 Pedocal 1 Lichtenfeld 2 Maià 134 invisible 17 Fillmore 80 Históricos 1 Klinkers 1 Ocak 12 llum 1 Neolítico tardío 1 mutata 3 Guldhammer 1112 inferiores 1 Lüneburgo 1 onlli 1 flares 7 Huth 1 Maillart 71 Fuchs 13 Ildebrando 1 labar 1 líganos 1 Karlevi 2 Frat 1 Jawk 2 Perevolchna 1 Middlegate 7 Pesaguero 1 Iñames 4 gramnegativas 1 NAPTR 9 Ondine 4 LWB 9 Pichu 1 Khazret 2 piquete 1 Hevre 2 HDi 1 Minoo 3 Kralendijk 1 Mondeguinho 17 padiola 1 multirastris 7 Gewalt 1 Merça 1 Lombrives 8 fumado 5 Lauenburgo 8 Obanazawa 102 interaccionar 1 Pellervoinen 1 Liebenfels 17 Meigos 18 mantos 2 Inmunomarcaxe 9 gaulois 2 Khoja 13 Naumann 15 Pacte 1 Lagaillarde 1 Panuridae 10 Natator 2 pasithoe 2 Fucha 4 nop 1 heredou 10 Naqsh 16 ítalo 2 Gopar 1 LTLT 2 Moravskoslezský 1 obligáronlo 1 —media 6 Geelong 1 leggiadri 9 IBT 2 Ngounié 1 moldeáronse 25 incrustados 1 Longueval 1 Piiparinen 1 jockstrap 1 frauenhaus 30 interdisciplinar 1 hauteurs 3 FFSA 3 Koseidon 1 Madhubaï 1 Gegúngez 1 Guanahatabeyes 1 homoxesualidade 3 mercenaria 2 klen 68 Keenan 13 gravadoras 1 individualizaban 3 Killeen 1 organicas 1 Mieta 3 Matronae 1 Levenez 4 Godelleta 2 Norham 10 palmiteiro 1 Lüdendorff 1 Havasu 1 kaito 4 menorquín 124 galaicos 4360 Illas 1 Odjuret 1 iPaRRaS 3 Mologa 3 Leine 1 Goudouko 2 intuída 1 hlas 1 illas Hébridas 1 kellyi 2 Ghokuriuu 1 Gipuscoana 1 Grillóns 3 permíteo 3 nematófitos 1 ligim 6 glutation 790 obrigado 5 Furusato 7 Lightyear 30 itálico 5 inutilizando 2 mejoramiento 3 Lajta 1 Innaval 1 mesclar 2 Gally 1 Mop 1 Flochon 1 Hostio 8 Hinshelwood 1 Migui 1 Houshi 1 Oberwagram 1 galeuzca 1 ljirtãm 1 Oido 13 Nemausus 1 Pivonka 100 forzando 238 Mauritania 9 Intendentes 36 Grimes 1 Galitzine 2707 marca 1 galactosilo 17 levitación 4 Leiris 1 Horská 1 natelillo 1 Jiquena 19 Lexikon 1 Hypoatherina 1 musiques 2 muscovy 1 Isocoma 3 haplodiploides 63 Humana 1 homooligoméricos 1 Monoterpenonas 2 Hautvillers 4 interrelacionado 1 Farò 7 Felpudos 349 Owen 1 moselano 1 Másteres 5 Lionnais 2 habemus 1 Gibas 3 maltaromaticum 2 paddocks 2 Naumovich 2 Paintal 4 nabelschnur 1 NMA 1 Navalonguilla 1 panpina 2 perlífero 9 Galar 1 ??ya 2 inxustificable 9 Milland 1 flibuste 3 Olympics 1 gasteroides 4 marburgvirións 4 fichouna 63 Pardal 1 Lodovisi 1 Munkaþverá 1 Frátria 1 Fronteirizo 1 McBryde 3 hinoki 1 Justimon 2 làqab 1 hectométricos 1 Nesogordonia 82 Marty 1 mirabilibus 1 Miðgarðr 1 Klumps 1 Malkamäki 1 mwisho 1 Goleto 5 Oxlade 1 Magherani 1 nestoutra 1 Ores 5 Humà 1 Hecatomnid 17 orográficas 2 infrecuencia 1 Letrada 2 Nabbeun 3 Kresty 1 Idreo 1 ombigo 3 Obchod 1 kærlighedshistorie 1 Mutto 3 NeverEnding 1 Frieferike 1 Peyrarines 1 Nigrofe 24 Liliana 1 Ossetio 4 Mahuad 2 Lueat 1 Kullebunden 1 Hansens 24 fundirse 2 Martimporra 1 FVPR 1 neptuniae 32 Ignazio 2 Gembaku 1 Loisach 4 mostrándolle 249 Munster 1 Mühleberg 1 falsetana 1 Lesha 1 internala 204 oracións 2 fornéceos 210 flaxelo 6 Faz 1 Iraskundea 1 jotum 1 garantíuselle 1 Isik 1 Mhiseoige 24 petrolífero 2 lexislan 37 Melon 1 noznej 1 jardinier 39 Flahault 4 Femke 13 farmacólogo 1 Grantia 5 Hew 10 Nadador 10 Month 1 Lauris 1 Houweling 1 Marrancos 1 Gallimaufry 4 multimodal 1 Peroniel 123 Français 515 gravados 1 inabarcables 11 implosión 12 neurodexenerativos 18 Nightmare 15 Keyser 1 Firiel 3 Madani 1 Fello 2 intensificadora 2 Pirgos 1 Haematospiza 7 istro 15 Fobias 109 Mouro 1 HDMCP 1 Lutepää 3 Gramatical 1 Numii 1 irascíbel 4 indopacífica 1 Pianíssimo 1 killall 1 Frak 4 phálaina 1 Fiscali 7 Neferjeperura 1 hazlo 1 instititutions 1 perteneceron 6 Lacedemonios 3 Jail 1 maridar 2 Kentaro 19 Finger 1 habitas 7 Lej 1 Ólcades 4 madonna 1 généreux 1 Feevale 4 falseada 3 Meerkat 1 Hryffony 2 Midgley 5 Jungfrukällan 6 mostralo 1 kriustan 1 Mitjaran 3 Israeli 1 italiano Dante Bini 59 musculus 2 Piveteau 1 femeinino 1 Lapanaback 2 minimal 1 Mayurakshi 3 Gardería 1 pintáronlle 1 fuxidío 2 Mellomen 6 Huis 1 Ocillatoria 1 Galatheidae 4 ? 7 FEU 2 pirineiros 1 investigação 4 Hermannstadt 1 FERIDOS 1 Ogura 2 misioneros 1 INGENERARE 3 Givatayim 3 Kjósarhreppur 34 megacariocitos 5 frugilegus 1 Ivysaur 2 inducirá 2 Obry 1 köktürk 1 Kwariani 2 Narbo 1 modems 36 GTB 2 Hanii 1 gilliardi 1 occipódidos 1 patearse 1 holytrinitymission 1 Ishielu 2 ovirraptorosauros 2 Orrico 9 Filamentos 1 imcompleta 4 Paducah 2 Kensuke 9 penosas 1 Manakins 1 netorra 1 nucleosintéticos 5 pensionados 3 Fieles 1 Kalwaana 384 obtense 1 lidara 1 Marchix 9 Pariser 1 Llebredo 106 Fotogramas 9 Kanin 1 Gòtics 1 Luker 4 GranDucato 6 fungi 3 Llega 29 Jesu 3 microsatellites 2 pareces 1 parcos 4 Halbinsel 1 Kurtzuba 1 hipsipila 2 Fuentelviejo 8 heterocíclicas 2 JST 4 Limoneno 4 Luti 21 nono 2 fenilfenalenonas 1 Grimontia 1 Nastasja 2 Oroe 1 KyrgyzPetroglyphs 1 interpartidario 1 Pactia 11 Pedrógão 1 Hemiculter 12 inmunocomprometidas 1 monorquidia 13 Horik 1 Nasopharus 51 lehendakari 52 monólito 3 indice 1 heu 1 naúticos 1 Mudardás 1 Laguiera 1 Gräflich 2 fasquizo 3 Méritos 1 Luxsar 1 Gunwingo 1 Gelgel 5 Isangel 1 perfilaron 14 Imaginary 1 Mejillions 33 Meireles 1 Ogygia 3 gory 3 Fidalguía 1 Ikakali 3 negalo 1 Goryuka 1 Persida 3 glis 1 Lamakera 2 gohts 33 minerales 1 pictográficas 1 Pertenecente 114 Mitoloxía 1 kompsos 2 Gumucio 2 Fresedo 2 febrer 2 mesosálpinx 2 nicola 18 Heimat 17 Magadha 1 joshua 2 Gribbin 1 Nabááh 1 francoagramontesa 3 Hamazi 2 Hadassah 1 Piumque 7 Helsingborgs 1 interlitario 1 Mavia 2 inselberg 1 Jönssonligans 1 Neocolonialismo 2 lucido 137 monarquías 433 mexicana 1 orre 1 originados 1 Feidh 1 Picapau 1 Meddows 1 Gecchelicarcinus 4 Gozález 1 Mortallado 5 Malvarrosa 1 Ocípete 1 Newroz 1 LARRÉN 1 Gripari 3 Grellard 1 Faltaban 75 flúen 18 Iradier 2 Landtage 1 Pepillo 4 Paidos 1 Marcofán 6 Heymann 202 impresionante 1 pigmantada 1 Grenzmark 1 nitrificados 1 Hephaisteion 26 lateralis 1 Hemmental 1 Hemistegia 1 Paralipinia 2 interesará 215 filoxenética 1 Homebound 1 Kiyota 1 Illiricum 5 Feuilles 1 paleobalcánicos 260 Gladiolus 2 federouse 24 Pages 1 Jyanta 1 Mashhur 1 Mutaz 1 Mironic 1 Muh 17 isopentenilo 8 Monticello 7 Pavana 1 mamífera 2 guecho 1 Pimpinone 2 petros 1 Ongayo 2 Parlar 2 partillada 1 Fortean 4 normado 1 muritim 1 Isant 1 joomleague 2 Ioxida 1 Formicariidae 1 guarric 3 Nariman 3 Jarrad 1 pharaô 1 Mattine 3 paralímpicos 25 Holyrood 1 Paradinas 1 Ferreiraella 5 Hampson 3 KRD 3 histopatolóxico 1 hyaloneura 1 Krong 2 incanum 1 '?f?ls 1 Hofliua 13 Ovocito 1 Mauropos 8 investigue 1 istal 2 Periquera 1 Peterswell 38 insólito 5 Februar 1 MTAT 9 machucar 2 Grekan 2 IRANOR 9 Kanada 1 picarón 666 Maceda 2 Nagamatsu 1 Ljósvetninga 1 multiarticuladas 1 kove 5 Orongo 1 PFU 1 fennelli 53 Nevado 1 petalicíidos 1 Mélé 1 Moerkapelle 6 Pibe 3 Pincel 1 opistocélico 4 microvascular 1 organoxénse 1 Marriammu 1 Lustprinzips 1 megi 1 Passamonte 65 medrara 4 Ogham 1 Okondiani 1 kj 11 Pirin 2 Jamayca 1 Jeorg 1 Faucheux 1 Pijuán 1 —inferior 3 Hunanian 1 Keopuolani 2 fau 20 Inimigo 1 Horosucopu 1 Kasseque 1 hyperia 31 hub 1 lacazanería 1 Moreschi 1 NICAM 1 Pendergrass 3 Lloll 226 milicias 30 Pancha 2 Hunts 2 Gasgas 4 Haplogrupos 23 Krahe 1 hematocromatose 3 hectocotilo 1 fctor 1 Fuchsalarm 3 Overy 2 filolépidos 1 GISAID 1 Frauennot 1 Juanri 2 guioosa 37 influínte 2 invenni 1 oliviane 1 Pacioli ou 1 inundara 6 NANOG 1 percórrenos 1 Nephin 5 Korcula 1 Jabarosvk 1 metanoxénense 1 normalizándose 3 investigara 2 Hemidesmosomas 3 Häggkvist 1 Nouormand 2 pils 2 fotomotor 6 fremontii 1 Gábrovo 6 infiltrar 1 jumla 3 Passado 3 Mozarela 1 formicum 2 mundializada 1 novità 1 Nerveux 1 flotaren 4 megabits 1 Fontesambuco 1 Kinlan 1 hypochytrids 1 Naawakamig 1 Flagrant 3 mellorantes 2 Mu?awiyya 1 laanscht 1 noyesa 2 Pelmo 1 Korkischko 3 Mielikki 4 marianum 1 performers 1 Kogure 1 penni 1 marceña 1 novo???? 7 landskap 1 NABORS 3 Orléanaise 32 Larra 2 Leftöver 1 Makkari 17 Paenungulata 3 madeixas 2 fortalecerse 4 mecilinam 1 himenóstomos 1 Ochmazochitonidae 1 mataybifolia 1 Goregrind 13 Gordy 1 ostrakismós 1 Harmonizar 1 nands 1 Krzywicki 2 Invarianza 5 Ibars 1 ireko 1 Kollar 1 glucoproteína 2 hudsonius 1 petrificación 1 permolle 1 Hexaz 3 Handkea 5 liberalizou 1 pimiento 1 Onbaa 5 IOV 1 obedecidas 20 Overton 1 Paisaxisticamente 1 igala 5 Marten 7 highball 2 Lestide 1 Jetsons 4 Kalevan 2 Joueurs 1 Kyanon 1 perdí 1 imposíble 5 Mazuecos 4 Gouled 1 Orny 1 noian 1 Gataia 50 Ljubljana 2 humain 1 Obrasopissez 2 Overtura 1 levantas 1 modélicos 1 Nra 1 Gologanu 1 Nvirakan 3 Microbiotheriidae 1 Médicamentos 10 Himalaya 1 maailmanloppu 1 Kilmacduagh 1 hardyi 1 Geocaching 1 Migoo 2 Irauten 1 magnoliales 1 montaches 5 Opisthocomus 1 Mbuyu 1 Lebovici 1 lezguios 1 IUNGERE 1 Glicas 262 Lionel 2 Gurob 1 fijiensis 58 Jiuquan 1 Famulia 1 Paralélamente 2 Navamuel 1 Keckwick 2 Fallou 1 k?ronos 11 Olten 1 nabiñas 1 incluíraa 2 Mantegazza 3 nigromancia 2 masidá 17 Lunca 1 felicitarlle 4 Nenè 2 planexando 3 Meán 1 nivarox 1 Gokyosan 126 Micronesia 3 fechouse 1 Ibami 10 Phone 2 Masalia 1 Pajarera 52 Logos 1 Hayatou 1 permission 1 kilohercio 1 Nurenberg 1 Khalif 11 lamentar 1 permeabilis 1 harenchi 3 Monachorum 2 perlocutivo 17 gracioso 3 Gloss 2 misios 1 Hermonassa 9 Morhange 1 Ite?ti 3 Mirlea 1 Isokoski 1 Órlov 3 FXIIa 2 GLUI 1 mucronados 4 PDH 1 fomatos 1 Picards 1 Platzspitz 2 NLGJA 1 Numena 37 Misterios 1 Oraá 1 Nísyros 1 Mihiramon 1 muv 1 Hundejahre 4 gallóns 2 Fermosinda 1 fisi 2 Orbaiz 1 MEIER 2 Guilio 11 LAMP 1 imitables 2 ndu 1 monólogos… 129 futbolistas 1 Laurentx 1 lombriz 2 interveuse 2 Ova 1 Leales 10 galloprovincialis 1 murrensis 1 negrales 2 personifícase 1 Neuendorff 5 Farmacognosia 1 Hexose 4 grebas 1 Hölder 5 Fior 1 Garrod 3 Inquisiciones 1 lasséva 2 Neocelandesa 2 Hermia 14 Hospitais 2 Gaveau 1 Fanerogâm 1 leidet 1 Floriszoon 26 parador 2 Holmiæ 1 Larinho 1 munxían 270 Holmes 1 ordenáranlles 1 nemos 1 Nagamune 1 Liiv 1 PEPC 4 Mercenaries 18 médecine 3 Hanadarko 2 Lacorzana 16 oxidorredución 2 Pillaxe 1 Hacquard 1 Laughin 8 Oer 2 Lueli 1 Hellwig 1 Nazko 1 Kikounga 2 Kalifat 1 intentarei 4 kamut 1 Motorizadas 2 Olena 1 llydan 1 flahaultii 1 Mulle 21 Loio 1 idiograma 2 Patavium 3 istes 3 passi 1 Ilyinsky 2 Malfeitor 3 LHRH 1 Isérables 1 Oinaikos 2 Heracleópolis 1 peneiradas 1 kumler 3 Levitación 19 Isbert 1 Miltner 8 metilaminas 1 Patoxénicas 2 filantropista 1 Lohu 1 Peçän 1 geëerd 1 Forretress 15 Golpellás 3 nucleocápside 1 magedem 2 implorando 22 Peach 1 Lauwo 2 isocima 1 helgasta 1 Gempin 1 ganlgios 1 Icónico 4 fungoide 2 Opticae 1 nacionsis 1 Ischikauia 1 Miniopteridae 1 Lezio 1 Moussadek 4 lucis 85 Maribel 1 Mondin 2 gargarízo 149 linda 2 Jankulovski 2 gueinzii 1 hathorico 5 Paniza 100 Infraorde 1 Mompodre 3 Niegolewski 1 pender 1 marettimensis 2 Mejlis 1 Pensilvanian 5 influence 3 Goto 3 Meltzer 1 luciña 2 labradorius 23 fraseoloxía 5 Gastroplastia 1 Muricy 4 Galvao 1 Pandin 2 MALDE 1 mawaru 1 plasmocitosis 1 Människosläktets 29 Paget 2 Graduación 2 Mansels 1 Lobodontini 1 Maleses 1 PalacioDelGeneralife 2 hieroglifos 4 funestos 1 Metacarpos 1 hipercentro 1 HerA 17 mociña 2 Krell 1 Feebas 8 ligou 3 Hepaticae 1 Fundacíon 2 fototácticos 2 philosophorum 1 opistobranquio 11 Oe 1 Moema 1 fotosintese 5 Oloop 33 obrigoulle 1 Lanesborough 1 Otechestvennaia 1 Fedoruk 1 gjuha 1 gabados 1 Karlínské 3 muyer 1 Fhearta 1 kirschneri 1 líctores 9 inundou 1 Lissochilus 1 Lavau 2 fisiognomía 1 Forham 2 Hallet 10 Multinacional 3 Fis 1 Kramers 2 Phytomyxea 4 Infantry 1 Maidalchini 4 Laudabiliter 1 Ivón 8 inseriuse 6 irredentista 4 Kiowa 1445 páxina 1 nácelas 2 Ichthyol 2 ? 1 hidalgas 4 modiño 1 ljubomoran 1 PCOs 8 Fermil 1 Orientaleste 3 Monasterolo 1 Hoskuldsstaðhir 1 MMOs 13 historiográficos 1 Partyy 1 Iamarash 1 ornamentarse 17 Fallera 1 olímpicasf 1 mazdeísta 1 oikonomia 2 leuconoides 36 Mapas 1 Lycantrophy 1 Labyrnavirus 2 Leiognathidae 1 Hreðrik 1 mainz 1 Grocholewski 1 Kakuei 4 Notoryctidae 1 Ismailia 1 formulacions 1 mangostiña 4 pájara 1 lengettél 2 Hafsid 2 Oriflama 1 Penteconstalistas 2 Oleada 2 Mégarine 2 Maurie 5 KeuPa 1 histiocitoma 4 Odontoblasto 14 Ferddig 14 Impresionado 2 Nogues 5 ole 1 fédéraux 1 Phillipsburg 1 Mythbusters 7 Molène 3 monitorado 1 kefalía 1 Pentaprion 1 HOPPENOT 2 pencados 38 magro 1 golpéano 2 Nasyr 1 fortúa 2 metatórax 1 Orobias 1 Ndiaga 7 Llullu 1 Karakara 2 neumopatías 4 jurassiques 1 Mycerobas 7 pasábase 2 Fiatal 1 Gnato 1 judicats 75 pensada 1 GRAND 1 Fartet 1 monyaxe 18 mirou 3 Ithel 3 hematólogos 1 Kmenuedit 1 Hidrocorallina 24 plasto 27 montería 1 oxtia 1 Jamachakih 484 marrón 3 Jaen 1 Liit 1 fibrinoso 1 Gnagboya 1 Iyashi 3 Pileggi 3 orientalos 1 Mutalau 7 Fires 1 Kerckring 1 Guelem 1 ilustríssimo 1 Jetsilphymon 4 Kurtinaitis 2 machair 1 Loney 13 Gruyère 1 orientální 2 Kalyakin 1 nive 1 Lahmacun 1 omnigenas 1 Opernhäuser 8 incombustible 1 gymnosora 12 photo 1 Khantho 1 Ortigalia 1 Mbuyapey 1 helm 18 Ismaele 46 Hanover 1 Pandalous 2 Karawari 173 Mas 1 històries 1 Niamana 2 Methanopyri 1 gonodotropina 336 metálico 1 Orangedale 2 Pernoud 29 materializou 6 negaría 7 Mahina 1 Fastigatum 93 nutritivo 3 fayalita 7 Masha 1 Meisje 1 neolatinos 1 Moabe 8 matière 1 partipan 1 Fouracre 7 Nández 6 hucha 1 LaTonya 2 lusofobia 2 LEMP 1 oreastrum 36 merecedor 1 Phaseoleae 1 fil 5 Madaula 1 lambig 44 Musicais 1 ihanuus 1 Kolourpaint 2 influida 1 Haacht 2 palúdicos 1 LETF 1 mosaguey 1 Fisicotécnico 6 Orphans 1 Lèmburgs 1 Malyj 2 Nojaï 15 Narodna 2 Kerselyan 1 Labas 79 Majoris 2 Kerikeri 1 Osao 131 integradas 82 feroés 1 naumann 1 Okucani 1 Herrumblar 1 frontobasal 1 Marypaz 4 Notitia 3 formalizaba 2 intelectio 2 Isleña 8 nucleoporina 2 Mardan 2 Kohlemainen 1 Hitchingham 5 Nyx 1 Pedersker 4 Hasegawa 1 peterburguesa 1 Frisada 1 GACKT 1 Huish 1 Herpetología 1 lieutenant 1 massunt 1 Inkeroinen 16 Heywood 2 gardadamas 1 leras 1 Fortunius 1 kroky 1 Pilotage 1 lasis 7 Mijaran 2 Fearn 1 guarnicionería 1 Glossus 22 Lap 1 Peloil 6 Iurii 1 maceitas 7 Paga 1 Labiobarbus 2 Hammou 10 hidronimia 1 Leipeis 2 Ketto 1 Majuang 1 Haiphon 5 noxentos 2 Ghanem 1 obligarono 3 Herk 2 Oscillitorium 1 Mulsant 15 ici 2 Machairophyllum 1 Palmair 1 Mylodon 4 Hooft 33 mitoloxías 1 ións— 11 Hanóver 2 leigas 4 heterodino 97 Landa 10 monteses 2 Kalache 103 Montseny 3 Matrículas 2 Panters 1 NeuchâtelNovicastrum 1 Mokushi 1 Parmenes 3 iminio 1 momente 1 metamodelos 1 Kahega 1 Hohentwiel 6 gilbertense 1 Holonimia 2 mandarines 1 néein 1 HOWTO 1 incidise 1 Gioac 3 hormigón 1 Hornisgrinde 42 Meixoeiro 1 neutralizador 1 Phulchoki 1 Kringlebotn 6 Karabag 1 néhány 1 inseriranse 1 Geremon 2 oceáno 3 Musicali 1 pïedá 1 Murong 3 fondues 1722 Lemos 2 Isaach 1 Occitanista 1 Naprava 1 Oahn 17 Hadi 1 Flahaut 1 Kyokubadan 4 Krutwig 7 floreando 1 nikad 1 LEH 17 Nagel 1 paleoindoeuropea 6 Getica 1 Mitsushima 1 Karakal 1 Gehrts 1 Masrai 27 kara 8 Ganimedes 1 juncturae 1 Limagne 1 Hypolimnas 1 Korsmeyer 1 in candelieri 2 hirsuto 1 Pishqo 1 Ngiki 1 lignolíticos 3 Getafense 2 Nompar 1 Mcmahon 2 Genouilleux 31 Monera 2 Mañanitas 1 kalerik 1 nuite 15 Korolev 1 Norampac 16 negundo 3 MSDSs 1 guichet 3 Marlboros 1 Itapagipe 1 incoporaron 1 Munekata 8 Maíllo 1 mercatores 2 Margold 1 Ocasiónaa 1 Makhlu 1 Gardamarina 1 nug 13 oriéntanse 54 patolóxicos 6 Ginestar 1 Kharrouba 3 Hippoglossoidinae 2 klinget 1 Oligocolius 2 MARCOS 1 harder 1 petrophila 28 Niven 1 Hechtia 23 napoleónicos 12 osteopetrose 51 Kunth 1 mezzetin 1 Mbude 1 Pelczar 2 líbicos 1 MCN 1 mieloida 3 McGough 5 GlcN 1 Mallinger 1 Muñoza 1 Kajoi 39 Muela 35 Fontaneira 1 Musu 37 involucrouse 4 Imperiale 4 homoerótico 1 parinaquta 1 Genichiro 2 Hamrin 1 Hourcade 1 Jaraguay 1 geko 3 Goatsnake 10 Petición 1 Giblin 5 Janse 6 heptosa 2 kärrhök 1 Meitufe 1 penderil 1 perrinche 1 librabase 3 hospedadoras 2 Paleoviroloxía 1 Oligos 2 musicaba 2 indeformábel 25 Incidente 3 meeuw 1 Okpeden 298 fume 1 Freistaaten 1 lovastatina 1 LIBRO 2 kiribatiana 3 Mazagán 3 Faxil 1 formisanoi 8 kangkung 1 Marliave 4 Mallorquín 1 kehalim 4 lub 3 Monacanthidae 3 Ledonia 1 Oscillatoriales 4 licheniformis 20 Grossa 1 jutra 2 Menditte 3 Opositor 9 herbe 1 pigmaea 2 Kadrina 2 INTERFOLIO 3 Limes 6 Lamedo 1 Hadhdhunmathi 2 Párpados 1 Kurzweill 1 juane 5 HSL 14 Magnet 9 Markey 6 nenúfares 1 Meizo 104 Mir 1 Lexicógrafa 7 palta 107 Piornedo 1 Hominid 1 Lepidopteras 1 Kamashi 1 fatigalo 11 Oró 1 orée 1 fotosensitivo 1 Muthamittal 2 hipogammaglobulinemia 1 Higasa 1 pesentado 7 Inscripciones 96 gremio 1 Gelugor 4 ordeados 1 Furculesti 1 Piquantique 3 ichneumon 1 Mikulka 7 Lakua 431 incidente 27 Pensouse 17 Iodo 1 fremosinha 1 pangremial 1 Niveh 1 heterolitótrofas 1 gleiche 1 Mitsuya 1 Imperdoables 5 óticos 4 Herguijuela 2 Larrebieu 7 héptatlon 1 furcifer 1 Lalaseis 1 FANCC 1 íá 1 Koloma 1 Humbug 1 Libice 1 Fóia 1 Iazgulomiano 2 okruj 1 mestre Estevo que 9 Karakoram 1 iniquo 16 Hamra 11 microscopicamente 2 pectiniformes 14 Karagounis 7 gobernatura 2 Gonnostramatza 1 GrassMaster 5 Kupa 1 leanbh 1 guiriot 2 Floridita 2 mancarse 15 newtoniano 6 persuasivo 1 inactivacion 37 pasmado 1 frontrais 1 Geala 2 níveos 1 LITER 1 Merkwürdigkeiten 1 Hawkesworth 1 Firca 1 lopt 1 Ienobu 1 Mowa 5 perfumado 23 laxantes 1 GÍ 40 night 1 Leymon 2 pernambucano 5 melanosoma 24 mariñeiras 24 Mulcahy 1 Obssesion 2 piretro 1 libkdeui 1 Fustrigado 1 Papadjakou 10 multitarefa 2 Heinrichs 1 Karatiana 1 Ksc 1 pantone 2 fatigoso 8 flop 16 incitación 1 j?~ 50 fusionáronse 1 Gallurdea 1 Ocorría 2 hidralazina 5 Lynchburg 3 Montage 6 Grabski 7 Leffler 7 martius 5 Gilly 1 mórrechese 1 flavobacterium 1 ny?d 1 Mulgarath 2 Kokuhaku 1 identificáronma 2 odola 1 holE 4 outorgasen 1 firmini 1 Lugbúrz 1 Fontabuín 1 Melesse 1 Inducidas 2 fetch 24 Nuuk 1 Hermodoro 1 kalamos 1 lareteiros 1 jaintianensis 3 freouse 1 mursu 2 Oberdeutsch 1 Kalala 2 Oficiosamente 22 ocupábase 1 Inclita 4 fustigar 1 Jali 1 HapR 23 impregnado 2 Fontanet 8 Narayan 2 Mefres 20 moksha 1 Paletina 21 mili 118 gancho 6 Kuni 1 Iarla 1 Nimboestratos 1 Pertunmaa 1 hanifí 355 Inclán 2 Nimród 2 monogamético 1 inluindo 4 Maunganui 1 Miniminiyang 1 marxinala 3 lanzarán 1 kéntron 1 Judici 4 Lucent 14 Oersted 1 Jñatio 48 Jagger 5 intuitivos 68 perdese 1 Homoioi 49 neoclásicos 33 Krilin 1 firths 1 Partolonianos 102 navalla 653 maioritariamente 1 metatarsofalánxica 2 Mahin 4 Kauno 1 peqeunas 6 incubado 36 planes 192 Pato 12 Mikkeli 1 lexitimizalo 3 heterógamos 90 neves 8 Mestúranse 1 fixaándose 3 Kendal 6 OECD 1 microhenry 4 Okuri 2 Palei 1 intercongresual 6 Madregilda 2 Kora 1 fenantrénicos 1 LTW 23 pesaban 3 Kalapa 1 Jordyn 2 glicerilfosforilcolina 190 Lino 1 monocíclica 14 Jokipojat 3 Kurash 2 laticífero 1 nátahpetame 7 indignada 1 limpiallo 1 Länghem 4 mutus 1 Feminnem 1 Gardagullas 1 IUDICES 4 Kaipara 2 giungla 1 influencio 10 impedise 1 neonazimo 6 Mudge 1 Phtisicoidea 2 Longhair 3 Kellan 2 Peixauet 1 Iliina 14 picapeixe 1 HBG 15 litógrafo 7 monociclo 3 perseguiren 1 Kâshî 1 Kosmotheôros 1 Gilmpore 13 Nijinsky 2 peculiarmente 1 Histiopteris 17 pasadizos 88 Maynard 1 paene 37 Gremio 1 Mactilburgh 1 Lucignano 1 Frauenstedt 3 Léraba 1 liopsetinos 1 Orobiae 4 MAGIC 9 Marítim 1 Kakhaber 1 JAI 1 Okina 383 oitava 14 Pegada 1 Onufrienko 1 Garoupa 1 Marroko 4 Libreiro 5 gegeben 2 furabolaban 1 Planorbis 5 molestas 8 Orts 1 fenocristales 63 Iereván 1 Kálfafellsstaður 3 MHCs 1 Krn 1 Gianfreda 15 habitáculos 3 personificando 5 multifida 1 lithophagella 3 Levinhurst 2 Mangalarga 1 Locho 1 marsh 25 meiriño 4 Imagination 1 Heinkenszand 1 Palascia 1 mukhtasar 1 obstrúan 1 megapreeiro 1 Pagrati 13 Litvínov 3 impúlsanse 1 Friedenthal 1 Hopetoun 1 Parechinidae 1 Muqqatam 1 Medicamentorum 169 Negueira 1 flatness 6 Ipoh 1 Kropp 1 lubenter 1 PFOS 1 Moluccella 2 imbricatus 1 Katsuro 1 incombustíbel 2 Leibniziano 2 leonesismos 1 Melko 1 Miquelot 2 Hererolandia 1 micrometeorito 175 Picos 30 fenil 2 madurada 1 pequeñitos 1 plastídios 88 fundacións 4 muricata 4 Patóxenos 1 Paraleucogobio 1 fluracepam 1 f???sije 1 foresti 1 Miéville 1 Kraker 5 Lene 1 Otzi 1 Laokoon 4 Odal 1 Imagino 1 Gelmi 1 Pityriaseidae 32 permanecera 7 florista 42 formalizou 2 Ourela 1 klimpelianum 1 ?n'dr?ej?vn? 9 Haelen 1 Pipridae 1 Gebeta 1 moyen âge 1 Jeghegnadzor 1 Ladurie 3 ForaDeJogo 3 Khonsu 11 ordenándolle 1 Malaclemys 1 Médis 1 fyoord 1 manipurensis 1 moxenas 1 MusikSommer 6 Montizón 1 Kjumpingcube 1 Gymnopaedia 1 GlcNAcase 1 Kopala 4 hablo 80 Loitou 2 nestorianas 2 Lombardore 2 Orendain 1 fenestral 1 Nigersaurus 11 lideran 1 Maximinos 3 ferroproteína 1 Misai 1 pichones 2 hite 1 párduc 3 Geovibrio 8 Marsaglia 1 Hiperamonemia 1 Klugh 1 Jujja 1 Lomer 1 Lucques 2 Muhyi 1 Osmitopsidinae 7 NCS 1 Lharampa 1 Introducíase 93 Farrell 1 hukou 1 Ngaremlengui 4 Otsagabia 4 nefrotóxicos 4 Namekianos 1 organízanos 1 Lavanant 11 Ocúpase 1 Gelocatil 1 hoacíns 347 Manhattan 10 Hokota 1 Gelastocaris 1 filosofís 1 Noriyasu 20 mc 1 herbstii 1 fudnador 1 Lebic 1 fotobacterias 4 Guillon 2 Galaup 1 kölsch 1 Judayr 1 Narea 1 Nordqvist 207 He 1 Pentahidroxi 1 Grettell 1 Maroso 3 palemoninos 2 Machaca 88 Marcas 2 fóras 1 googleaba 8 hipocaustum 1 ikanago 1 Feodosiia 3 Herosé 1 Outo 1 pallidicauda 20 Gambrinus 1 gabouno 75 Glory 19 mecanizada 10 IMEI 2 Inludes 7 perdurábel 13 pacificada 1 Obligo 3 Paren 1 Jeny 1 Limousis 8912 L 15 pío 5 Methanosaeta 2 Hipi 2 impúdicas 1 incurvando 1 Gribb 1 noció 1 Gaspa 2 Norling 1 magnetoestrela 3 Faúndez 3 oscilará 1 GENT 2 Jintao 1 ferraris 4 Mahamane 25 Oak 2 Matoaka 3 Iol 6 mamparo 1 kah? 1 Khalmg 1 Gerritszoon 5 Paraugas 16 Kamikaze 26 nitrocelulosa 136 inscrito 1 humuleno 1 Glenr 7 Nematoda 1 oleiferus 1 Meduales 1 Goriña 108 oxidativo 3 LICINIVS 1 nomeárase 737 Paio 1 Metaloprotease 144 Logroñés 8 mont 370 mitose 7 hakka 2 perségueno 1 mongolicus 1 Nicko 3 flavida 1 Giafar 1 gaviformes 1 Periòdic 1 petrolóxicos 201 orais 1 Ivrindi 1 grahamii 1 nitroxénicas 1 Ivppiter 1 partículo 1 luxuriantes 1 Irecek 3 Massie 9 Mbabane 1 Hortícola 2 Notopteridae 2 Langanesbyggð 84 Osvaldo 15 Guiraut 1 Gryphochitonidae 5 inintelixíbel 10 grossa 2 ortodoxias 4 Memòria 1 imortais 3 GALÁN 1 Guecha 2 marmurios 3 Moskovsk 1 hidrófóbicas 1 Mondaríz 1 physiologischen 2 Konemann 1 Loarte 1 Lumnezia 1 Ginpei 3 Kuortane 1 Idunet 5 mad 1 italischen 1 hsitoria 268 Lexión 1 pilosum 10 Pepin 1 Gali?ia 1 hieromonxe 2 Namaqualand 1 Ingsoc 6 maestría 6 Lehm 8 pagaran 3 Macrae 1 Lagodekhi 2 Peroxidase 1 Malisheva 28 introducíndose 6 Husky 1 ?ilah 1 Mezzanego 1 invaxinados 2 Linhart 6 Nanjo 1 gurunsi 1 Ordinato 4 ISTE 1 Glaciaciones 2 Neron 351 ligados 1 Papallones 1 osynliga 1 perillán 2 kypärä 45 MN 7 partenoxenéticas 1 pachyosteus 3 Kombissiri 39 Larsa 2 Khana 1 muskiy 4 Ilejay 4 Homolka 5 nordestina 3 Kagome 1 Macio 2 municipis 1 manipúlación 2 Hesling 1 Insurrectionalist 3 Panie 2 orellanus 2 Hazlehurst 1 Mapusa 6 Hrvatske 1 Hidraulícos 2 Lherminier 1 Patelaro 15 Gráficos 1 picno 1 Munditações 47 patoxenicidade 1 Kajol 37 Interesouse 7 improvisando 1 oiseleur 1 Iesi 3 MouseHunt 1 mejorando 4 medise 1 Lice 31 itálicas 1 kyle 6 osixenadas 1 Huanwang 9 Lortzing 1 Mikhael 1 mepa 3 Palentino 2 Lachen 1 Movits 1 mascarenense 34 Herrerías 3 musculada 12 Ganado 1 muk 3 memoriak 2 GALEGOS 2 Groniga 1 miserationum 15 piceas 1 figurer 1 historisch 1 iviii 4 McVie 2 insolidario 2 Fenomenología 1 gup 6 partan 1 irreductibilidade 1 Pennacchi 1 LaGrande 2 gruit 46 Mahou 1 Plâteau 1 masos 1 lanero 1 fierrazo 1 informaciónn 6 MMC 5 Montalbo 1 miljounir 1 Hellissandur 2 kamelos 2 Henegouwen 4 henry 3 Lavacerido 1 Kraemer 23 Piorno 1 Moign 13 mediterranea 2 Pankratios 7 Haldir 1 Fugamon 1 Ilsur 6 marcacións 1 pesti 12 Pachacútec 1 Obshchestva 4 Penetrar 2 Feasgar 1 ladrona 7 Kiseki 1 Haïku 1 Khasmin 1 Minamiazumi 1 Lophanthus 1 lberada 12 Mom 31 Irmandinhas 1 Janetta 1 momificaban 1 Fascinio 4 héptada 1 Farran 1 Perdigueiro 4 informará 9 minoico 1 ishidatami 1 Paschy 1 oxandrolona 1 Paoufla 30 Hideyoshi 1 Krueg 91 máster 3 filtraron 1 gezei 10 loxas 531 Janeiro 7 Frua 9 Godescalco 1 Otobe 3 Passerieu 10 Karlsbad 2 MALI 88 litorais 1 Lanolina 3 others 3 Haninge 11 mellorase 4 Metrófanes 1 Modjeski 1 Pemféridos 5 Ghislieri 13 partirse 1 Pervogo 2 Mamé 1 keetii 10 Naturals 2 ollaren 1 infinies 1 Mondonville 2 Ourtilane 23 Nb 4 Koraís 1 Julver 3 gri 1 hayataiana 6 Faus 1 Jugrafiya 1 pereiopódos 1 nimia 2 Kunal 1 griegaIberosTartessosImperio 1 Fújiàn 3 manosilo 1 microevolutiva 1 jacobinismo 1 Nerbonne 1 parecíanlles 1 galerada 1 orkut 4 haul 2 lipoatrófica 2 ovuncatum 1 Manucci 1 ONGC 1 Luftschifffahrts 1 holanés 16 Petronor 1 nadalenc 2 Piérnigas 1 lleven 5 Haarhuis 1 Orbity 1 lignotubérculo 4 Katzenelson 3 Hanayome 3 Personality 3 ferrolás 1 necesitaríamos 1 pareix 7 HighPerformanceEngines 4 Joanet 13 Justícia 6 Kentrophyllum 1 Megapíxeles 10 mem 1 Limb 1 Jaksche 3 Légier 5 filhos 1 Noviza 3 Lingayen 1 Laxón 2 Orobancáceas 1 Hokkei 8 heurísticos 4 Kaganowsky 1 geyeriana 6 Fertilidad 8 microaerófilas 1 Lohiatala 1 g?n 1 Frankrijk 2 Guiniforte 4 guindillas 1 Kadosh 2 Paracha 1 Niniari 1 Fossiébourg 41 fotofosforilación 1 Inxeniosas 1 Landstraße 1 Gazomètre 1 longstaffii 1 Kanacassala 1 Herbívoros 3 gradualistas 1 parafrástica 1 Papeda 7 Gaucín 1 Laurino 1 Hashoá 4 Narew 1 Furetière 1 Inkeys 29 incluidos 1 kleinigkeiten 1 'l?opolt 5 FLT 1 Maroxa 1 Kotcher 17 Mendeleiev 1 maitlandii 1 Ferroníquel 1 nuotras 1 Jounaling 3 Forua 1 Meandreiras 1 Gijuku 264 nebulosa 1 memag 1 Meknès 1 francogallico 2937 mellores 3 LXXV 275 persoalmente 2 párvulo 3 liberata 4 Hamazasp 3 Ketsudan 1 Morality 21 Levítico 1 Fenilalaninopina 2 Orientar 4 Murena 1 Ful 1 matoubom 1 jube 1 MILI 6 ovatum 16 MPa 3 Kuchipudi 3 nuclean 1 intemedio 1 Llais 2 labu 2 Nadvirna 1 giurtelec 1 jalapeño 3 Iniéstola 3 Franquista 3 Forese 1 geganta 1 hoteldevilleh 3 Feisty 7 PINCE 1 geomeetria 1 intrumentista 2 Oahe 1 ordenandos 2 KPW 1 Filesystem 11 mazas 10 fusilaron 2 linoleoíl 2 Niederrhein 17 Foligno 1 Gavrílovich 1 gebëtonyal 17 Lomé 15 intervencionista 47 Joubert 1 lugoti 5 Neaño 1 inculpalo 6 Lubricación 3 nød 382 Guadalaxara 6 Lapu 3 Paxonal 1 Mendatica 1 fendéronse 59 pes 3 Gaviidae 2 MARTINEZ 9 Helper 10 Guadalmellato 1 Francy 1 metérona 1 indisputábeis 1 NEI 1 Kootznoowoo 1 integrounos 1 ?nada 3 Lifting 1 FICEB 3 fitocromos 1 orxie 3 karnuxs 1 monocerata 1 FERNANDEZ 31 incluen 13 pementón 5 pascuas 2 Kalapani 2 Fromentine 2 hiénido 3 Loule 20 infestacións 128 Innsbruck 1 Nagozela 14 flotilla 4 Krasnoperekopsk 1 Kurring 1 kga 2 infotecnoloxías 1 Nymphen 1 Muchado 2 Fouglé 1 Hlarión 3 furlan 16 igualados 2 órice 69 Femme 1 mascaran 1 Pencilium 1 Mucic 23 Mastrigt 5 pavía 2 memorizaba 473 Jerry 1 Kitsissuarsuit 2 navas 1 oratória 4 parénquimas 1 Gantheaume 1 Herzogenhorn 2 Kyrgiakos 7 Modernes 9 Lodeira 1 lauschen 6 melenas 2 Luengas 15 Ourensán 1 NDX 1 monodontoides 6 fórmaa 4 fanfarria 1 ognuno 2 Fribourgeois 11 Pasaxeiro 23 homoloxías 1 Leningradskiy 2 Nitteti 2 Jante 1 Fraiches 1 gemmellarii 3 lanzo 8 introducírono 1 Hesperiidae 3 Perens 1 kissati 1 Georgianos 1 fühlt 1 Isskustva 2 Glaessner 1 Momcilo 1 mallorqui 1 labraba 5 Pavl 1 griseira 1 Landhausleben 1 floresianus 1 Ockinga 1 mudjêr 1 Haremsgittern 1 froitoé 1 Itaboraian 1 Garmmon 1 inactividad 3 Moule 1 Iuvenalis 1 Pichín 4 Murska 2 Petropavl 4 Jol 3 Lisosomas 3 Parsemain 2 Gobernado 1 Mietke 2 lidová 2 Matsum 18 Métis 2 Hamala 1 hentañ 5 pegándose 1 Petermannia 1 Panaria 1 iky 2 Hydriotaphia 1 Iudoco 2 Kernels 1 Pallin 6 Llovio 1 gialdyn 1 Panathinaikós 9 Fatio 1 intensificase 1 Høje 2 granarius 1 nationaliste 3 golpeándoa 2 Fructoso 6 Impero 7 Geniez 8 Gaciño 3 Giurtelecu 2 MLST 1 froneira 1 Parasphyraenops 1 operacin 134 Hendaia 1 Keepmoat 2 Lillies 3 Louisbourg 22 panícula 1 perloca 1 heura 6 Lez 10 Philosophia 40 Lupo 8 Minamishimabara 1 hemiterpenoides 4 Justín 1 geto 1 Pasiphaë 1 Hatsugen 2 Loanza 13 making 1 Irk 1 helenizante 3 Felo 3 lota 8 FV 1 Fotografiada 1 Noíchrothach 1 fedatario 1 Matsijs 1 Handatlas 1 iacigos 5 Hoher 6 Maa 1 Heimligen 2 huracás 1 Manastyrski 25 Odio 2 Implantou 8 Planh 1 Gadau 1 Hallonet 1 lloca 1 Loukari 1 minetras 1 Oppegår 303 holandesa 3 Hagbard 16 Jóvenes 1 netko 4 particularista 1 ouriñais 1 Orra 1 Konali 2 grupamento 1 Mangerr 6 Hannoversch 2 orixenismo 1 Igara 2 Kimbirila 1 Farian 1 minimor 92 lóxicas 8 Lenta 3 fitófago 3 Perdín 1 nätet 1 mentrasto 23 irrigada 1 Mungab 2 fotoasimilados 1 Neddermeyer 2 Heresiarcas 3 Grillos 1 Jentkaues 1 Gíslason 1 gwaeddgreg 1 Lipocalinas 1 Ottosdal 3 neonoruegués 1 Mondúver 1 malacológica 14 Myliobatiformes 1 helíctitas 1 Marad 6 Gy 2 Frenza 2 ozonación 1 Patriarchal 1 Ferroso 1 Maraea 1 Jeshván 4 Mendigorria 1 mereces 1 ISB 1 Legally 9 macabra 6 Láirge 20 implementada 2 Metzinger 1 frawen 1 Mutar 11 Fuero 2 Imsety 3 Lobatse 1 Olanu 104 Noutro 1 mantell 5 Gédéon 4 Lobão 2 Nwofor 5 Klum 2 mecanizouse 1 k?rs'?r? 271 mercenarios 1 inundándose 1 Occlo 11 nubia 2 Ithryn 13 furtivo 1 libanes 2 mergulleira 4 gratuítamente 7 Nigromante 1 Hellvik 259 masivo 1 najlepših 1 Lodoliana 2 Întorsura 1 merécense 6 Grinderman 2 Participations 1 Howshaw 1 Kuomitang 3 neomudéjar 4 Kinyarwanda 597 Live 1 Hoch 1 Ilía 1 Kaidron 1 Odoshishi 4 infrinxido 8 NPK 2 Hvat 2 Kurddal 1 Iaundé 2 Messolongi 1 Gójar 1 microrhizomata 1 Haringvlietdam 11 lentiscus 1 Invulnerable 1 karamii 1 laburra 4 Marumori 75 IFN 3 nefrocitos 17 Montilivi 1 Jenteal 2 Gerres 21 imperaba 3 Lykawka 28 Jarmo 1 Hippys 1 Minegishi 1 FLETCHER 223 mansión 2 Hygieia 5 Mesonero 8 franciscorum 1 Mankivka 2 Haikouella 1 Koten 2 leit 1 gandhi 1 PerkinEmer 1 Lietuva 7 fosfoserina 4 Horio 7 mobilizan 1 paksis 1 Foreste 1 Hafnium 1 Heterochiton 2 Garellas 1 kuyruklu 2 Háttatal 17 Halland 1 Muurman 1 Hrothmund 4 insértase 1 Ligares 3 mazdeísmo 2 obrigóuselles 1 meternos 6 Pir 1 FUIT 1 jrebya 1 Fotóns 1 Hellerud 7 perversa 1 Lvinaya 94 Min 1 nitrenos 1 Imaginari 1 mesquités 6 fantasiosa 3 Piiroinen 1 Keimatubu 9 Pierfrancesco 1 jscholarship 1 kawhaan 3 H?i 4 Jabo 69 Hurt 1 Micromomyidae 1 Napoopoo 528 fina 1 PeterandPaulNeva 21 Garrison 1 Meluia 1 penétranse 6 marcionismo 14 Kronen 1 Jernløse 1 Pholidoskepia 1 Gawab 1 Kreidy 1 Gaüzère 1 jodida 1 Hoysala 1 Interhumanas 1 Fosfinidenos 3 Mehler 1 Geodätischen 12 jeu 14 Khufu 1 galotaninos 23 Fosfato 1 Lipicier 1 Hkakabo 1 húmköldu 2 Letsholonyane 1 Imprimatur 1 Ilidio 4 Opcional 1 Grundzales 1 Kantan 1 Forix 11 Matsushima 1 moldúranse 2 grelar 1 Gethsemani 2 hipobiose 1 neoasirias 1 Lysiphlebus 1 Pebane 1 Gamini 1 Oefening 65 holandesas 1 mixturar 1 Guggiari 1 Nofret 3 machas 25 oftalmoloxía 1 homœopatía 1 Mileniwm 1 Ofanimon 1 Kambritch 1 Malankar 1 Mostacillas 1 Greenport 7 Homuzu 1 kharosthi 1 itineraria 1 Kienzan 4 Musketeer 1 Lygisaurus 1 Haurie 1 germanischer 3 Nationalbibliothek 1 furamonas 6 Inthanon 1 Franquès 1 Hadasi 7 magnocelulares 3 gång 2 Kapisa 21 fanlle 1 petliuristas 1 peoniáceas 2 kutenai 1 neobizantinas 1 Koniec 3 Kroger 2 Fechos 1 isosorbido 2 Freixeira 182 golf 2 Paleontologia 1 Nörvenich 1 Garçonne 3 holósteos 1 gobenou 3 monocorde 2 lipotrópicos 1 Kunstsammlung 6 Fokin 1 mitoxel 1 Labancegos 1 Industrializadas 2 Guarazoca 2 OSE 1 melanoidina 1 ilegalizó 1 HEINRICH 1 miniA 6 intramusculares 9 Gasterosteus 3 Ouriolo 4 Hontanas 2 Laikmaa 12 Keener 10 Niemi 69 Kase 2 Planococcus 2 Iroquois 5 Parapsicoloxía 1 Guragone 2 Husar 2 Gwh 1 Peláxico 14 lapón 1 Miqueleiz 12 Manne 2 onicolise 1 linfanxiosarcomas 1 macedonismo 1 mazrai 2 neoclásicista 1 nominibus 5 Muchacho 2 Holness 2 Kesshiko 1 Neurochem 1 obstinadas 1 Jevgeni 1 Oyvind 3 OVW 80 náutica 1 Kyela 5 Ikinari 2 fonoteca 2 Kabarda 17 livonio 6 Ignotus 1 Grisaldo 1 ligárono 1 Operas 3 materials 1 Horripilante 1 Hulubesti 1 interesador 1 Noselo 1 leilana 1 Maxilly 2 Flamengas 4 Fournerakis 1 Gassam 1 fibrolisina 47 Oñate 11 Levant 1 kathak 1 gwc 28 Monárquica 2 Mangoeiros 1 fortalecería 1 Lilluti 1 Itzcowick 1 picobilifitas 1 kld 2 Mutpuracinus 1 Gakyojin 13 Parnassus 3 Lunacharskii 1 Licancabour 1 Labourerien 1 jiliqi 1 hima 2 Olong 3 gaelscoil 1 Lontrg 1 Leborne 1 Mechi 2 Joanis 963 Habana 1 ouso 2 Madurecen 2 gefitinib 2 Pasaco 3 Froilan 2 neotenia 2 Muruga 49 Finalizada 1 nafni 2 oftalmoscopio 1 Misri 2 Pippa 1 norueguês 4 Heterocarpus 1 lipidadas 1 Insurxentes 3 Pelaxia 1 Levamos 2 Nominoe 10 Illumina 1300 perigo 1 Omohioideo 2 Halófilo 20 Felicidad 67 melón 1 NERComP 1 INCARNATIONE 1 Jenkner 1 Homewood 26 Hippoglossoides 233 Ingresou 1 Irwing 2 LeVieux 2 Jalingo 5 McWithey 1 parenquímula 1 Kamenogorsk 1 fibreni 8 Leocadio 1 Labarnaš 1 Ligurini 2 instalárselle 1 ivonicus 1 Judensohn 1 Gulfián 4 HOLGADO 1 Keympa 1 Märtin 1 Oosterbaan 1 ollahíes 505 fotosíntese 1 Imías 1 Istämi 3 Mankono 1 Guineana 48 Lew 9 Fascículo 4 Kaczorowski 1 Kubbaniya 1 Marshalle 1 haxioloxía 1 Lii 1 Grankuwagamon 1 Mazia 6 Grimarest 1 matematyka 1 Himeguma 2 Mouriscas 2 mostou 4 filópodos 1 Opernhausgepäu 1 Hadamar 5 habilitouse 1 intercionalidade 2 jacobine 2 Fertik 1 filholi 2 Guðroðr 1 Fangasito 1 Fleckeles 8 Grob 1 Garoza 1 interceptivo 1 Ifosfamide 1 larkenii 2 granjero 5 pipes 1 perfeccionárense 1 Kitros 1 Panareas 52 goleadores 1 intercamerais 53 Mares 25 libertador 1 Mians 6 Higashiura 1 Fdjeux 3 Genzano 158 lineares 1 PeeWee 1 forcecen 1 Líga 10 Havelock 2 pegaranse 5 Kaarina 1 malaiisch 1 fosforotioato 1 fuira 1 kaneh 1 Menschärgere 4 grandeiro 1 landkartaro 1 Faverzano 1 Ichiyo 123675 foi 1 lavradores 36 Malek 15 Pide 1 perdono 1 Pianti 2 introducirnos 1 Ovrag 3 Minashiguri 2 orlinnyj 33 Norður 5 Michaelsen 2 Meßkirch 64 piedra 8 Holby 1 hnti 1 menestral 1 Manring 1 Kalervo 2 Jacchesio 1 Hidraginaceas 1 Koitsu 1 Fejtö 1 oficinalis 697 Meira 1 Lirondo 1 Grünn 4 Kenley 1 inxuriaba 5 Mengli 1 Kiekon 3 Grashopper 1 lipnowski 2 padanos 3 Hilos 1 Jürgensburg 1 nsukka 2 glosado 1069 hóckey 1 Hetherspoon 95 Fauna 4 Hälsingland 1 Fluorescente 2 Frenando 5 Marsans 1 Nurowski 16 Negre 1 Pelasgós— 2 Kothari 1 Obsessions 1 Hant 2 Moriche 10 Nelumbonaceae 1 pegóuselle 4 OCF 1 panoikeiotatos 2 Herczeg 1 Photovoltaic 2 Murrai 4 Nagi 1 Mbaracayú 10 Malveiras 18 Mihailovic 161 Palmeira 1 gcalc 1 Flyte 1 McCorry 1 Giannakopoulos 1 Parbleu 12 Náxara 19 henryi 1 Hesione 1 Olieslagers 1 koteba 4 patronímicos 3 Hedtoft 2 Hqr 1 Nottigham 37 Fases 58 Pina 1 Iugarius 1 juzgan 1 neutralizasda 1 matriomio 9 Gizo 4 lousiña 7 hospitalizacións 7 Mecanizada 1 papa Bonifacio VIII 82 Marías 1 Leningitij 1 janmabhumisca 92 modifican 24 Natsuyaki 3 Neveira 1 Krüss 1 fluidifican 94 Obreira 2 Loveninjas 1 micorscopía 1 Korfantego 1 obedezas 5 inxéctanse 3 pilón 27 intensifica 5 NEIRA 5 impartirse 6 penduraban 7 insectívora 6 Nwoya 5 jamriyyat 1 Pemagatshel 6 grupúsculos 1 Kluisbergen 1 Oreopanax 8 GCA 1 Holts 1 Habuneku 1 MemMaker 1 pericardiofrénicos 2 Hohola 1 Friuch 1 Naüja 1 Faton 50 masonería 24 guetos 3 Honorata 1984 pasando 3 hemsleyi 1 Lamck 2 Murky 2 gaúcho 2 Marrone 1 Pironti 3 Goms 2 Goias 1 inenarrábel 19 periodos 7 Giornale 1 peleontolóxico 16 pensadora 1 Instrúe 1 IOC 4 Hefestos 4 Limasol 65 Hand 262 melodía 1 HOSTES 4 fragmentándose 2 piperatus 1 Hakimije 97 Pepa 24 Mercados 1 pentadáctilos 7 Hvad 1 Hasax^sax^ 238 IEC 1 Mabuhay 31 Heckel 1 Otxamtxira 76 olivas 3 juv 1 microcélulas 1 piñeiriais 1 identificáse 1 Honsfield 2 oxímetro 1 oiriades 2 pho 1 Lupeosauridae 1 Goldfield 7 Mátra 1 kilemanyaro 1 mnalacolóxico 7 movimentos 1 Iholdy 1 papa Gregorio 1 intraaracnoidea 2 Meimendro 1 Medzhitov 2 Hafnia 5 Guardiáns 1 parnasianas 12 Monachus 2 labializada 4 Ntcheu 2 Mouronte 13 Kunsthalle 11 palpable 1 Janota 3 Hibrida 1 linquo 1 paraalbumina 1 onmóbiles 17 Hunerico 1 halte 1 HanLin 2 Pallasmaa 1 kirtag 8 immaculata 5 nomeación 1 Igon 1 glicerilo 1 Goboano 12 financieiras 1 inundaríanse 1 Micheaux 1 pencado 1 NVPH 2 Garagouz 16 Mirada 1 gonion 19 Onnes 3 hemet 1 Hueyatlaco 1 Majid 1 Hachemitas 10 magrebís 1 Ofr 1 Neostyphonia 1 novedade 3 Lyssacina 1 Menang 1 Lasken 9 Fogerty 2 ínsita 4 Moxico 1 Mwesen 2 pasionaria 3 invernizo 4 fall 1 martélase 5 mouriscas 1 Fasnet 2 macedorromanés 8 Kamaishi 1 Grästorp 1 Fersini 1 inteiro 1 luch 59 lubricante 1 Goudkov 1 Pa?iniya 6 Glorio 1 Keepnews 1 planteaban 1 Fortescue 8 Millón 1 glemt 1 nelumbonáceas 1 pernaslongas 4 Maco 1 Juncaret 1 GOP 1 IFEDEC 1 márcana 6 Luske 1 Khallutush 1 Mabaruma 1 Pârscoveni 2 Nojiri 9 Jair 2 Phaethontiformes 7 pigmentarias 1 Heterosteidae 8 Heraldic 3 Forex 2 illustratae 11 nacenza 1 ochentas 1 Ornis 2 Mevalonato 9 Goldenberg 2 fernerhin 1 Ogsim 1 kelmys 2 Koumi 15 Misshitsu 4 laian 4 Hopen 1 marielebourae 1 petabyte 1 finiquitar 1 Murati 2 gawar 3 FLO 4 opoña 1 institucionalizáronse 1 Nœux 1 Koenigshoffen 2 octanoato 1 Geisterseher 1 fondar 1 Hillah 2 leach 1 Meinhardiner 1 OXTR 2 nulense 6 loitosa 1 Nyneve 3 fosfolipídicas 2 Monthan 39 lona 1 ordenábanse 1 fromâjo 1 Itsutsu 13 Lubbock 1 Jalq 2 Leopldo 1 Niraman 1 manhigan 26 Karlsson 1 identifícaa 1 Mammut 3 Niet 2 infrinxíndolle 1 Lübbeck 1 Gags 5 instituir 2 hpEastAsia 19 larvarias 1 kwezdi 7 lipoxinas 80 Nomes 2 Khishur 1 Hipodamo 2 heliograbados 2 Jiki 1 plasmoblasto 1 Krautzun 12 Liderado 78 Halloween 5 Hegi 1 Padieket 11 Gurgueiro 3 Phleum 1 irideus 1 Ororbia 59 orientar 2 Hafa 1 Novión 1 Lowbrow 1 naia 1 Flamencos 45 petrolífera 12 KDEmod 1 Leopardos 1 k?an'se 1 Islaz 150 fundición 1 iídix 2 hipersensitiva 1 grancolombiana 2 Khnopff 1 fallaría 1 Karmica 1 mattiana 1 lugus 1 Floride 2 Ourovello 2 onceava 1 NMU 1 misoshiru 1 Iesa 2 Gécamines 1 miristoiláción 7 mass 1 Odebrecht 1 Mugharel 3 Paúles 1 Ledeen 1 herbiña 1 Manene 1 Microcephala 1 Langseth 4 hins 1 Llors 3 ínfulas 5 Haliaeetus 1 kyanita 1 gayanum 1 Gew 3 intraepitelial 4 Pagola 2 Jetty 1 fugitivas 1 llywarch 2 Lipotyphla 2 Kvitrafn 3469 obxectivo 2 Itacio 2 peiteando 1 Liknade 1 MotionScan 3 Pekarík 5 Palaeos 1 Paranoica 2 perihelios 2 McGRAW 1 frontman 1 pirovoíl 19 iOS 1 Malý 1 gastr 3 paulicianos 1 Gerou 27 jubatus 1 Marsmen 1 hominoide 2 Laprune 1 moldeadores 1 HPRD 2 Gugong 19 Manín 4 Musician 1 GalegoLAB 1 Miha 1 peus 1 lleufer 1 hipernomarquía 1 maskers 9 nostru 1 longior 1 Mamoncillo 1 Kagalanggalangang 3 mahrattas 3 Mutimir 3 Penúltimas 1 Geiriadur 1 Neufmoustier 1269 Municipal 1 jazzísticos 1 Metatron 1 obligada 21 Pali 1 Masalavés 1 Halictus 1 gulus 13 Hermanarico 1 leucorhinus 1 ndoki 3 irundarra 22 Fluvial 2 Janch 4 negáronlle 3 Lione 2 Kander 3 Marquardt 3 Gehren 1 Kratiado 11 gan 20 fura 5 Kathedrale 8 Gentianales 2 Moañesa 12 Kentigern 1 opoñéndoas 1 fluvisois 2 manirráptores 2 Malamocco 2 pioverdinas 112 piar 2 G 1 Guinardera 10 menarquia 3 imprimíndolle 1 Hillstrom 1 Marqus 7 levofloxacina 1 Implicacións 4 Korihait 2 Frijda 1 feuillage 6 Nívea 6 Meleiro 5 imitativo 4 lisosomais 2 motz 1 glossa 19 Lui 1 Hechter 2 gorin 3 Hibisco 1 GUOLO 2 leibergii 1 macroskeles 1 julifera 9 Nobiliarios 79 hiena 1 malls 3 Morceau 12 inmunoloxicamente 69 pardal 2 Nackid 1 parís 1 forsterana 1 juorni 2 favrrot 2 Minamotono 1 Laços 1 Mogera 2 Noara 1 Instigator 2 Malvide 134 morrería 3 operárono 1 Kapal 244 flúe 1 IpaC 1 Gymnospermen 2 Gardell 1 Glaszmann 366 Homes 1 heterocarióticos 1 Harriette 1 Palisio 1 Gwernol 7 ?i 1 generalitzat 1 letište 1 Pépiz 1 Morrogh 7 Maleagant 1 Malik 1 nanatsu 439 Ken 1 Mered 3 Fann 1 Ferroportina 10 Pafos 6 Fumega 3 piezométrica 2 Harith 1 generalato 1 Melanda 1 galisans 6 Marni 2 jovent 1 Interiod 1 Ilium 1 Pecetto 4 marfís 1 Langlaoich 26 neoplasias 1 Kapitain 1 Kralupy 1 Gunya 1 GunBird 3 Frisinnade 1 Meynet 1 Piroplasmida 1 Hilden 2 Ipres 1 Führung 1 farnesildifosfato 74 Maximiano 5 Flop 1 période 1 pementela 1 Govardhana 5 implexa 70 Pireneo 2 Múnegu 3 imaxinismo 2 Madriu 2 Obtíñase 1 magniflorum 1 munifex 2 Keila 1 genipapo 1 infroestruturas 1 pensata 17 Nowhere 45 pacíficos 1 Guilisasti 1 Parambassis 7 Gomos 39 Lothar 1 Gaiolas 44 Heroína 1 Phx 3 IGA 2 Piratini 4 maxestuosos 1 memoría 1 mixotrofia 10 Odontoceti 2 NAK 3 Hassán 2 Leonera 1 Moigae 1 libertine 1 Luperón 1 lecteur 2 galateísmo 30 Hipias 1 Herwagen 1 librecambio 49 Municipalidade 1 manicho 1 lutrensis 3 Lepomis 12 imprecisas 3 partillando 6 nine 160 periodicamente 22 Morata 2 Indisposición 1 Majha 331 golpes 2 influenzavirus 26 inmutable 2 knarr 1 Lovage 18 memorando 3 ofrecerllo 2 monoxenismo 1110 frota 1 heládica 1 hiruva 1 palaces 28 Maurya 1 Persifal 1 geldiydi 1 Papinianus 1 pasajeramente 8 Jaltenco 1 Palladion 100 Olsen 30 minuciosamente 1 Hurriyah 1 Maribarbola 1 Ifri 2 Placoziphius 1 Jestateltenk 1 Maceracións 4 Pasaría 1 Marathraceae 3 fmilia 3 Laudas 2341 mor 265 Había 3 Icio 1 Lemmertz 24 Macha 8 Matan 9 Juchitán 1 Ouadai 1 Mehcad 1 forstå 3 Karagandy 1 òl 1 JZZ 1 neustria 1 INNO 4 Kvartetten 2 obtusiloba 1 Manteola 3 glicoxénica 156 oculto 1 Moestrup 1 Leliceni 5 martaraña 1 Mantine 2 interstinctus 7 moderando 1 magnetorrecepción 2 Libolo 1 Kave 5 fundamente 1 IMPULSAT 1 Ogou 1 Mult 2 Happyland 2 inaplicables 1 intervogálico 1 Ngeremlengui 1 lechuga 1 Heliocéntrica 7 Firdusi 181 inhibir 14 golpéase 349 Madagascar 50 lítico 447 luns 1 ICARDO 5 latifundismo 1 iratxoak 6 lemnisco 6 Nied 1 Ortony 1 Másmovil 1 nitratros 1 Méphisto 1 na Piazza della Signoria coma 1 Masná 22 Ide 1 licenciasen 19 Gabi 14 lucioperca 1 Misso 1 Langavat 1 KUNKEL 1 Gardela 1 påti 4 Gaelscoils 1 libriformes 3 mergullase 21 NOG 10 Obote 1 Frasercetus 28 ovetense 3 Likes 4 incumprimentos 3 mì 1 Kabaivanska 7 Paralelismo 4 Ostend 1 Narrinyeri 4 nedd 1 majete 1 fincalas 2 Melicertes 13 Linguística 4 Marahoué 1 Leukadia 1 hyracodontidos 2 Lilienstein 1 PINTOR 8 Pantin 1 Lykketoft 1 minimizaban 1 Hemoperfusión 7 Midón 1 gravábaas 2 Kaarta 18 gnomo 1 Horalka 15 Filius 3 palpábel 1 košta 1 Merrilees 2 Manh 3 Monstres 1 inhomoxeneidade 4 Fomos 2 mutationes 1 Ganduz 16 Noire 147 gandeira 1 olen 2 muruxa 3 fovea 1 Mayuko 1 hiéroglyphiques 1 Photographer 14 megabytes 1 Lauguerud 1 Muhanga 1 Perviven 1 Massad 30 Paisaxes 1 Hatuf 2 integumento 2 Ishu 2 Glowing 41 Nguema 2 inmunodifusión 1 misella 8 Mesturado 3 Kukkuni 13 Palop 2 oxixena 4 inico 1 ICNB 1 Lumiya 13 novembre 1 Giangrandi 2 Froilano 3 Kentaro 1 klingonese 1 Fixérona 1 ibes 1 Guitare 2 Isbaniya 1 modernu 13 parlamentarista 1 Indohyus 2 mebros 10 Narathiwat 3 Mám 3 Indubidabelmente 1 filoplumas 33 ocupase 1 nuristanés 1 MURU 1 Gagaúzia 2 Lobalú 36 Feuerbach 2 hicsa 8 Malem 1 Osteoléptidos 3 Kurama 1 Ngoi 2 Nocturama 1 hidroxo 1 jawa 1 Miyazaki en 1 ilk 96 Llagostera 3 Oxixia 5 MasterChef 1 owyheense 1 lasiococcus 1 Jehoida 6 Fasnia 37 partían 16 PhD 1 Jalsaghar 4 Folguera 1 Franay 8 Gavarres 1 peridotito 4 Kaurin 2 NEMS 14 floricina 1 giella 1 Gladkowska 1 honban 22 nuevos 1 Jahresberichts 3 pirlo 10 Loei 1 Ouelbani 4 invés 1 janthina 1 Hueravillo 16 MINUK 1 Ojostsk 17 Micalet 8 Fresnedo 6 inténtanse 1 Philology 6 Lobatón 3 Niedersachsen 1 Ksamil 27 peer 1 nebulizados 2 meravigliosa 1 gelehrten 7 Mecencio 1 infíltrese 4 Pixii 2 Hidatidose 1 Neoselachii 1 Hiporco 9 inscriben 1 leninist 1 Lazise 2 perralleiro 1 Oruvan 1 Petersohn 1 Mattole 565 Illinois 6 Niedermeyer 1 fidelibus 18 idealizados 1 misófilos 1 kúroi 3 inhabitábeis 1 Kouaï 1 Pagamentos 1 Klanv 5 Lafonoteca 1 Goianésia 1 flexuosiformis 2 Mineixa 1 OSFL 2 Guangdong 4 Geographie 50 Persoa 3 Lemps 4 Muxiliformes 4 nogai 3 Glaros 2 guevarista 8 FHV 1 incontrastable 1 I?Be 4 manningi 1 intensifs 1 Gringos 1 Hérémence 1 kobez 1 liangii 32 pasaren 1 hedghog 126 Lubre 2 percursor 4 Mosto 1 Mumps 50 folios 755 frase 2 Lexotan 9 Hertwig 1 Pawlatsche 1 Higginbotham 1 larmoyante 4 Filan 1 lavedan 8 peitea 38 Paramos 12 monat 4 mudárase 9 PDR 1 panadizo 1 Pícaras 1 permitiéndolle 1 leniusculus 1 Memet 4 Lalim 134 People 1 Inverson 1 oomiia 46 Nakano 1 hedreira 3 folletinesca 707 naval 1 mutatum 1 píncipes 1 Harnessed 1 Luostari 17 Onze 3 Geissolomataceae 8 Jenney 1 Muç 3 kinact 1 gababan 1 papa Bonifacio 6 Fore 1 Lajoinie 1 Kembolcha 20 Gimbutas 31 Paquita 146 pecados 9 Gorno 2 MJV 1 Graphico 1 Pídovos 1 Octodorum 2 Kazikes 3 Krokodil 1 fuxio 1 Mbul 1 Lukyanchenko 1 khrim 6 Kunya 1 Liakopoulos 4 observaría 1 Mannox 1 Khazim 2 Ganilau 1 hemotransfusión 1 hobits 1 LucasFilms 1 Hawaiiloa 5 oleaxinosos 3 morrreu 4 massimo 1 Ornados 54 imprescindibles 1 Freijanes 2 hubieran 1 Letterkundich 2 kazekage 1 Goukas 2 ph? 2 Maylan 1 Newble 1 Flurazepam 56 hbar 2 Officii 38 Magnusson 2 Mernetaph 32 Galician 1 Mzymta 1 Nárvaez 1 Grammatophyllum 3 Patlabor 1 Kantaldia 9 micose 1 Ipota 1 Jute 1 orationes 1 Jigglypuff 1 navigli 3 Offlaga 12 pangolíns 23 Patrol 30 inxenua 1 maníes 2 Garcillán 2 Intercope 1 Neiseriáceas 1 Moleclar 1 FILICARIA 4 mantivérona 2 incredible 24 Pementa 13 megafauna 1 guatambú 2 Igaciencia 15 Lukaku 2 microscleras 1 Neferkare 1 forúnculos 10 Koštunica 1 indefrenza 2 Gambell 1 Nordby 49 menhires 1 hiperglucemias 37 Péptido 1 Montemolino 4 Hyl 1 metapolítico 1 pàxinas 1 masajid 2 Parteluz 23 GUI 1 Firkušný 21 Pedagóxicas 3 Kranichen 1 Otep 1 familiarizara 1 Ngarinman 1 Halsgrove 1 Israelachvili 4 parodiado 12 kaempferi 1 Gresques 1 ifrit 11 Littérature 6 Honto 7 Folkstone 37 pasalo 1 Lundholm 1 GOVERNADOR 1 Kawaa 4 lsr 20 macedonias 31 invaxinación 1 Oedipum 22 Nabil 1 Friction 80 padeceu 1 manasen 1 PERI 33 Kaposi 2 patinadoras 113 indias 4 fulerenos 5 laranxeiro 3 Ocupábase 7 Opcións 1 ordés 2 Kenzaburo 5 Jonquil 1 Jumbotron 6 homeomorfismo 3 GroES 2 livoniana 1 landskapsbileder 1 Ichijima 11 gols 1 Kudrjaschevia 1 Parany 1 Ferrdura 1 gentili 2 Percorría 1 incrementanto 1 huuar? 1 MegaVideo 2 iúniores 2 Ghata 2 Nyugati 5 Piliaieve 168 Nina 1 Gourgeon 2 ordination 20 incompatíbel 1 koblakari 1 Hareng 1 Ferrusquilla 4 Kordic 2 mencionaría 1 Othalan 39 Gamallo 1 Orbazán 2 Jenufa 1 Kapitoan 545 Letonia 1 hidridomas 1 llaneza 16 Neleo 1 Lumpia 1 lanipes 1 Historikon 1 Inscríbense 1 Neorautanenia 2 Litchfield 1 nulth 2 Ispiluaren 2 Hagenau 1 fosducina 2 glMatrixMode 16 obesas 1 Hiriburu 1 meridianus 2 pasnado 3 landmark 2 Gerde 3 GalEusCa 2 partenios 3 nudivirus 1 malem 1 Kuninobu 9 IMSA 1 küzd 1 Lavide 1 neose 1 Kety 5 infixo 2 Lusedra 1 Kynosoura 1 knutr 1 Lunule 1 marquee 2 Leonarda 1 planificará 1 fossus 20 inchamento 2 fri 1 fotoxenia 1 Kipphardt 1 Glaeseria 1 Idonda 5 Landy 2 Guarare 1 oleoílglicerol 1 Phytodiniales 3 patagónicas 581 independentemente 4 naftoquinona 1 Oltradige 1 Higaleja 1 Legendi 1 Pieksämäki 1 Jesperson 18 fomentaron 1 Kodiossou 4 macacino 34 Guadalete 1 haricots 1 migrateur 2 Granucillo 1 LoveToKnow 2 galardoouna 23 INSEE 2 Imposíbel 22 moenda 2 hostilis 5 Moiséi 1 Oyanguren 4 Harkonen 5 Fão 5 GCLC 1 Mongoloide 8 Menacho 2 Macareno 40 normalizada 2 lieblich 1 negativoss 2 occasioni 3 particularistas 2 Neyron 1 Hydaspé 1 Kamoh 22 gobernativo 3 monohíbrido 1 Malhadancha 39 formasen 1 Jernia 144 indirecta 1 Kuchan 1 geco 4 Paronniquio 4 Iamagata 2 Mogoticos 62 Ferreiroa 1 notosauro 1 pasaxeiros— 3 Onzas 1 María? 53 Gan 7 italianizante 1 Maudeleyne 6 Orci 1 nickelodeons 16 Peredur 1 Helianacte 3 Globemaster 2 Labaien 122 inédita 9 Hawkeye 20 orientan 1 Hybognathus 5 marocana 4 Nannetta 1 NÁM 1 Icaronyctens 5 Neiba 1 Mappel 2 perecedeiro 1 fundáronna 5 kesa 87 inimiga 5 Masuoka 1 Nij 2 licoperdáceas 4 guidismo 5 Paikuhan 1 nocla 1 pasies 2 Odelia 4 IFC 1 Lifschitz 1 morase 1 Peo 2 Luini 1 kertomuksia 5 oghuz 4 palaeos 1613 Papa 1 miyabi 1 Mozuco 5 Peruleiro 3 Juniet 1 obxectuais 2 persignaban 1 Heterurethra 11 Hawley 5 Madadayo 1 Mesodesma 24 Pigmentos 21 Migueliño 1 Lespontones 2 herzios 1 irinotecán 1 impétigos 1 percorrese 7 Ikastolas 1 IGCSE 1 Oenoe 2 Feltria 3 fenua 1 Gracchus 6 Halbach 1 Monorrail 2 Hydrochoerinae 1 Methylococcales 2 Janikowo 142 Ki 1 nairoi 1 Inflorecencia 1 Kedravra 2 Kirkjubær 1 Paraspinibarbus 1 —pintores 1 Isábal 6 Noomi 1 Mjgéés 27 ocasionaron 1 Leidschenveen 1 ministers 1 Jodo 1 limúlido 1 Parthenium 1 Freck 1 hepatorenal 1 Partuloidea 55 garzas 2 Infatuated 1 männlichen 1 nácenlle 33 Middleton 2 gluten 2 NECOM 1 Mestrazgo 1 Kroatien 2 Ngatangiia 1 pentaneurum 3 pacán 1 intencióes 14 PCs 1 Herra 1 Muhyo 3 Impío 129 métrica 1 Grisións 1 Gühne 1 Gazzale 1 Ossevatore 2 orribile 5 Perr 1 kraft 4 Iuba 1 Møghund 1 friidas 3 halon 3 illustri 1 Hypsicalotes 20 Lebowski 10 monoamina 1 inversível 1 physicus 1 Hanteru 1 matábase 1 kaua 2 nerpa 1 ksour 8 gazeta 1 mirarán 1 masacraría 4 Misiva 1 jocunditate 3 Pagus 2 incredibles 1 Lezghian 1 Muluk 2 ofimáticos 1 Leherteko 1 Gigosos 1 neurotransmision 2 LCK 3 Gaxa 1 pacifismos 1 minieólica 1 Lachner 9658 Pedro 26 Ödön 1 Plagius 1 Gurudev 3 ferrallas 1 Mortandades 2 Haleva 1 metatálamo 1 Giannetto 1 Norrath 1 Kapas 1 Kunstmann 1 Octamyrtus 1 Lampallás 1 obxectvo 1 graúdas 44 Lobás 1 Iarthach 2 panafricano 1 Kusamba 1 Marcaron 3 moy 26 Jespersen 6 grupais 1 laetril 1 liq 1 Nazziunali 1 namentlich 3 graellsii 1 gurrras 1 Gourney 3 Logudoro 1 Grabitatearen 1 Jenyfer 3 Otuna 1 Pértinax 3 personalísimo 1 Muliñandupelicascarabajo 1 Gazon 1 idad 1 mht 3 Masanasa 1 fittianum 1 Ghiiama 1 glioxisómicos 8 Hunduwa 11 oubli 5 FMT 1 medraía 1 Hidrolízase 1 Fuday 1 nécton 1 Helb 1 multifamiliares 1 Heroics 1 interromperíase 1 Hermenexilda 1 Fioria 1 lieblichen 3 Ovnis 6 Ister 9 heute 18 Fibrobacteres 3 motivándoo 3 Kalkbrenner 1 Periodística 2 IEW 2 intervira 1 flutuarón 7 mediaba 1 MadriDC 1 Holocristalinas 1 Grumblemon 1 Fautrel 1 Passanantí 1 Firmato 9 Irmak 1 Nostalgija 52 Hilda 1 Kandemir 1 mits 2 Lanzadeiras 1 Ntaláras 15 Hititas 7 Mamoré 1 nihonga 1 Jecoufer 1 Foloña 2 Grotewohl 3 Kaba 2 Ledra 1 Kirriemuir 1 judogi 1 gypsorum 1 munumentos 12 festeiro 7 Feixes 3 Kimotsuki 1 gállaras 1 fotoorganótrofas 1 Pescos 1 Motumua 16 Geneva 2 LIDAR 32 Músculos 1 Ovocný 1 lilloana 1 Menao 1 Fotbalový 1 frutosdeutopia 1 francófilos 6 mystère 1 Fosfuro 6 Lett 4 Künstlervereinigung 2 Nonito 2 nilosahariana 1 intramundanos 43 invocación 23 galena 4 Gloop 3 Panom 8 Guardi 4 merendeiros 5 Orpheu 1 minián 15 mim 1 Oruxo 1 integritate 1 microaspersores 1 Pedrosiño 6 Hyams 1 Midskalarheidahraun 1 hematoide 1 Gabeca 12 Leonhart 4 Munte 1 limpaparabrisas 8 Fotograbado 1 irresponsibilidade 1 Linurgus 4 óptase 1 Mezame 1 piquiniño 1 natufios 2 Kanpeki 1 Nightrage 1 Munqidh 1 Lithographia 1 Panjab 2 Gociano 1 Pasapezas 21 Herón 80 gastrina 1 faunais 2 laitier 5 Pitos 2 Mighara 74 om 16 Nicolson 10 Hornigold 1 Meixonfrio 19 Mild 1 Orthal 2 francófilo 26 lamina 3 Maniobras 14 NX 1 Ngerubesang 1 myntunionen 8 Gemmatimonadetes 1 pergit 1 Levaillant 1 kenyanos 1 martir 1 Grunnen 1 Kindertransport 1 Microfibre 14 Neander 1 piróxeno 1 Ideolóxico 1 Goudsmit 1 Nassere 19 Leszek 1 Linasin 17 McNish 1 panís 2 Fourré 1 Maymon 3 Germanistik 4 kya 6 imbéciles 4 lexicais 1 ocultala 4 Khnum 1 insertábase 1 Paiolante 4 foliolos 1 gezurrik 1 Higashikasugai 1 Hyakuikkaime 25 incriblemente 2 Glaschu 4 Insúa 12 Jabois 15 inmunodeficiencias 1 inscribíanse 3 ffDNA 1 Modela 1 Physochila 211 instalou 1 muscazona 62 mia 1 Liutizanos 4 Líbar 1 ofendidas 1 Morrice 1 Laonnaise 10 Gotardo 2 Llanddwyn 1 ignóreos 1 meninos 1 Muljacic 1 Masanari 1 ghoomar 1 gima 2 Matteoti 9 mobella 1 Paladella 1 fitoquelatinas 1 jojoya 2 Kinda 1 hancockanus 3 Goraguer 1 Ketec 9 Furuya 1 Ksila 1 luciuse 2 Pádraigín 1 genees 1 Jægersborg 4 PCS 1 Malvados 1 Jabbeke 2 organula 1 Georgo 1 Lordemanos 1 gajowy 3 Hege 1 Mariées 1 feirear 1 Mehalzu 1 Kpackage 1 Kereón 1 Ghaybulloyevich 1 Muted 1 paellera 6 Iríbar 7 Montearagón 1 noviembro 1 mirifica 1 nalgùn 3 integraranse 2 insubmerxible 1 Hish 1 funiculares 1 Luboslavova 2 Moross 2 imanente 6 knockouts 2 Lavapies 1 Georgio 7 Folerpas 2 Phyllobacterium 1 Gerre 4 Fraijanes 2 osc 1 Iwanb 1 Ovsejenko 1 marijlan 6 Iru 1 Incoativo 1 perichaeta 1 peñones 44 outórgalle 103 felices 4 mexacáns 1 ghazâl 1 neurodestrutivos 2 Nossal 1 Geóffrey 13 Oshawa 1 Masescha 2 IaI 1 Hipoxeos 1 patronización 21 Mecklenburg 1 pekmez 2 Pensionados 1 Graver 2 Metrosídero 1 pirimidínicos 68 madrileños 1 Pandeireteiras 40 Guimarás 116 padal 2 †M 5 Perrie 3 optasen 1 genitori 1 mehati 1 Nußdorf 3 mertensii 1 ORÓSIO 5 interrogante 6 fornadas 22 identificalos 2 Llasera 15 Licores 1 Neeli 2 Hansgirg 7 necto 1 piroxenita 3 imam 1 frautines 1 plasticas 1 Löwenapotheke 1 jurassiens 1 Maishima 1 KWord 3 lambrusca 1 mnésica 10 Ghia 4 Philocheras 1 Mandol 1 Gneeveguilla 1 farnicoco 5 medicadas 1 Nuculidae 2 Gaucelm 1 intenzón 1 gentío 20 hidrolizados 14 Lunik 1 Kubigangri 2 Monestier 1 octavadas 1 perderedes 1 Lugáns 13 lutescens 1 heterocarion 4 Plane 1 Mezoiras 1 literatuira 84 frustrado 5 GOG 3 ordenouselle 86 luvas 32 piadoso 215 Leinster 1 llévame 2 Ishq 173 manobras 1 maldite 43 Iberolacerta 1 Imavere 1 meldolillo 1 pertigueros 3 Freixoso 2 inclúenos 1 Longaínza 1 fihrist 1 Pantanodon 17 Oribio 1 Nordh 1 Monstruoson 3 Fallersleben 4 Nepean 12 insípida 1 laccases 1 gaús 56 Nisa 1 himmelbaurii 1 Isochrysidales 13 Narf 15 Pèire 3 Gattinoni 7 hidroxiácidos 1 Nein 2 obstruída 4 Pertini 2 Micrologus 3 Fuenteoliva 1 Motorpasión 4 oblit 1 miniver 3 fibronectinas 1 Mosóc 2 LeRoi 1 libelli 1 Igualeja 1 Livemore 1 Gwili 1 muxiron 1 galegocubano 1 monoparroquial 31 Hanson 55 Kuban 59 inxustizas 1 Montoyita 44 literatos 1 Olympisches 1 Omosudidae 2 k^?r 1 kaikias 1 Mogounus 4 JAM 1 microscopy 1 Koklova 1 Iuil 3 Pipá 1 Paralabrax 1 neumáticas 34 pigmentadas 60 papiros 1 fotolitoautrótofos 2 Gordeev 3 Kaafu 1 hajimaru 1 Gurís 1 Kodesh 1 lamense 3 inventaran 25 Kruckenberg 11 Kaveri 4 paganas 1 lgnis 6 Pinarello 3 Mialxia 1 Peitieros 2 maîtres 2 Gallowglass 1 Ipalé 1 Papazov 1 Historiados 1 Nierstraszellidae 6 Lezen 1 Kaile 2 Grigorenko 5 miscella 2 korshinskyi 1 indoarianos 2 Jacopone 4 Fenicias 2 Ilian 44 Papiro 1 merveilleuse 1 Pallawah 1 Lacédémone 2 Gilarte 1 Haukkavuori 1 Haapiti 1 Papuanthes 1 Junbish 40 Partito 29 nt 1 Lighttpd 2 Meitogeika 1 Knizhnoye 2 Itaquera 3 Hemodinámica 39 malvada 1 naOpéra 2 Hostuviroid 8 grise 1 multinotatus 16 Helianthus 1 Mavrogenes 1 Hochner 2 PiC 1 logopenacard 2 Kiriyenko 1 fridharöld 1 Jahl 2 percolación 2 furare 1 órden 1 nobiliaro 4 Lactuca 2 gravándoos 1 Permitíalle 3 Laguar 2 panxabiano 2 Lampin 1 Ilarratz 1 Pasase 8 nonna 1 Helenoponto 1 muppets 1 Fathallah 123 Gallery 3 Ostrovski 1 láparos 1 Pasdar 4 Peyragudes 34 macronúcleo 1 Kesos 6 másica 1 fracasen 9 organizará 1 Lahart 334 lagoas 1 minusvaloralo 1 Olaz 1 Paliepiai 3 interfértiles 2 pinguelo 1 Fortificação 5 Obsesionado 3 Inconsciencia 1 Llovizna 26 Millie 5 inspirase 1 Nozito 1 miguelitos 3 perseguiría 1 misíles 5 fantastique 24 LTRs 3 hallux 4 Morzine 1 oposición— 13 Liubomyr 11 frères 5 lévanas 1 metalófono 5 Jesolo 9 Maikel 1 Oestermann 1 mamosferas 15 octaedro 1 medicalnews 1 géif 1 lugars 1 lutherie 1 Klasies 1 Janar 1 Omis 4 platycodon 873 Natural 1 merdán 3 mordía 1 Pettino 3 inactivadores 1 lactamicus 1 jazykoznanija 1 LWJGL 1 Jefes 2 lita 8 Lotta 1 Gruzinskaya 16 forrada 1 Kaveripattinam 37 Monaghan 2 hipertermais 21 mid 5 Mallaig 395 patente 1 nautas 14 Meirelles 1 Maleuvre 1 LoveBlood 1 Pelagoniski 3 Gogarty 1 Monoecus 68 Maite 2 Maremagnum 1 pindelkrabba 1 Fukyowaon 25 Holding 1 Myouzai 35 Gohanda 1 multirexional 1 GazellaSoemmerringiWolf 23 káiser 1 finobálticas 9 Horry 2 hipotrofia 1 Lethiec 11 páis 1 Onysyfir 2 Olodumare 1 Früchte 6 mast 1 Kuvanmas 2 neotestamentarias 1 mish 1 IRO 1 Fidan 10 palmada 9 Ichthyomyzon 8 Jeps 4 Fujisaki 1 Jacknow 1 Lieues 9 Mois 1 lull 1 flanqueos 220 Órgano 96 modificando 2 Neudeck 1 Phymatodes 1 Graffenberg 1 Leminskiana 10 Penarredonda 157 lisas 1 Isavirus 21 pecháronse 1 Peliceira 1 FLORIANVS 3 Kajitsu 9 Forkel 1 Obstrutiva 1 lemnios 1 imflame 1 heredamiento 1 Hoger 4 Landslide 5 Hlín 2 inédite 3 Palleiros 1 meterei 1 matous 19 Myspace 27 Lyonnais 1 Impfondo 1 parodiadas 1 Jacopetti 3 Hodonín 1 Glieder 1 Inmunidad 1 Gaimardiacea 2 juegan 3 nimo 5 pathway 9 ORI 1 grandilocuentes 1 itzá 94 Lolita 1 gramados 1 O?eleni 1 Fosforilan 1 Gaztetxean 1 LLedó 5 Hocus 8 Industrialización 2 Heinitz 1 keredo 3 Mengod 1 Orbón 1 modificándoos 1 gasas 2 Liens 402 Paso 102 mastocitos 1 Maghella 1 mtama 1 PAO 1 haias 1 multivariábel 1 honolulu 1 jumps 12 involuntarias 1 morza 1 moqueiro 5 Jacki 1 humanitaria? 1 Olmera 1 FLUC 5 Mimmo 2 Ludiente 1 gannen 4 innominada 1 Pentre 1 frandes 5 Heusen 1 moderatore 1 parnelitas 1 nudicaudata 1 negriero 1 Nawawi 2 indeno 1 Isobaras 1 kulan 1 Malar 2 Lamantia 28 Loka 3 Monégasque 2 Observateur 1 Lindpere 7 Hepatocystis 2 Lofa 1 mátamas 1 Olimpicos 1 nu?n 8 Lamizana 1 gravitantes 15 mapache 46 Fonds 1 Oyola 5 moio 30 gramínea 1 Mulemba 2 nitrofurano 151 ordenadas 1 GGH 4 miglior 3 fosilizou 1 Kerayong 2 Igresia 23 morran 2 Milone 1 gácé 8 Koponen 177 inclusive 3 Kanner 4 focidio 1 PClinuxOS 1 goði 6 Manilio 2 Griz 1 Ictioplancto 1 hiperquinética 6 Kokura 1 neuroquímica 3 Kujawska 2 Monosomía 1 Ojcze 2 impórtame 1 hiérogamies 1 Mô 4 Formica 4 Luyendijk 90 Inscrición 952 mellorar 1 Lagostinos 1 Fozzie 1 Patache 3 Paleontology 1 justiciera 3 Filigato 1 noroocidental 2 Isolacionismo 1 Hyakinthos 1 Labeyrie 1 parturientas 1 foglio 1 lacedemonia 2 Invenciones 90 Musas 3 marinaio 5 papiriforme 16 Lura 3 Novakovic 1 hipopnea 1 Milgrom 1 Kordelin 1 gotiños 18 Ganz 1 Festéxase 2 Lamosos 1 OFFA 13 kava 45 pelotas 1 Magadhan 10 homicida 1 Hurtigruten 1 Meliopsis 2 Minke 146 Lucy 3 Navata 1 Loloish 2 Hiisi 1 fonticúlidos 1 mesorrexión 2 Mait 1 labirintodontes 1 percalzo 154 Gardner 1 Kocian 2 Oirigarum 19 mediadora 1 Físiques 255 Mª 3 ignorala 5 Nikolayevna 1 Metaxakis 670 mestres 1 FERPALIA 1 Kauleas 1 Hidley 5 Neghra 1 pernolas 30 Minogue 6 Orientaciones 1 Mosura 1 oíche 1 lacrimomuconasal 11 interaccionando 3 Fuchi 17 Opole 1 Pievigina 5 malgaste 2 Karbon 1 moural 2 luxuriosos 1 Galissard 1 Pharmacologie 1 obstrúense 1 metilanilina 1 illárona 54 Grammatik 1 Julissa 1 papillatum 1 Inxectar 1 Izvoare 1 Natã 2 hiperico 1 multiestado 1 miniB 12 Ferradillo 1 Konstruajho 26 galegofalantes 7 Phoebus 23 fuma 26 Morrone 1 manjé 5 mesturadora 1 kaioshins 1 gantroenteroloxía 1 Kruce 11 fuligula 2 Palhoça 1 mensis 1 merletutut 2 Helping 1 Gaznauí 3 Münze 1 malogramento 2 fluoroscopia 1 Oema 1 llamaron 1 Khonkaen 3 Hippel 2 llevado 1 incineracións 9 inversionistas 1 imidazolidina 2 Panicóideas 3 Farsas 1 Königsee 2 Ngurah 7 pechábase 56 pasas 1 igawen 1 Luncoiu 1 Mallon 2 Kikan 1 ngop 8 guttatus 8 micrópila 2 Piuma 1 genoù 1 Katryna 2 Hajos 2 Perpiñá 1 oido 1 pA 6 obríganse 6 Nimo 1 fullereno 1 Furtun 3 Mindfields 1 LaLola 1 persar 2 Fuenferrada 1 Ghiorghiu 1 nnnAnn 1 ligarase 1 ovifera 1 Lûnasa 2 peñascos 1 Fujinomiya 1 Marratxa 1 Kerstmis 19 Gorlois 1 Itchyworms 1 PHACTS 6 Pelargir 6 hidratadas 1 Halic 1 Follets 5 halló 2 maqui 1 Meitaro 1 Octoxenario 1 Laingiomedusae 1 fortificarase 1 Kartagener 1 Gardenology 1 Kamionkowski 1 inclinadamente 1 Lollys 1 Naranjas 1 oenanthifolius 1 líguas 1 performatividade 8 Middelsee 1 Ornitolóxico 1 kalari 1 Mirowgh 1 Nervilia 14 Oferta 43 illarse 25 placer 1 Phing 1 Moyeni 3 Ganander 2 KDevelop 2 fitopatóxeno 2 perceptual 25 Meiose 245 Newman 3 jetzt 3 oncovirus 49 Paradiso 1 Nayman 1 Hageri 2 minn 2 Fusís 4 liberábase 1 Lépida 2 octó 1 Movéronse 1 Kúvíkur 186 ordenada 1 Lovua 18 invólucro 17 iranianos 25 Hush 2 Melkov 1 Geospirillum 56 Forster 1 idis 1 micrognathus 4 Nissa 5 ignífugo 1 Orosius 2 kleftes 117 Mateu 2 Hokuei 148 Museu 2 gastric 6 IPs 1 Konfederacio 1 negrense 3 Krasni 1 GEIE 1 Kaiafas 1 Ginecólogo 144 infectar 4 Helenieae 1 Kadiköy 2 Filipestii 1 familiarice 2 hemocultivo 1 frisk 2 Geu 456 Forza 1 Nautio 15 flashback 1 percolatus 1 Paracentropyxis 2 Neutra 1 Kotelawala 1 MAYNEZ 4 Navero 1 Mörkerseende 1 pasábaas 2 Oyamada 1 grausame 1 Kureha 2 perlíticos 1 piça 1 hamsters 1 Križanac 551 Muñoz 1 Guarioba 1 Melford 1 kubaryi 1 irrevocábel 4 Highlights 1 meteoroloxistas 1 jaygah 16 Mohandas 3 Pavlou 39 Hermitage 6 Hengelo 1 penetráronse 1 Pilzno 2 fyrt 1 impresiónalle 1 hóuboas 1 magullada 1 Jesselyn 3 Makabe 2 Frühgeschichte 8 Florette 1 hyakuman 3 orixinaranse 6 interactúen 1 Isaaq 4 Keenlyside 61 forais 2 MacNicol 1 paraugueiro 1 Hunbeanna 2 Oração 1 gasísticos 200 foxo 1 Llombart 2 NINCDS 2 Nguru 15 incendiando 1 fenogrego 82 hormonais 1 Karurá 21 pilosidade 1 Hobgoblin 7 limpadora 1 planaria 1 indefiníbel 2 Goodridge 190 Hermes 1 mamiferoloxía 2 Oratory 1 kat?'v?it??s? 1 informadora 1 Geneser 1 Leveridge 2 mandir 1 Nunciaturas 1 fíltraos 1 floreix 12 Gandesa 2 nubeiro 1 pacea 1 ilusionar 1 KvAP 1 Grayhm 1 Oberaker 21 PALC 1 Kouzeloglou 1 Odontostelma 1 Gilierna 3 Hollandse 1 Orgens 1 oxiclina 5 normalizaron 1 Lesouezec 2 Hancocks 6 origens 1 Funerais 1 keskyt 1 Maymuru 1 Itsukaichi 1 idammen 1 Ondrasik 6 Nascar 3 Fenollar 2 Khujand 1 Kapsberger 1 õigus 3 Holmb 4 natürlichen 2 Ghab 4 NLG 82 Piacenza 3 lyrata 9 Mapother 1 Phytyl 4 nostrum 1 Makis 1 Kuras 1 orporation 82 Hu 1 Krao 2 hilinos 3 macrospora 1 Goslicki 1 gasoducto 122 oscilan 1 khronologiya 10 Lorre 1 Hávarðar 1 megalópolo 1 Macoi 2 metilfentanilo 1 Naabat 6 Jouvet 1 Oubril 2 Optativo 1 Gematria 1 Padekite 1 Hopfenbach 3 Géorgie 1 Majzén 1 lepidum 11 Monseiro 4 pahlavaní 1 platyuros 1 Negroamaro 6 Ihesus 1 Maírín 5 maduren 1 Národni 8 Maipo 1 maguanense 1 picti 2 Mutismo 2 Pareira 4 micáceos 1 Mongets 1 Phyllostylon 55 Giulietta 4 oprichnik 1 NationalPark 18 foliáceas 612 permitía 1 mallochi 1 kempeana 1 momentanemante 1 kiek 4 leolítico 2 kissa 2 Linero 1 Granlocomon 4 Lapize 2 Nowisky 57 gasosos 2 McG 1 korida 1 Goodheart 1 Lectis 1 Fortellingen 77 Gregos 1 opositiva 7 Goor 6 Garr 14 Palgrave 4 nártex 1 nelumbo 2 Leumi 1 olyfaunt 1 Glissant 1 ouml 13 hipotenar 1 Joosta 1 mahapurusa 2 Jolley 1 Herdaría 1 Ferradosa 2 fotosintatos 1 Nasher 1 kiegyezés 1 Manón 1 frecuenciais 1 Féderalista 1 hidroxenocarbonato 1 Pieragullano 1 Fitopatologia 1 Koordinakundea 1 Fhada 43 Impartiu 272 moderada 1 FOESCA 1 Mackiewicz 1 muskat 1 minensis 1 Gottolengo 4 ochotensis 1 hialoidea 1 Masra 1 Iced 1 hondartzak 28 Gillian 171 namentres 1 Liesveld 1 Papaelias 1 Iaea 16 Hoshino 1 íspese 1 Mordvino 1 Haleakala 4 Mulberry 15 logarítmicas 1 Namoreir 11 Heterolobosea 1 Masatane 2 Kolp 20 Irtysh 1 multixeracionais 1 latenter 4 Niasviž 12 Ghent 1 Ordéase 1 FlatOut 4 Lisabetta 2 flouma 1 pirlos 6 Maurepas 6 Platanistoidea 1 intersemiótica 2 Gorazde 4 Granacci 2 Globósidos 6 Luda 5 mörker 1 kojim 1 Haramburu 6 LaSalle 3 intubacións 2 Kojo 1 moselés 3 Pavletic 1 honrándoos 4 Fater 1 li?uk 2 Mbemba 145 Frances 1 microvegetales 1 GENERU 1 Fardón 1 Hamochi 1 Omirah 8 Mehetia 5 fotorreceptor 1 Humanistyczno 1 Marzi 1 Jázmin 1 metabolíticos 1 nomeáronno 1 Laggan 2 Hastado 277 Nacho 2 instancian 1 Pimolisene 54 Mexicano 1 Phytochem 7 mers 1 Kozáni 14 Liotta 3 miragres 1 Hipuridáceas 38 Nationaal 3 insectoss 3 periglio 1 Neodypsis 2 Garroway 1 Garvín 47 Natació 1 Itauguá 1 Migo 2 ocluír 1 Hisaw 1 Frad 1 Nefarian 7 Gonzalves 1 Monstrous 20 ordre 1 Mahendrapul 10 Mississauga 1 monosifóneo 1 isostásico 8 fillastros 1 Kangal 5 McArdle 47 Mito 2 lemuru 1 PALM 1 Petroedmondia 1 Janics 1 Glacidorboidea 18 Hang 1 metilaminometil 1 Fimiani 154 Kobe 1 Morskiye 1 HcpA 2 Guacamayo 1 Milhas 1 moh 1 Leeder 1 fanado 60 musicalmente 1 juruanus 2 Misconduct 140 pictórica 1 Mancias 1 isópacos 2 nectónico 1 localiades 2 perícopes 2 modalizada 1 occhei 5 Flugzeugbau 1 kaureno 1 Pancratiastes 1 Mirebalais 1 Mühler 9 Lively 2 Lorimar 4 pintará 1 jao 5 Kunda 1 peduncular 12 Oleksandr 267 Pinto 4 Iliad 2 hrbitov 3 hexosaminidase 1 Ludik 3 norcoreanas 1 Gelu 1 Messene 1 Märthesheimer 4 Pekerman 1 lykien 24 mercenarias 4 Mese 33 Makemo 1 Lukimva 6 Harakat 2 Gustas 1 hiperdopaminerxia 9 numismáticas 1 petaFLOP 34 Hadley 1 operala 1 favas 1 Kirkeklokke 1 Interbon 1 Minucioso 4 Laamanen 4 Muhamad 1 kinnus 1 Letros 1 interfoveolares 1 kakós 15 Mellow 1 Pisaurus 1 homeótico 2 LTH 1 glycofilusa 1 NOÉ 5 Onsella 3 mesapios 1 Odpískané 1 Limbang 1 Kobuchisawa 2 Guten 6 Ojén 2 Pilocarpina 1 noventaoitistas 27 itinerantes 1 Gella 3 Gunche 76 lendarios 11 Georgano 11 Norns 1 fava 1 lexes 5 Mendeleev 5 junk 1 geleden 10 Outrage 2 Modivas 1 Pave 1 Horjenti 2 Ghezzal 1 Kuznetsova 165 Lourido 1 Heterocythereis 2 frutificasen 12 heurística 60 Paradoxo 1 peplómero 1 Leiriense 1 Mbhashe 17 Patriarcal 1 Pacura 12 ls 1 Kontzertua 1 iraniennes 1 marcio 6 Iglésias 1 Helsinkiensis 1 Notocheirus 1 optimidade 1 Merenguito 1 Namoráranse 1 Gerddi 25 manchega 1 monociliados 1 Inonia 3 Gewehr 1 grimalt 1 Mirjami 3 ostentoso 1 Komborodougou 1 hizieron 1 Kaleras 87 Feito 7 Móstranse 1 Koskullskulle 1 Kidus 1 Létavértes 1 ortosilicatos 1 ondi 1 Flarv 2 Osterley 2 mensualidade 1 multiestático 2 Otílio 1 mediatecas 1 miniatum 1 Monem 1 Peccantem 2 olvars 265 Igrexas 1 Horson 24 macromoleculares 1 heróons 2 Luen 2 Perina 7 Føroyar 15 Panisperna 1 Gradite 2 Furuholmen 40 Gaiferos 2 Pentaceropsis 4 Merimdé 2 marioría 1 Pauldarrak 20 Gnathostomata 1 Pandectarium 1 Glenfaba 10 Peebles 1 implementase 17 permanecido 2 monelina 148 Mariner 1 Instruccións 2 Makanrushi 1 Oliveirra 1 ópitco 1 Moskowitz 1 Laureola 38 Job 1 Fazáns 1 Identite 1 Luterans 9 Magica 2 ouvirse 1 Pacaneiro 1 lalalalá 1 milling 1 Nioaque 19 Musset 1 Furcodona 13 Lonardi 80 Noalla 1 fått 1 luditas 5 Ilorin 1 Karpatech 3 Opencor 1 madrassicum 233 mitocondria 1 paranoïaque 5 glicerato 1 pedian 2 maiora 173 invitación 2 inadecuacións 112 Kafka 1 Hilyard 1 Photharam 661 limitado 1 noretisterona 1 Hochrad 50 gratuítos 6 minimizados 2 nein 1 oligoovulación 1 Pažaislis 1 intrunxios 13 meningococo 2 harp 1 Gallin 1 luctuosos 1 ornitomímidos 1 foste 9 Lluçanès 1 Notley 1 Pactou 1 Nelso 1 Osadu 3 Furipteridae 493 nena 2 GCSF 1 Gaskil 2 Peltre 1 manobiósido 1 Lapos 2 Pasarán 1 Huelmo 36 Pepsi 17 Oceano 1 mpfflugzeug 2 filicifolia 84 Full 3 pier 1 pantasmado 17 Instálase 1 lejeuneana 1 Firmistáns 4 marcándose 1 Goueloù 1 misterivm 2 Nenasa 1 incomuniación 1 Gaika 22 incautación 1 Mosiera 7 microdeleción 22 Faltas 3 Garrix 20 McClure 5 Lampazas 14 góndolas 2 Gutheim 2 Gbarnga 1 laudis 15 Maurín 1 Ksour 1 neoyorquinos 1 McGibbons 3 microordenadores 1 Floréal 1 máthir 120 pescador 2 paragrama 1 Peaux 22 Kutaisi 7 Guanentá 2 germaini 4 Markovnikov 3 Photorhabdus 1 Markovits 1 misterium 5 Lophophorus 4 gravasen 8 Linfomas 1 Garduña 7 Lucín 2 ocios 16 MNAC 2 Jazzland 1 Neak 134 GMT 22 Mikolaj 1 Kaprelian 1 Gwalawo 1 Paltinoasa 11 Guzman 2 lamagueiros 5 pinnatífidas 1 malandrín 8 plasmadas 1 FRESU 3 pamirianas 7 galorromana 6 Gelre 1 magnetotaxia 1 lumira 1 jinggangshanensis 1 military 1 Janák 68 permitíronlle 5 Moderadamente 3 Neamblysomus 1 Os 1 higrófila 12 Handsome 22 pechándose 3 Namakoshi 1 Kacevo 1 Frisionum 2 invan 1 osadia 4 lavouse 3 Gianola 1 Mukanee 1 Fts 1 Murte 21 mastaba 3 miorrelaxantes 1 Mindset 1 gaivotín 1 Maßweg 32 Femmes 1 Mirafentos 14 Oost 1 Ignatievka 1 forzaríase 1 Hydropotes 1 Microdancing 10 Matchday 1 phutai 1 inarizushi 18 horarias 1 Filolóxicas 1 morisiana 1 Phoenicoperus 1 metiloxidocarbono 1 Mouley 1 madurés 1 Lohin 1 Maféré 2 Osako 6 Fórmano 1 ifomauga 1 filicetorum 5 Jaakko 2 Kiprotich 11 macla 1 Johannisburg 5 Monsalve 1 Motorbooks 1 gues 5 Gombak 1 Hoppip 1 lamuka 1 Otaudi 833 hormona 1 Mobbar 2 massena 1 muziekencyclopedie 32 Ivy 21 Pavement 26 PHB 1 Physiologica 1 nómine 3 intercámbiase 7 Pittsburg 1 lehendekariak 1 istituita 5 panadeiras 6 Maye 49 Ingleses 1 McCraven 1 kuechenkunde 1 Jeejeebuoy 1 Mescudi 126 paterno 7 mentiroso 2 Ostaig 2 Pentlands 133 ideoloxías 1 pentamérica 1 Lecompt 1 Jihun 1 kirbyellis 3 Higeki 3 Formuláronse 1 Fetlinska 1 Inès 27 fíxanse 1 idolo 3 Joyriders 2 halepense 2 Imi 13 Lodge 12 levantaban 1 flotarán 1 Habelt 14 Gosling 233 Martes 2 Íbice 18 oligarcas 5 himlen 1 longitudo 2 Guitarrero 3 Nitrospiras 2 Kingori 4 Hyakumangoku 1 Marlis 1 Inupiaq 4 Kallman 1 lnternacional 4 Picaporte 1 Myxus 1 Iyakkam 2 Kienzle 3 fraternalmente 1 Nuzhnaya 58 Pemán 1 Kougyoku 5 penitenciais 2 Leboso 2 Galt 1 —grosos 6 Melozzo 1 lóbudos 28 GTC 1 krapohliana 2 hsdM 1 inalambricas 2 nerädäd 1 Iulian 1 partillábanse 2 margrebowiei 23 intervido 2 gaida 1 Gén 1 fromHigh 1 invernado 1 Paguridium 1 Hilduin 2 Farenheit 44 flotan 1 Hosianna 1 Ordonis 1 Lipson 1 Médréac 1 Ñoro 3 glicurónido 1 Pechkam 1 Gandamu 3 innervan 3 Foh 1 inflammatio 2 fosfomolíbdicos 1 Maurane 1 Orgères 56 Kells 2 montiños 1 intensificadoras 2 Knottnerus 4 Oppert 1 leucophloea 21 Ludendorff 1 pectunculoides 7 Mazorgán 5 Gominolas 2 Merinthopodium 1 plantait 2 fosfosinalización 4 pedregal 2 moitisimo 1 Hipocastanaceae 5411 luz 10 pedíulle 1 Gravenites 3 Lundahl 1 maquetados 1 GLK 2 grandii 1 Khalij 19 Marítimas 6 mesolímbica 1 Kayoko 1 Logresti 3 Forzados 2 FLU 14 molestado 201 hostilidades 1 Malaleuca 1 Honraras 1 Niehls 4 lactífero 2 Pedretti 2 inge 1 kantorea 1 FWHM 1 parramina 3 Geerinck 6 lanzándoo 2 HAPS 1 Kèlamayi 3 padel 1 pandionisia 1 Hassha 2 Heerrufer 1 Letheren 1 Nouaye 3 faltándolle 2 hipóxicos 1 Iniciaran 1 márcaas 3 mudez 8 Phillyrea 388 minorías 4 Mandylion 7 pagoulle 2 Majdal 4 metacercarias 1 Hurmoz 5 Lotófagos 1 monofónica 15 manatí 1 mimetizando 3 Kapelusz 3 leboa 12 Malloy 4 minutuero 14 Gaslight 1 Kislov 13 medius 1 Laambert 1 Harrysmithia 2 Hengerdd 1 Impossível 12 obstruído 1 lipo 2 Ochsenburg 1 interamnios 1 hastifolius 25 Mecánico 484 ku 2 Planigale 58 mesencéfalo 3 Lechugales 1 gravetienses 127 matogueiras 1 magnetizadas 41 granadina 1 Horrore 1 gaze 16 Issoire 9 Mocha 1 ingloriosamente 5 infralitorais 1 Glädjen 1 Oocito 2 Lijiaxia 1 mirakler 5 Jian 1 Nematolebias 1 Lovro 1 Outrras 2 Glebe 12 fuxitiva 2 Fincath 1 Miramientos 1 luminosodade 1 fralaron 3 leoni 18 Morri 1 opositando 1 Internac 2 finxíndose 1 grig 1 Incunables 4 Justes 1 Nussito 1 musicias 2 novembroDía 1 Malini 1 herrialdeak 1 mestúrano 11 mathematica 65 pálpebras 7 Mado 10 Negrillos 1 haélios 1 Húmus 3 ministre 1 Participados 3 Pedralonga 3 Löwenstein 1 MAGNIFICVS 1 FOI 1 obligando 6 kerk 1 Kraigher 1 kahta 1 ouvirase 1 Leptopodia 1 Littaea 1 madagascariense 4 Merlès 2 Menaechmi 1 Pellestrina 1 Llibros 3 Filmado 330 instrucións 1 Neospiza 1 peloria 1 parenthèses 2 k? 1 Hvannadalshnúkur 439 Paolo 11 galactosamina 18 Frozen 6 pernoctar 1 frangipane 3 pecaminoso 1 pantropicales 72 Keynes 1 huskie 1 Nanichi 555 Humanidade 1 negreiras 95 organizando 2 incementar 1 insinuare 1 goniognathus 514 obtención 1 humectantes 4 Pescadilla 1 intrusiones 1 marceador 1 Nadou 5 geral 1 Karobath 1 Loginov 1 igualade 3 Oveja 2 Nevelson 2 Geological 1 harmonieorkest 17 mío 1 pinout 1 grutesco 10 oy 2 Koksijde 1 Homalomena 99 magma 1 Keaten 74 funcionaban 1 micropingas 1 Foucelhas 1 Hemmiki 1 Pasareni 1 mzinbana 3 galliformes 2 Nirwabi 1 pastorearan 3 integracionismo 2 neoborn 1 numeranse 1 gliomedina 1 paratracoma 88 pasarían 1 Pantanosa 2 Faradio 1 Mendong 1 inxectáronos 2 periindoeuropeo 2 flocular 8 fortísima 1 Iyang 10 Mathijsen 1 Görög 2 Jersei 1 Pennarosa 96 inhibida 30 Madang 40 morde 2 Himenóptero 1 Filiou 1 Pinglin 2 Hogs 4 fitoesterois 23 plasmalóxenos 24 Ivánovich 6 mixoploidía 1 herramienta 3 Otomana 3 Ferrassie 12 Kars 1 malvarisco 1 Gyurika 16 Ovellas 15 gras 1 IFNK 1 pervivise 1 Hamr 2 feniletilamina 16 Kleiber 1 Manzo 1 Palemon 2 Outokumpu 2 Marocos 1 orleanés 1 oxibenzoatos 1 lusofonos 2 HMBDP 1 Klymentii 2 Klassik 1 Hediondo 4 Klarskov 1 Pericote 1 morer 1 Gartsford 1 Lyrisches 2 parálisis 5 Inventado 1 palmitoíltransferase 1 katotse 1 Gripssonar 1 Lointain 2 Phänomenologie 1 Megisteon 1 Karytinos 1 glargina 2 meditarránea 2 lampriazo 1 Gladkaya 2 hormese 1 Makiko 3 Mardas 12 Mensaje 1 hemiterpeno 2 floroglucinol 3 Malabry 2 falláronlle 80 gástricas 1 materíal 15 Painceira 1 francesa Código 1 Molsky 1 Izpegi 1 Lomov 1 Platychilomonas 13 Marton 1 Gravedigger 1 imprescidible 3 Neagu 1 legibles 1 plattdeutsch 1 Mourille 1 Pantrigo 1 Hisar 2 Hexametonio 1 fotoheterotroficamente 1 gamboíno 2 groove 1 olgu 8 Ittihad 3 Forsythia 2 Kantara 2 Iulias 2 marchese 13 lutraria 4 gastrea 7 instituida 4 indepencia 1 nemtsy 7 Padronelo 1 miscixenación 1 hioides 1 Moyanés 1 interorbital 4 Llionés 7 liberianos 3 Masanet 1 oscailte 2 Marguérite 2 LeishmaniaMexicana 1 MikeMiddleton 1 Kunitsugu 1 formulase 1 Läskikapina 1 hecateia 10 Higashikurume 1 Kralefsky 3 inmunoabsorbencia 1 Paim 1 Jasanoff 2 paliando 27 Gaeltacht 1 friesii 1 Haggertita 1 passet 171 piollos 6 Landschaft 1 kvin 1 Lucronio 4 partirán 29 Icía 8 peripatética 35 monotremas 1 Journalist 1 Markner 11 Marleen 1 fushu 4 leucísticos 53 Montijo 1 Kannondo 6 Jabuti 203 Inmaculada 12 hermosa 1 lugareja 15 Northwestern 1 Kerdos 19 Muley 63 levándose 1 Maldicir 4 Ouzbékistan 1 peciolulos 154 Penedès 13 Mangifera 1 kuningaskunta 4 FOS 2 Ozo 4 ionqui 2 Interpreters 4 Mallea 1 labazas 1 ovaryb 3 grom 206 Malí 213 incapaces 1 necromántica 1 mecanicos 1 Plagioselmis 1 McIlvain 2 Nilapšini 1 martinicensis 2 Nunduinë 3 HNS 4 muceta 1 Hipofanías 1 Llaos 1 Ildelfons 1 Gericó 4 líase 1 Katsuyu 1 Froskeslottet 1 mamertíns 1 KDNP 3 Getariako 1 Macusani 3 parallelus 1 Lochdon 98 libraría 20 Hirohito 1 Paecilomyces 7 ganando 3 Gudziak 1 pemzektez 3 Hydatellaceae 22 Leza 5 Moloch 7 Mísiles 1 Igunga 1 Granfelt 1 Lopimia 1 Montenovo 1 Matheseos 8 invaxinado 4 Masucci 2 Nalaga 1 gaduación 2 Foradadeta 1 Gebio 1 fisurado 1 historicismos 3 Minyana 1 Pisidios 3 Lenderink 1 iMPACT 1 Igors 7 Jednotka 1 Lenoncio 1 Lansac 25 Merelas 1 imperfectibilidade 4 Lavoir 1 Jaagup 1 pçodese 1 Nieuwerkerke 1 Luperosaurus 2 Oberholzheim 1 Kommuner 1 Kallikrates 47 Oberto 1 Nayanjau 2 monoestático 1 Odenke 4 Phillis 11 FVA 2 Milangaz 1 inflúeo 2 heterotrópico 1 gozarda 4 Léopard 1 intrestinais 1 Olrat 1 intruducida 18 gritando 2 iMovie 1 Leonites 2 Peregrini 3 indignou 1 gonodios 1 liblik 1 Koutalas 1 parlant 6 Jaimito 1 licentiam 1 Okura 1 Kamperland 4 Guinart 3 lexislouse 1 miad 1 Pecadeiro 1 Mushom 1 Fanhões 4 óllanse 1 noreuropeos 1 participares 169 ordenamento 1 Gishubi 4 ome 10 Piranesi 34 iaka 1 livens 5 molluscorum 1 MIVD 2 Leptobramidae 1 Kouen 1 Lampobatus 1 Jamastrán 1 ITCam 2 Pelión 1 lauchones 1 frati 1 forcexo 4 Foschi 8 Maroon 1 mesaxes 1 ortimixa 1 imperalistas 1 Fasulo 74 Pizjuán 1 Implante 158 murais 30 Penibética 3 Insonid 2 formeros 36 outorgaban 1 lilaino 1 Incario 1 n??t 89 Mater 3 Palmgren 1 Garbutt 10 Minamiuonuma 1 Giannettino 1 Feio 1 Lehrjahre 1 Grasp 6 Occhi 4 neogoticismo 11 opinar 53 férrico 1 nitrados 1 lixado 1 Itapapa 3 Osset 4 Morabito 1 Krebszellen 2 Mitosoma 1 Hülle 1 Micrópolix 1 GlcNAcilación 4 OUTPUT 2 meditativas 1 Francaises 14 implantaron 2 Fengliang 1 Mourani 34 inval 3 Haebaru 1 mecánicocuántico 1 inspeción 1 iuå 2 Fugouse 3 olsun 1 Loduca 1 Paldiski 1 Neoegipcio 2 Maiorica 1 Mivtsa 1 Hankatxuak 4 Murraya 1 Fidlibum 23 Lives 1 Olmedillas 2 Hysni 5 ge 1 Fomitiporia 8 Fresadora 1 multicaules 6 Gossas 1 Pietós 1 galiciaenfotos 8 fareiro 1 Golfinho 1 FENEIS 1 JORGENS 1 keârddam 1 Nocturnidad 545 fixera 1 olecules 1 Goldstar 1 picándolle 1 pilatensis 3 Pinone 1 Peritel 1 Irrfahrt 1 Korapiloa 4 Penetrancia 1 Pénitents 76 Partes 2 Osteoclastos 1 Heckenhauer 3 fiedleri 1 Frizee 3 fight 1 passeggiata 1 kraujas 17 impropiamente 1 Horca 3 Lamagrande 1 obedeciches 6 imbuídos 1 norteportugués 1 Nassnaoo 1 nausée 14 Krefeld 1 Pelipper 3 Larco 4 Imperatoribus 4 Lembrado 1 hasskarliana 1 Lökbatan 147 invade 12 granulomatose 1 Hydrolea 2 L?t 1 Kondensmilch 22 Gilera 1221 Federal 1 lactucfolia 1 Palada 5 fórase 1 Iaakov 1 minikoensis 1 Lehmanns 1 Oberwesel 1 Hixinia 6 Haddington 4 intercepte 1 monosialos 21 fín 1 Geztien 10 Nahyan 30 hidrografía 1 packardii 1 laurícomos 10 Ferreres 1 Glyndyfrdwy 2 Laerru 1 Leenaun 2 infoshops 1 liguaxe 5 Lass 2 Galco 1 Harthausen 1 hidroxietano 1 Molinier 2 Pabellon 1 Nationalität 3 Lycosidae 1 Mesembria 21 Nórdica 1 Goddelau 3 nasabi 3 Lambicus 1 pintaran 1 FCBarcelona 31 Ithaca 1 galvanómetros 1 Kartzela 58 FUTURO 1 krankheit 1 Molvaer 18 Mística 2 Melanotropina 8 paparazzi 1 gardadores 6 Mundus 1 Manshuram 1 Ondiz 72 mergullador 1 inel 41 obtiñan 1 Hattari 86 Melville 1 Petiz 2 Pits 3 Iceni 2 Froxende 44 pez 1 Parachiton 1 nunaha 1 Isneauville 3 Gontro 2 MCMXXI 2 laisses 3 Haaest 2 Papaveráceas 1 Hawkesiophyton 1 pizma 1 huacho 2 Monoftalmos 1 Pherkad 2 Irisberto 1 gombae 1 fyddžyn 1 illable 4 ilustraciones 1 Notztri 2 Nancagua 13 Nuclearia 3 Isard 1 Madnhaya 13 Landers 16 Ginebra 2 Lobería 1 Hidrolase 2 Pastoris 1 GAIT 1 Jagdgesellschaft 7 hinos 198 Lars 2 mioinositol 3 Kariba 1 nigrolabris 9 Parva 10 incluíuno 4 Naturwissenschaften 5 perlado 52 hermano 1 modérese 1 FOREX 1 Ghaibara 2 Koryo 1 gallicum 1902 fixeron 2 Messimy 1 Machteld 1 Llendecastiello 6 pagarán 1 Kondura 30 perderá 1 Martindegui 2 Mocurunga 3 Meramec 2 Freidl 2 frozenset 3 Herreys 1 maldicindo 1 Palomos 6 Fuhlrott 1 monotón 1 necher 3 Moivus 1 Karamoko 1 hautuvar 1 Fatón 5 Neille 1 pileta 1 mélodie 1 petrográficas 2 lisca 1 narzo 3 Khal 4 pementas 1 Hatmax 2 Namoráronse 2 Gallinara 1303 Park 12 Médard 1 lelek 1 pederseni 3 LDF 1 Frérot 1 Krysaor 1 Oraefajokull 33 labradores 4 pátria 1 Maurili 2 Maleantes 1 Ksudach 356 pertencían 12 Kekkonen 1 Frumosu 1 pannosus 1 Guinduláin 1 Iunio 2 Naabeehó 157 leiras 1 orthos 1 Menabuoi 6 feroesas 1 Märzrevolution 1 GALDVRIAVNIN 1 histodiferenciación 1 Kankava 4 O? 1 Garaizabal 1 Goitse 1 Mocoa 5 Koblet 1 gachamiga 2 Gérgal 2 haplontes 2 irreflexivo 117 McGraw 1 Kärla 2 Hipótoe 1 Fliegerhorst 1 intermuda 31 Nabokov 1 glee 1 Ogori 1 pechándoos 6 Perdrix 1 Jangam 99 minoritario 1 Marber 1 galageo 1 Kanario 39 maza 5 Nüremberg 1 IRQs 67 Huracán 1 †Menoceras 5 Pessegueiro 2 noen 2 Pigüy 2 NI? 6 oligopolio 37 locales 19 Infinito 1 Hanancha 1 Macchio 35 Krzysztof 1 Opression 2 ficcionalizada 1 pachyceras 7 Fontefria 1 igrexas— 1 irremediábeis 4 francisco 1 Matjuschkin 5 Melli 1 metodológicos 12 Nito 1 gallivensis 2 Planeado 8 humanísticos 884 placa 71 mergulladores 1 lepdópterios 21 Gola 72 legados 67 Hardaway 5 Lulua 1 orgranización 1 metampsicose 1 foggara 1 montem 1 Mendés 2 ichu 1 Geçmi 1 Jéthou 12 Himachal 1 Hatieganu 36 pedíronlle 12 maquetación 4 Mataiapo 1 IRANIANO 1 nutrirá 1 Grammatologie 3 habrían 1 Golemac 5 Fergó 2 lignosulfonatos 1 manfifestaba 1 krusensterni 1 JGA 1 Meendiño 4 frítese 6 LaCoruna 1 Goikoelexalde 1 panteonparis 2 pasámolo 1 myelitis 6 Peutinger 1 Llouiou 1 Gatdam 1 patrucios 1 lobzat 2 LaserDisc 2 gañándolles 3 Naude 1 Himalaio 1 impedíuselles 1 Maik 1 Jehove 1 Petrushky 1 Oackie 110 glicoproteína 1 gametófitas 1 Ivatuba 1 Mikurallima 3 Infortunes 1 fotovisual 1 habana 24 Landrove 1 Hormogoneae 9 filho 1 Habladas 1 Mappae 1 Minissei 1 Kanegasaqui 1 Müjdem 1 Maitasun 2 Marinhais 13 mukhannathun 1 Francíada 1 FEECE 16 Minguillón 4 Fluidos 1 MareaCombarro 8 Majulah 5 Islandsmot 1 padar 1 Mouchiño 6 musculocutáneo 3 Motivación 2 perissodon 2 filosofici 1 Manousos 3 Liarte 2 Fifa 3 neuroprotectoras 20 lipoxixenase 1 labelos 1 Fénius 3 GHS 3 Muntxaraz 1 insolado 1 ÖBB 1 muria 1 Multivitaminas 1 Gradi 1 Kissmark 54 falo 1 pàiste 19 monocatenarias 1 Madhî 1 Kastielmosovce 2 Handzuš 2 legiones 1 Margaritaville 1 ktg 16 Megalópole 3 Govert 1 Jumpstyle 2 Kurya 1 irrebatible 3 Ocultar 2 ichthydion 97 Kuala 5 Guthlac 1 Natujenge 2 Mahbes 6 medimos 2 Jesen 1 PELLE 1 limpexa 1 Lineu 1 Gravitino 2 Hryhorii 1 —filla 7 faltará 1 Monger 6 Herreña 2 leucotos 1 perfidos 1 Glipizida 1 Paximadia 3 inmunoblot 3 Greenslade 32 palatais 1 Gradicek 1 Gorskaya 1 Paragonimus 7 Oeuvres 3 Mohsen 2 pedáneas 3 Mandic 1 honrat 1 Ouchakovskoïe 3 Marlais 1 fislosófica 4 Foscarini 1 Galanga 17 galgo 1 pastram 1 innomeables 140 Fire 1 Hozyo 1 ?yu 1 hipsofilo 1 patäridzick 2 ovirraptóridos 1 Llebre 1 kwawu 1 Híacint 17 galeguismos 9 Nettuno 1 Nunggubuju 1 Piperáceas 13 fulica 4 Magacine 1 Nuora 1 instantanea 1 llevaba 2 Kanturk 2 masterizar 1 Fuendetodino 1 Palantucio 1 Joshodaben 34 Mudouse 2 Katwijk 1 Oseinket 22 Movement 15 paperback 1 Lingons 14 nih 1 Niederranna 1 multidisciplinaridade 3 habitalo 2 hebdo 1 Fardo 1 Mitteldeutschand 7 Goldene 34 MAD 1 Friábel 1 KUT 1 Imarquello 18 hematopoético 3 Montáñez 1 Lectoras 1 OEIS 1 Flairboote 6 Langeveld 2 Meillonnas 1 Filmography 2 Gaminella 2 Mooncraft 1 Gbamélédougo 1 Microflex 1 Križ 2 Hootkins 1 HOVERGEN 2 Madjer 5 Petada 2 megacidades 22 hominis 1 Honeydew 1 hippoglosos 1 Intrácrina 78 Hokuriku 7 Hadria 11 Pictoris 8 Inês 3 inglaterra 1 Huvas 1 lontar 9 Nisi 938 ósos 8 Illapel 4 Habitatge 1 permitírame 1 penicíleos 1 Palmarosa 249 fisión 18 inaccesíbel 1 incendialos 2 naïves 77 Order 4 HerreraAntequera 7 ocasionaba 2 Moignans 1 Gašper 1 innervalo 1 Hammawi 1 pisaduras 2 Nagayo 1 noOS 1 Lownds 4 foguetería 1 maquillan 1 moprimeiro 7 heterodúplex 17 musteriense 2 Fonche 4 Olasagasti 4 Keiun 2 Hª 1 JOM 2 lendemain 1 Itallia 1 Lakdawalla 3 perdimos 7 Phet 1 ombotróficas 5 Hostias 1 glicosoaminoglicanos 4 lagartija 2 Neobabilónico 35 Filiberto 11 muixeranga 4 musikalischen 1 ?Ong 1 Laurentien 2 MHPG 1 mándolles 3 Pebbles 1 Juntacadáveres 1 nóctulos 2 Minger 1 Hispanicus 1 Fraizzoli 2 Mortella 1 Maxfield 12 gills 1 Lorentzen 4 Lochium 1 Mohamede 2 Injoux 1 Furtivo 1 Hamstead 5 interrumpiu 2 Khwarizmí 28 molestar 1 Geierforschung 1 musicalizador 1 Inmobiliarios 3 Kiabi 1 Paones 36 Normativa 12 Pentreath 2 Galpharm 2 latóns 69 Feb 3 lagrangiana 3 Gamling 2 Peramelidae 82 pilotou 3 paludosa 6 Longmans 6 hereje 1 Foner 2 hippeis 2 Gyozo 1 filoxenía 9 Lützow 1 Pansing 4 leuchten 1 Inatsuki 1 Ke 8 interruptus 292 picos 1 Kakiri 6 otomangueana 1 Hardeen 1648 fundou 3 gaélicofalante 7 ICR 1 mantidos gravitacionalmente 1 Neréus 29 Jovi 3 perigros 1 Namaram 1 Kasak 2 Kennet 24 Federació 10 gametofito 1 Métabief 1 Pirminius 3 Pade 8 fontiña 1 FLOROS 36 PB 8 Lunas 99 parénteses 1 linfoquinas 1 farinxealización 1 Gretchaninov 1 palisadas 74 Furelos 11 ignoraron 11 hurley 1 Lumini?a 1 Koukeldach 1 KVM 2 Galaecia 1 Nunamineral 1 fitzsimons 86 Fowler 43 Óutara 11 Hausa 1 pinzós 1 Ödeshög 2 Lotononis 16 invalidez 1 Marchea 3 Khe 1 Paturro 1 Graecinus 1 PKAc 2 Jamshed 1 piñor 2 He 31 habitable 9 mande 1 lagrangiano 3 Folenche 1 Kariakoo 184 Ibérico 1 Gunthamud 1 oxidorreducións 1 inspeccionaren 5 Monstruo 1 lurpios 5 Malformacións 25 Francolí 2 HobbyPress 2 Onceta 356 Oslo 7 gustativa 1 Frankenmuth 3 Lathan 4 Moel 1 Googlebots 2 parliamo 15 gamallos 3 limusín 3 padieira 1 Mirrcandani 2 Pitra 4 inusitadamente 1 Gymnelopsis 2 Kakhidze 1 Molomix 1 Moyola 2 Nouy 4 falsificou 1 Kerian 1 Microsílice 1 Halicoridae 1 Likwal 1 Mongolochelyidae 1 niamat 1 kantianismo 7 Noni 6 PKB 3 justiça 1 GlamourGirlsoftheSilverScreen 2 niveau 4 nemanoptera 1 Kramfors 1 KABF 1 indetermijnados 1 Grabian 2 peonía 1 ohashi 19 habitáculo 3 Giraldez 7 Gianmaria 1 iltun 1 Palleske 1 Grundbegriffe 2 Pirambu 1 noxentas 1 Olorón 1 Paragocevia 2 Ibaeta 68 Nadie 11 filum 17 Paleta 7 Nikopol 8 LIG 1 Platera 3 glioblastomas 4 Haloplanus 3 Hijaz 2 parcialidades 2 Noncommutative 37 ornamento 1 Pardo… 6 mormones 2 Morbio 1 Kalymnou 1 infrestruturas 1 Mollenauer 2 Paseata 6 ficcion 1 mendricantes 2 Pesadoira 2 Glub 5 Nutación 1 Harazha 8 Filométor 187 perigosas 14 Hibiscus 1 Megaloglossus 1 Köthener 2 neurovascular 3 natürliche 83 Foundation 2 Leery 15 Linguistics 1 minicircuito 1 oweniana 2 matromonio 1 Guymer 304 gloria 1 Mihaliç 1 hunkpapa 1 kárabos 2 janiczakii 2 osse 2 Lekeitioak 1 florataxon 1 Jézébel 1 menesis 1 Irazábal 1 Hoëné 6 pásaos 2 Fortaleceu 1 foraneas 5 Mancisidor 1 Mezada 1 Manifiestos 17 glenoide 3 galletiñas 3 koad 1 Maurea 9 Grinch 2 intraarticulares 2 nhee 1 Pentanemus 1 Homalocarpus 1 Linera 1 Octomitus 1 fractalizada 1 gemeente 6 Libreria 2 incautaban 1 Folklórico 1 inverti 2 Garred 1 Glyptostrobus 3 Lúgano 1 Lisopina 3 maudiae 1 Omelyanchuk 5 lisado 1 Frumu?ani 1 Melese 1 indeseables 2 pirrónicos 1 paleoclimatólogo 1 Güiania 1 Macken 2 Fredenandus 1 inframundus 2 Metals 2 marazulla 1 fermentara 1 Haisyn 1 nightingale 1 obríago 10599 logo 1 Lobuche 20 Fuck 1 Nicoloro 1 Guapay 1 operons 3 Mamm 1 FSK 1 Ingerana 1 Ornitomimo 2 inxerilos 1 hipotésus 1 Outorgados 1 oggetto 2 frcuentemente 1 kirdi 1 nishnaabemwin 1 mitrom 1 Federatie 1 Moravica 11 hotentote 1 ofendo 8 Parisot 10 h 1 mensor 2 Havisham 3 oxidasas 1 moíches 2 loerzingii 1 Horribilis 2 GLENDINNING 3 Fero 1 ouxeto 8 norcoreana 6 Ladero 1 ñu 29 filix 1 Monodelphini 175 migratorias 1 Hermán 1 Guzparras 2 órganes 2 Hversu 1 Muzab 10 Markt 5 Gualba 1 me suxerisen formas 1 FIFI 6 Geau 2 Islallana 4 Nishani 3 Kumenan 59 Greenberg 2 Pipín 2 Lejarza 1 Ganus 1 Newnes 246 liñaxes 1 graver 2 Orteguaza 4 Harnell 2 lynte 1 Forellen 1 Gbadjié 1 Medicinisch 59 ontoloxía 1 Gowri 1 Loretello 2 Neuruppin 4 Noctuidae 1 Pelesh 11 Minty 1 McFaul 1 heterogéneo 32 marcianos 1 kemaonensis 2 Methanoculleus 8 Monofisita 1 Oñatiko 1 formadoa 1 marma 1 interwikis 9 JAG 4 Lissarrague 7 Neuss 1 frundio 1 maracadas 16 Oren 2 Fantom 1 neoalbum 3 Langnau 4 LLA 13 Minorías 2 Olotí 1 HolyAngemon 1 neotéricos 2 Matachín 44 ok 15 Pierson 4 Gintaras 1 Godatas 1 mansions 2 pazzo 1 lobelia 5 Nyctaginaceae 1 fusilarán 1 heterosexismo 2 Jagjaguwar 2 FUENTES 2 LUGAL 6 patido 24 ocultando 1 Neovius 1 LuxG 2 Materiali 2 Iemma 60 Guitián 1 Gratiolet 4 Nkhotakota 1 Memorábeis 1 Izéil 4 litófitas 1 mestoque 1 Patmeses 4 Minoica 7 HN 6 Petete 1 MoN 2 Jazine 6 Maloelap 1 Pastorano 1 lubelska 2 Pignon 1 Landáu 1 Oschtjepka 2 Ourensás 15 Metcalf 5 participação 4 Penitenciarias 1 Noworossijsk 1 Orguens 1 olfacteando 48 Mur 1 Lucainena 1 óhmicas 1 librándoa 3 Patzún 2 Naginatajutsu 3065 Irlanda 31 Lamigueiro 4 Kyogoku 1 ocupándoo 5 Gallard 4 Hyles 1 Lehrenstalten 77 Player 2 madurados 1 LPTN 4 Herría 2 ianthina 1 Mijael 1 melanostoma 1 Planenc 23 Hawkes 57 inter 1 garabateando 1 panizu 63 FP 28 Míster 1 glumos 2 magistri 1 paride 2 moaxaja 2 Meximieux 1 peteirazo 1 Gorbalán 1 hilaron 1 labs 1 pántanos 1 oestrumnides 1 philol 1 jara 1 Horatius 6 Manglano 1 jxponesa 1 Pithakpol 3 Fontfride 2 maclada 1 Hurich 1 Pihuychen 2 Harrijasoketa 6 Harling 1 Oncológicas 3 Henok 1 Fariñeira 1 Meatballs 1 Gigas 154 Pedrón 1 Nothosmyrnium 1 nerm? 8 Izko 6 Monteggia 1 Mafile 3 Gretton 1 OFN 1 Penone 1 Liachov 1 palmaformis 1 jaisten 3 Pflimlin 10 financian 1 Physiciauditus 5 nesto 1 Ondricek 144 mellorado 4 Philbin 193 Marítimo 1 ichnofósiles 1 mungetes 1 pinados 1 killerbitches 1 Norepinephrine 1 helenizados— 4 Fossar 2 Hanbun 1 orexinas 1 Osbcurecemento 1 MAEC 2 Gheraba 1 Masuto 1 lateritas 2 Piringalla 1 Gesichtserscheinungen 1 Grochot 2 nancyae 44 oblongo 2 inmunomodulatorios 1 Innombrable 1 Kilnarath 1 friedenreich 1 Markarián 2 Johannisnacht 2 frenolóxicos 4 Lillywhite 17 Joetsu 2 Gesalatz 1 Hattusil 42 limpos 11 Formio 3 gravouno 1 Mugairi 3 Feijoó 2 lipovanos 1 Luòtuo 15 Franken 4 Floricienta 3 Palach 149 laureado 2 FIDAC 308 Linares 1 Napule 1 Motosada 7 fototransdución 3 Leszczynska 1 gerendae 1 Firmiana 1 Häädemeeste 2 Foua 1 osobucco 1 Labroideos 1 Lawthorn 1 Piispanen 1 llargs 1 Pensaches 1 Kydonia 1 Genyonemus 1 karapinarensis 3 Lisca 3 monomolecular 24 incómoda 2 Mu?i 1 manobrado 2 NotreDameDeParis 1 modernizarase 10 Kreuziger 1 isomorfas 2 kov 1 GLORIA 53 lexicógrafo 1 Mychota 1 lagabœtis 1 Lezajsk 1 Mukura 1 Langsuyar 1 Fellaoucene 2 Kicki 2 Nadeije 1 Pergolini 6 Naidu 4 lenteur 1 partenariado 2 Methanomicrobia 1 Herdar 1 Mezohegyes 1 morfofuncional 3 Honekawa 1 Paleolog 1 negrexan 2 Murmúrios 37 Fixi 1 Lemosiano 1 Honeycrisp 3 Pery 1 Grecio 1 gondomar 3 Palmaj 1 Gerlsdorfer 1 Golfesco 1 Nisporeni 1 Jeanneau 7 Islero 2 métrique 1 Moze 4 Naubolos 1 Oysel 2 lactobacilo 1 femtosegundo 1 Marsell 27 Mankiewicz 5 Ichthyologie 1 Musichiere 1 Monthault 1 peonalizado 1 inmisciu 1 Gwerneigron 1 hakona?y 4 Karstens 2 Pétrusse 1 Gandomak 1 Mallabi 2 hidroximatairresinol 1 Modrany 1 Grudd 1 Legmoin 2 literaturización 1 matadragóns 3 funcionamente 2 Fredéric 1 Persicaria 1 HBDC 2 KHC 3 Ironsides 1 Pallens 1 Gawne 1 Paquerette 9 gales 3 iQ 31 Hound 71 Mikko 1 Lataha 4 Maquillaje 23 mátao 1 frnacesa 1 Monnty 3 Merlucciinae 1 Microvidas 1 intellectu 9 fenestra 1 Merkalova 2 Hartzenbusch 3 mystery 963 gris 14 güelfos 2 Nailers 1 mexete 1 lanzarlles 4 Laban 2 Luhhan 1 Hurdsfield 2 Glicofosfoesfingolípidos 3 gullo 5 Fleuve 2 incluénse 1 Flottans 1 Leptolinae 195 ocorrido 1 Nuytsiaceae 1 Patârlagele 1 leptofasciatus 1 Kudamon 10 Gumball 1 Hävla 2 glicólico 1 indices 1 holothurion 1 Kurotaqui 4 fatos 1 pararetrovirus 6 Fraikin 1 kao 1 Göpel 1 hoffmani 7 magnánimo 1 Josamicina 1 macaronesicum 2 Logounova 2 Mostacciano 1 neboentas 2 Guilloux 2 Greguerías 5 Miriocéfalo 3 IRREGULARTEMATEMPOS 2 mudoulle 1 insolite 1 phaloides 1 indetectados 1 manuelantoniano 2 penosos 771 Howard 3 infedeli 1 Houdancourt 4 ondes 1 Garrocha 1 Filharmoninen 30 numerarios 1 obtenir 1 Hofors 1 Nättilä 1 Nonoka 8 Pitton 5 Nerone 1 Lassefar 1 Mebaragesi 2 oooh 4 Jijón 1 Kblackbox 1 Justicias 1 Pinnic 52 Lava 11 kein 1 Graydon 2 moguchy 2 Iblidae 1 Féérie 4 Fratafernes 7 Pederson 15 pintaban 55 morrerá 2 Gouvães 3 obstruía 17 oxalato 1 Platycoryne 1 fawqa 1 Magaye 1 Medit 6 hiperamonemia 78 Granda 1 Kwoon 2 Harzreise 2 Fiable 1 Natasia 2 monacensis 1 Hypogaeic 1 guindalas 1 Košarkaško 1 hamsah 6 Oisin 2 Penís 1 parapetadas 3 Nudos 1 gloquidiada 1 Juni 1 iunost 1 Oterswil 1 pereionito 1 Foillan 1 Gigantactinidae 1 ordean 12 outorgase 1 niikawa 1 Pentapeltis 1 intervíu 2 Iguanidae 1 Kouaoua 2 habéndoo 4 Hierarchy 7 Hapalemur 1 ngäbe 1 Khorloogiin 1 MOVA 1 naparte 1 hatxe 1 Gwenhwyfach 1 Haretara 2 Pajou 2 Khmelnytskyi 1 Parkening 12 petroglifos 1 Gallanstown 1 Greffet 5 pedrazo 8 macroalgas 2 Pavías 1 fletcherianum 316 húngara 1 Homenaxeaba 1 Irreligious 20 Lindbergh 1 Gicquelais 1 FamoS 1 minories 5 Joshi 1 Mingyu 1 monthon 1 Microfonista 4 Haswell 15 mantedor 1 Martvili 1 Koppelaar 30 Marketing 1 Jenpuku 1 frondator 1 Onaiyekan 3 Fidem 1 MOPT 2 Gorzula 1 Gattis 1 Omnibacteria 1 Guignen 179 Permaneceu 1 Kolesnikov 5 Piolín 1 Geraint† 3 Nuvens 2 Oristà 14 Menderes 1 Iá 1 Hemisphace 2 mantelería 1 Lapeirousia 5 Keel 13 MOV 1 Nocoadala 35 Placebo 1 Nothosauroidea 4 pernigra 1 Kovalski 1 mazorgueiro 2 Magnaporthe 2 Kneževac 3 kempi 6 industrializar 1 Meijin 3 Nitrobacteraceae 5 Mapping 1 Munko 1 Lampes 1 increíblemente 2 Infero 1 Neuvic 1 mongeana 1 Nachtr 341 implicado 2 Niemelä 3 Manchones 2 Kammer 1 Gothie 6 Fauzy 3 outobro 1 Lupanina 1 Gorgollóns 2 Flacila 1 ICTU 1 Ferlazzo 510 metano 6 Kamenica 1 habital 1 perdoei 16 Pietsch 1 Fridrikh 2 pallaza 1 Nembargantes 4 Joi 4 libeliña 1 moravios 1 literalemnte 2 katemfe 1 loryphylla 1 Fedeli 1 Mcburger 1 gunth 7 Kokoda 1 Kaci 2 Odria 1 Frerea 13 Opcionalmente 1 pérdeo 1 orolei 1 Mésaventure 1 Gecamines 1 horro 1 Pervushin 1 Guardiano 1 Gajevskaja 2 Jayo 1 Luchas 9 pastorale 1 Harjutused 1 futbolist 2 instituíse 3 Gudusia 1 krstiteli 1 Kuchinski 8 Juncosa 3 piars 4 ikan 1 kaum 4 perpetuouse 3 millan 5 Liguori 2 informaran 2 orzada 2 Nártice 1 Hauron 28 Fundamentalmente 1 platinoides 14 lavandería 1 Fazakas 1 Kygogion 9 ferrocitocromo 1 Mamíferiformes 8 Lepiota 3 gamopétala 1 Hiders 1 Indestrutible 19 Grazie 10 Petroleum 11 Marusiña 1 mesotelial 2 Jacobe 1 Gegedeh 2 fromCharCode 1 Mwakikagile 4 Laborie 1 Menphis 1 festaas 1 hjelm 1 Kavárna 2 Hixia 1 meteren 4 penados 4 Frigga 4 invitara 1 Gweryn 3 Knotts 2 Goutou 1 Heliophila 15 Oob 6 Hugberto 18 militarista 1 isien 6 helios 13 inestimable 1 Lobin 4 pedirse 1 Lathouris 10 organótrofos 1 Montechiarugolo 3 manan 18 modulador 11 obliquidens 2 outres 1 interven 1 Maykulan 2 Legno 2 perdues 3 ouxa 1 innovacions 9 oidor 1 perfecciónase 1 persuadiese 1 Kitchin 1 Megamall 1 mesooceánicas 1 formariase 2 peneirada 68 ido 1 fondealas 1 Pierinae 2 Mazzoglio 1 Overpelt 6 novedad 1 Grammático 18 Fieis 1 notae 9 oj 1 ménager 3 Morassi 121 oliveiras 1 Nizhnyohirskii 1 -i 11 Odinismo 3 Feelin 1 lobaris 2 gambiano 5 llenarme 1 Frem 1 Groo 2 PIDEO 10 Montaño 1 pescantes 2 Nolina 2 Pavuvu 1 otimesB 1 neopagano 1 Flatrès 1 Pinguiñas 1 Marchori 1 Gondarán 1 otomyis 2 Hypsignathus 2 Kavaleryan 11 flutuante 1 loubada 1 Imaizuma 1 Gamas 2 Financiamiento 7 Generations 4 hazaña 1 lousinhar 1 naturalisées 27 Heimskringla 1 Lembrou 2 Movilnet 3 Fondamenti 1 penaización 10 Iwamizawa 1817 Lingua 1 Gourrier 16 lóng 46 fresa 1 guérandais 2 monoterapia 2 incapacitadas 1 MORALES 1 Ifaranga 1 groupes 1 Headings 3 Filosofar 1 Klementa 1 melns 2 Ivalo 4 hele 1 jinkim 1 Gwisec 2 Navaconcejo 1 hydrangea 10 migallas 1 Hibernius 2 Perdelo 1 lipófila 1 Katarqalai 5 Misidáceos 9 inventáronse 1 Gazzada 2 Maloti 3 lutreola 1 Festitalia 1 igua 110 Gobernatura 1 IMCCE 1 Lepidosauriformes 1 Ghuloum 5 pirariam 4 Kl 2 Mupag 1 molekulen 49 Mstislav 1 Obteranse 4 MgADP 14 Formacións 6 Maurel 2 oesta 1 interfrontais 1 Hwon 1 Pactouse 1 Gojoume 1 fassen 1 gritan 2 Karakum 1 onnika 1 inflexiona 1 Mahagnoa 1 neuron 1 Kurisarisu 1 Ninguno 7 Morade 6 freenode 14 Mauke 1 fidenigna 1 inforamción 2 Kenutu 1 Lezamiano 1 Mittelmächte 2 Pangboche 1 personalizou 3 Meinrad 12 Marantes 1 manidoowag 5 irrefutables 1 filhou 38 longueirón 1 ?akami 1 fundares 32 Ideoloxía 1 multiservizos 69 Interleucina 7 orquestrador 1 kesselringii 1 lometo 60 malformacións 1 Lakao 1 isomaltitol 35 OSCE 2 Forniellos 4 Faron 1 Gimundus 1 Gesicka 3 invernando 1 intercomunica 3 ferreirá 15 Lanzáronse 11 neurite 8 ofende 8 ormurí 1 Mohniit 1 gmacht 54 importada 1 Judziewicz 1 idiatigena 3 motivacionais 33 Krim 35 insularis 1 millotii 1 INCN 1 holoproteínas 3 Felpeyu 1 Lucciola 2 mándaos 1 gaudinista 2 Hainán 3 Piada 2 orograficamente 4 Percopsiformes 4 Lymon 1 Gouesnière 1 netmask 1 kulturne 11 Ordenada 1 Octomyxa 150 pasiva 1 gorrazos 1 níxerocongoleses 3 invertir 2 Intrusismo 1 Librada 3 Menlo 1 Ordzhonikidze 2 Krikor 8 margaritas 3 Metuchen 1 Mollis 1 Olsobip 40 plaça 5 Phichit 1 Lovetown 16 penique 7 Méric 3 migre 27 maoístas 2 lactinas 1 Kindu 9 Gramme 25 Ferreri 2 fenílico 10 Østfold 1 Mandanga 3 Jutai 3 Garnati 1 flabellifolia 1 mediterránicos 1 ouvisen 1 MANDOU 1 Neopositivistas 163 imaxinario 1 PARRILLA 1 Haavikko 5 Mouta 11 Hécate 1 Filignano 2 Gakeen 1 filoxeneticamemte 1 Nyangga 3 Karweta 3 Páxaro 21 hash 3 feio 6 Gniva 1 kosmosas 1 Goetzinger 2 Jacobstads 5 Kurr 3 Mangetsu 1 hleun 1 gaudryi 22 performances 1 Masotti 1 Noígíallach 44 Pichel 1 FIFOs 9 Filopátor 1 Melchionni 2 granzima 2 Girvan 1 mostrounos 1 kravata 1 Gavicagogeascoa 2 Jattab 2 frateli 1 llwyt 1 Fiddlesticks 1 kellun 1 —familia 1 Inagotable 3 Jujubinus 1 Homencuu 14 Ondina 1 megaleuce 1 Mililitro 7 MSZP 1 ko?ka?i 1 Nougier 2 Mauran 3 ?i? 2 orchatería 1 mørke 2 hidrólogos 1 Hok 27 Mantovani 27 infalibilidade 2 Goldston 1 Olofsdotter 1 palvaid 1 phlebopetala 22 fimbrias 2 inferna 1 Lucil 1 Hindustano 1 Kapišová 1 gláchon 3 Pagos 27 Himnos 1 lezna 5 Immortel 2 nomearían 8 Kudamatsu 1 Jovian 1 Passienus 1 Opmeer 7 feramente 1 hidroxibutanodioico 1 Lycanthrope 5 lements 1 Östers 1 gasthuis 6 PEC 3 holográfica 1 nmos 199 grunge 49 Metohija 1 improbum 45 mildio 1 iota 2 lfp 1 guácharo 3 Libor 1 PDGFB 1 Oberbauer 10 ipecacuanha 2 Palidez 2 Osnabruck 2 Keana 219 indie 1 pizmei 1 pexábaselle 3 miriápodo 13 McKee 1 jundalini 1 Nonas 1 Grocs 2 planctívoras 1 Masyoun 4 gatiños 1 Hnivan 1 Luffy 1 Pénitencier 1 Leokki 2 Nuapapu 1 Okobo 1 perqueiras 1 Garças 1 noticieirogalego 31 Lusíadas 1 Lallevir 1 muote 2 Narodno 1 merecelo 1 Oberschwaben 1 invulgarmente 1 Khalouia 2 Karbalá 1 Hockersmith 1 Mencionámolo 5 indecidible 3 Greed 6 partisáns 2 Jamukha 1 Gendringen 1 hævn 1 Millen 165 Krebs 1 perigoo 1 fuinneog 1 okkum 1 Kaleyn 1 Palgraver 1 Laokoön 1 furquito 1 Fontetes 3 Okiya 1 Haslinger 1 Jeruzale 1 Krieblowitz 1 Helps 4 Maupin 8 Gonzáles 1 Haematoxylon 1 nefoi 1 Pelexaron 2 mwami 20 macromolecular 2 Filenkova 1 Pinsapar 1 Miyazaki como 6 hexástilo 19 Jiu 3 Madamas 8 mois 1 hspAmerind 1 Frederikke 1 hipotensores 1 hallase 2 Kasuia 1 merliño 280 Kinki 1 Gaudenzi 3 incorporalos 1 innermongolicus 1 muóns 9 optimiza 2 Maddux 7 Meunier 7 noveliña 2 Jablonsky 3 ictiofauna 1 fotodixital 1 Iepe 2 Pântano 1 Padrell 2 Greybeard 1 Minnihlíð 1 Gabz 5 innominados 3 falseando 1 nigroestriatal 11 monterista 1 Fazlul 4 mediae 1 hako 1 Hegelianer 2 IBISAtv 16 piRNAs 1 indicándolles 1 Inbisa 115 nenez 1 Mu?ate?ti 2 Groenendijk 8 Jörð 1 oceéno 99 maritima 5 ovoidal 1 loxitudes 1 juren 2 Grammatidae 1 Institutiones— 2 inmotivado 1 Pierer 1 Lifeline 20 lanzara 27 Heinemann 1 iugoeslavos 1 Glisando 1 Migash 1 Lemesle 2 Mancio 2 Magri 550 Paraguai 1 kuwareru 1 Jadees 1027 guión 1 frazzled 1 isetiónico 1 oblancifolium 1 Faylen 7 Guen 4 Parasitismo 1 kleô 5 Fiduciaria 2 Paleoantropoloxía 1 Gatamaro 2 Fisgón 1 Ottopé 2 Ngami 1 Míllelo 3 Frencel 10 favo 108 introducíronse 1 Oransoda 33 miscelánea 1 nótalas 2 MacMaster 1 górod 2 nimium 1 Kjarri 245 Golpe 1 Izcaray 4 Miocardite 1 kimefasiriwa 13 innervado 2 Gabytos 2 Kutna 1 iktim 5 Gnagna 2 Iongh 1 innervados 2 Óese 3 italiae 2 Idir 2 Orleanskaja 1 Inkallaqta 1 Manala 1 Morghi 3 partiremos 1 Millera 1 Listel 52 Orfeón 4 Giacinti 2 Permette 12 Houaiss 1 futboleiros 1 gastromyzon 1 patirrojo 1 Kayagum 11 Mediterranean 1 GALICECAN 3 inchábel 3 loup 2 morriñas 1 Metamon 29 Keiji 1 fuligineosquarrosa 2 Galizí 3 Fébé 99 kcal 5 Haddada 7 juega 2 Gulbuddin 1 katzer 3 muridarum 1 Golubey 1 Gottby 1 inconcrecións 2 Hofvijver 2 pensadoras 1 Micropodabrus 2 megarhynchos 23 Fracaso 1 Masoe 21 obodritas 1 Nostoi 7 iri 2 Pantholopinae 1 Hylton 11 insertos 1 Luerssenia 13 Hauer 1 Haloperidol 1 julgavam 1 Hypsibarbus 3 peiteaban 1 nakanai 1 medindose 1 Libioi 1 Fusileiro 1 interrompelo 1 fenotipicos 1 Fustigada 1 Mourama 1 Kudr 2 interesterificación 4 morrerei 12 Ghabhála 1 iIbérica 1 inférense 1 Phasáiste 3 musicóloga 2 mediase 1 kisspeptina 1 Geissorhiza 581 foise 2 ñopo 1 Marable 1 Guilde 2 Monoblastozoos 5 normalizando 1 hormonales 5 Layamon 2 Mussy 153 Gaulle 1 Lutrogale 2 Kargamiš 2 fluoroscopía 1 Gnoll 3 Kurfürstendamm 28 Hoja 1 Iamitas 1 Llewiadur 1 Luggin 1 kotekas 1 Muneasto 6 Furcia 1 mosas 1 Myuzik 17 madurando 1 MYT 1 hiperión 1 Inicua 13 Koko 1 Minliar 1 Newalll 5 Giere 1 Hemithrinax 32 Jacarepaguá 1 nonpuntuou 1 merceniario 1 pentasódico 2 Fridge 8 mutans 4 Partimos 1 Hupišna 1 Karakallos 1 Gagak 1 Heinhold 2 homoios 1 Orakle 1 LivH 1 orquestraron 1 Gojjam 6 Matich 1 González coa 20 instalara 1 Mediática 1 Jiai 1 Gerjant 6 indisciplinados 50 peitos 4 orneo 1 panormitanum 2 Feedback 1 Kakatiya 3 Lirico 2 Lentegí 6 Otth 2 influénciaa 1 lascivos 1 Osmail 1 Nithart 1 Lanima 3 Pavesas 25 Osgiliath 1 Mörchingen 1 Luts 1 Heolstor 1 IpGra 1 Julianeta 1 Foressos 1 McIlvane 28 melloradas 1 finque 4 Niarchos 9 Loge 2 itt 5 labia 1 ortliebschen 1 MCl 2 Mattern 4 fisionómica 4 Furgler 1 Moudud 2 Nifiloli 1 Lexcen 1 Mukh 1 generaloberst 21 feedback 2 jugabilidad 5 Kanuri 1 Fronza 2 Fiscalia 1 Idiosincrasia 1 Mepolizumab 1 koroto 1 Melobose 1 Nikolist 6 Ottosson 1 Forholdet 4 Overmars 3 Ichthyologica 4 güiro 7 paracaidista 5 Huaral 2 Kanzo 1 Neobaclea 2 JH 1 Kusro 147 Íñigo 10 maleábel 1 mobilizarase 18 Marquet 1 jurel 5 Internationales 1 Namahounondougou 3 Kruszelnicki 1 Karczmiska 3 neuroléptico 2 isomerismo 5 Piñeiroá 1 plantexárase 1 jackstclair 1 lovaniensis 1 Meritano 1 Karakate 2 Méditations 2 frati 1 otzovista 1 Merdj 1 ortogneis 1 Mediterrànea 3 Ficaron 3 goddamn 1 Muanza 2 Pishaj 1 idéndito 11 fichase 1 lipopolisacarídica 6 Masopust 2 maseteros 1177 incluídos 2178 Fundación 1 orógenos 7 penada 12 Moskva 12 Oona 1 oropediorum 4 perentorio 1 GIESTAS 3 interferiron 23 Nerik 1 HMLa 1 Pemagatsel 1 Fotheringay 49 inhibina 8 Lemmy 1 Ónfalo 1 Molete 1 Ikirun 1 lepirudina 1 gamaherpesvirus 69 lepidópteros 1 gulonolactona 2 fracasasen 1 odiala 12 oliváceas 1 Lamarckiana 3 Gloeden 33 Mobutu 1 Kares 2 myortvogo 1 Onicha 1 nilagirica 1 Htapodia 3 MARS 20 Krasnov 3 hidroplano 1 Phrygian 1 Harsfelder 4 neokantiana 25 modista 14 miopatías 2 Nu?c 1 koitos 1 Oogata 1 Kosaka 1 Gravaris 2 municipai 1 ovilidad 3 Isleworth 1 nucleaban 2 phytina 7 hereditariamente 26 GBA 1 Moronera 1 Hornedo 1 Philosoplhical 1 manusear 1 fichasdeseguridad 6 Marigold 2 Palangre 10 Fos 4078 Fórmula 19 Hax 1 féminins 2 jogú 2 Granyena 1 Kentauros 1 Lehmacher 1 Ocejito 1 Ibiri 1 Ongina 8 indicará 2 Kokal 1 Kurzbiografien 1 Monodies 1 guðsríkis 1 Metidatión 1 Lenah 6 Hadasht 15 masterizado 2 Lagoecia 91 floema 37 piñeiral 1 Nigrae 1 mcu 3 palense 200 frontes 5 inscribíase 2 Louside 1 Muedra 1 Meekus 1 palaeohispanica 5 Gilardino 3 Pegado 1 Joneses 6 Gabinio 1 Papedes 1 Kokhanovich 1 jakha 1 melllitus 28 fundamentación 1 kolkhoznikov 1 orquestralo 6 Gouden 1 froiterías 11 Hulkenberg 1 Illacme 1 fuxitvo 2 Magnetophon 2 homodontes 4 pagoda 4 Furet 22 homeobox 3 Loyauté 1 Oxocinio 6 NWW 1 Marset 1 interceptasen 1 Kavo 1 kudya 2 gazte 3 joju 1 Itsudatte 1 moccu 5 Hydrogenobacter 2 longipedicellata 1 kickxiifolia 1 meretricio 30 musgos 1 Morinaga 2 Methol 3 filtrase 1 Jaunaren 2 ocapis 1 Máttarádját 1 Oxynooidea 1 permitíulles 1 minstro 1 gorecesen 4 Manizales 6 Kalachinsk 1 jurisdiçión 15 Maduro 1 kringles 1 Navalcaballo 5 fotosinteticamente 2 Iugoslavos— 1 nidzo 1 inégalités 1 Merulo 2 micronutriente 1 Pelegrínos 2 Pantacles 10 parasitar 1 plastids 1 Hecart 1 Mamin 1 Farishta 1 Martirósov 51 Gabilondo 1 nœuds 4 Peñascal 4 modúlase 1 Kkot 2 kreas 5 Forge 8 noitevella 1 grite 1 Niederle 4 Lesenho 320 orellas 7 Martas 29 Impacto 2 malevo 4 menten 7 Fiyi 1 lérono 3 germana 1 Koelbel 1 HGZ 5 Hajar 1 medioque 1 legahockey 1 microorgasnismos 3 Kenilworth 1 Léfini 1 Marak 1 —personaxe 1 Paraliodrosophila 1 MspA 1 Kibago 2 mungo 3 jarrai 4 microrrelatos 1 HPMCs 1 McCrimmen 1 Laccosperma 1 Giotto e 1 Fylingdale 1 petrifilia 4 gil 1 Grandate 13 idaltu 2 naucrates 1 lebbekoides 1 Minimalstat 1 naauwkeurige 1 Ilmenita 1 Novidosos 1 onomatopéicas 2 pelvianos 1 liparotas 1 Plasmodioides 1 Godere 10 piamáter 20 Petén 2 Manquehue 1 mielínico 1 francocanadianos 1 Lopadussa 57 Middle 5 MUÑOZ 5 frutificantes 184 impulsado 61 Figo 7 folle 6 Mesomycetozoa 1 Fret 1 Ourozinho 1 Piretro 1537 Mark 1 Networkmanager 1 Neuropsina 2 pédagogique 2 footballers 17 Medianeira 8 inxectable 6 Lurraldebus 1 indiicador 1 heteropoliméricas 1 Kowalevsky 1 Nitardo 3 Gesteira 2 obsedit 1 Petitone 1 izecksohni 12 Fong 2 furoato 1 Isognomonidae 1 Lotorp 1 Lócride 1 karambol 36 Pepo 1 Nisko 1 Parakuhlia 1 kmers 1 Heidelbergenses 1 gymnostemon 3 Personas 1 Keyshia 2 Peralte 1 Pannaipuram 1 Gnore 2 Locadia 2 NHC 1 Gospa 4 Malnutrición 3 monosulfuro 10 HIF 1 moitvo 1 periodistes 1 Pignot 1 Mjørkadalur 1 Meton 2 Monné 2 Groovey 1 Kammermaister 1 henriqueño 2 histriónico 1 Lekumok 2 Gairía 3 nempela 1 húngara Katalin 1 HaMalach 1 Kerkeling 2 inamovíbeis 1 Killoscully 7 Motobu 2 Ostentado 1 Iturria 1 persca 12 Josephus 3 Lascellas 20 Feet 66 Mart 1 nycticori 1 futuribles 1 laticlavia 2 Kitsune 2 Kauas 31 platihelmintos 1 huerfanita 1 Lócridos 1 LEGALITATE 1 Penayo 3 isquiáticas 1 hOisin 1 o laúde 1 fukagawa 12 KAT 16 Margarit 1 oculodentodixital 1 mergullandose 34 griseus 1 murtidanum 2 iodogawa 9 penitencial 1 MUVIM 652 lesión 3 Malak 3 inclinaron 4 Maternidad 42 Igreja 1 Paravas 1 ITAGRA 1 hermenéuticos 1 NOSTRORUM 28 hidrostática 1 Openmoko 1 i?s?b 1 Firaxis 23 Finca 1 Muggle 2 leváseo 1 guindamento 1 Keibetsu 1 internobiliaria 4 ondeaban 1 Murcio 1 Paredarermien 2 hanafita 6 MediaCorp 5 Pasatiempos 1 Nilgiritragus 2 ocorrerán 1 marianiña 2 Kpelle 7 Ganadería 1 khyer 1 Metsäpirtti 1 Indogermanica 2 Lotaringia 1 hapalina 1 Groman 1 Nagatsuka 1 hopeana 1 italoalxeriano 7 levantala 3 judía 2 Olíntica 2 Peillon 2 Glinn 1 Nigromancia 1 Gry 1 planifique 1 NetRunner 1 Meridj 1 Himmelskönig 1 Gyelsen 1 mirai 1 Ghair 4 Gasparee 6 patagonicus 31 imporse 3 misil 2 kolm 48 Liv 9 letristas 7 Plats 2 Hemorrhois 3 Llarch 1 mayottensis 1 HMD 20 fortaleceuse 25 Grossman 1 Gaznávidas 1 Hobbessii 1 PeterBurgo 35 glicano 24 mediastino 2 Narrado 3 Nyasa 1 Gyokutou 8 mires 1 Mhidi 1 grecoromanos 7 Morbid 1 Gondophar 1 Megalithsyndrom 1 Kaniaceae 44 Gladiator 101 paleta 1 fascisme 2 oppositiflorus 2 Glasersfeld 10 indígena 10 Fornjót 4 nidus 1 NewGrove 5 ortocromático 1 invírtense 1 indesxeable 2 JSA 3 Manelson 1 Ostracism 10 frouma 2 mirándolle 9 Faría 1 Peñacorada 1 Ingunta 1 FonoAstur 1 pictoresca 5 muiscas 1 inmunosensor 1 NovaMute 5 lethwei 1 fundamentaies 3 Kolettis 2 Khuwarizmi 2 Kutchma 1 mysticinus 1 pentecónteras 1 gca 3 Nörfi 1 Leirsund 2 Gapu 5 Melas 1 obrigarao 9 insignes 1 Hjelm 1 multiseries 1 Intrigues 1 luor 2 Ogose 1 Golduck 1 Parishan 1 Neuronismo 5 occulte 8 intradiexético 1 Kindertontenfuga 1 finalmenete 5 †Palaeorhincodon 2 lucius 1 Hilera 2 kántharos 2 houberades 2 Goetzeaceae 6 Maraver 47 GTS 1 gammágenos 9 Fiuza 3 kinshi 1 Frentania 1 Imposter 3 homeópata 3 Limosna 1 pídele 2 mutio 27 iconoclastas 1 Keïta? 2 fucked 6 Naj 1 glicofosfato 7 ocluída 1 Joone 1 Iagus 3 HashMap 1 Hébertot 1 Golyshev 32 Halterofilia 1 gustándolle 1 Jehuda 1 milliones 2 Frende 2 papyraceus 2 intéressants 30 incidir 44 neurólogo 1 Köllikerstraße 1 Gontant 2 jankowskii 31 Manio 1 Pejite 1 pikkujuttua 1 Hatepe 5 palatabilidade 1 Jatabi 1 hemotrópico 1 parágoas 1 GALE 1 Garik 2 Lengokoak 3 Houdin 3 Hershkovitz 11 Francini 106 fosfoglicerato 2 particulamente 1 Lucinasco 1 Konjac 10 monoamino 1 matizándola 7 hexaploides 1 OpenGEU 184 liberando 6 mecanocuántico 2 homotrimérica 1 histericamente 2 Maclas 1 Frapa 272 incorporou 4 Lyndsey 2 Michou 1 Gardella 5 Pisto 4 Gwallter 1 Plauer 8 peristoma 1 oleoanilidas 1 Numance 2 Glodeanu 18 humanización 2789 método 1 Kilwinning 1 Ibuse 1 Oswiecimowie 1 Kondrashoff 1 Innishannon 2 Novotný 1 peregrini 1 Grabato 5 Gaudens 1 Mazor 2 fingidas 4 Huallaga 1 Kofoed 2 Jamel 1 Halmoorea 1 olpé 6 Lodoicea 73 personal 1 Kripton 2 kinetochore 1 Lukuga 1 homenaxearán 1 merócrino 3 gabbiano 1 Fasol 1 Pettitt 50 Heights 1 neofuncionalización 2 perforaron 1 Helior 1 hanmoto 14 libélulas 1 L?N 1 Lillebonne 1 octilfenol 1 GERL 4 Lakela 11 manualidades 11 letreiros 1 Hoeckerschwan 1 Kukka 1 Örnskog 2 Muso 1 Horitzons 1 Idbihi 2 felepa 2 Paralipómena 1 Froitifica 15 Fisac 13 Markowitz 3 Irri 1 Pendargon 1 Fuselier 1 Foxtel 2 Grancima 2 glaziar 1 Peucelle 1 nummer 1 Pandyas 22 pertencería 6 Goxán 1 glykýs 1 inverterán 1 Nussa 5 Lewinston 1 paysanne 23 Leyenda 1 Guanggi 1 fusiláronos 4 pampullo 1 na National 1 hipoxea 1 Gustel 147 innumerables 1 Mostramos 1 filorepublicano 3 Jethou 85 Gomez 1 piracanto 1 gabeta 1 Pijarowski 1 naut 1 hvern 1 peridíneas 1 Liubech 4 Lircay 1 marchában 9 orianka 2 incautou 1 Pasunrah 32 Nicolaus 1 ño 3 menän 10 Montesclaros 3 Ferral 1 Gallerie 1 OOP 1 frison 3 Markl 4 halóxenas 1 NEBULA 1 oíuselle 1 Moschato 1 Ovipares 1 ILona 1 Gwari 4 Kurikan 1 nocardias 1 furlaz 130 integrinas 11 katana 1 interveniuse 303 fertilidade 1 Oubou 3 Fotheringhay 1 moitho 5 Papanikolaou 1 másde 6 Gobernantes 1 Iora 46 fermosura 89 PE 1 Henriquetta 3 Fascisme 6 Lilja 1 organisos 2 Incitado 1 loalo 3 Kazamaura 5 muralistas 3 Lardosa 1 natussë 1 kipriakí 2 francéses 1 indistinguendum 1 Paekinga 1 Oceanologica 3 Katashina 24 Mull 1 ICODA 1 h?lios 1 Halobacteriacaeae 1 Kororaa 1 gardée 6 Gastornis 1 ORPA 3 hiposecreción 1 manipularlles 1 Kortezubitarra 43 morna 1 ochabada 1 intuíndoo 2 MARIE 1 Holzuz 4 Gwaneumsa 1 Microscopic 1 masoterapia 9 modulando 3 fanada 2 lesionara 1 imidazoquinolina 1 Laevidentaliidae 1 mosteirios 1 persiguieron 1 Maguleiro 2 Insensibilidade 1 Paratodos 1 Kapolka 4 Mazarocas 1 Ghioqui 1 Kangeroo 1 percorrerase 1 Obraztsova 1 Helkavirsiä 4 Khatami 2 pando 1 Heptaptera 2 Malanchuk 1 fumaredas 2 Infiernillo 1 Nimier 1 Michalewicz 1 Ordinazions 1 Fructopyranose 1 Ghanamaqui 1 Freyung 2 Kynthios 1 Jeheber 3 moteado 1 Perrinche 1 Malcán 1 Hortiago 1 impidio 1 Lódares 2 piassaba 1 oxixenará 48 libanés 1 Keruh 3 Loporzano 3 Panjdeh 12 íberos 2 ghettos 1 kumaras 29 full 1 Fruchtmann 33 geográfico 3 Paycock 2 Mollafariña 1 Grietas 4 LSP 1 ngleanntaibh 4 Nemertinos 12 notan 2 Furin 4 moche 1 Friston 1 Haemosporidia 2 Pándaro 2 férricas 495 mariñeiros 2 obovatus 7 fotomontaxes 1 Indesexable 1 micronacionalistas 1 meendu 3 flebotomía 1 Nangahar 3 Katsuya 1 hpSC 10 Orodes 176 Japan 1 irritaría 1 hemólico 1 Muiron 11 infectarse 1 Navagero 2 Favorinus 3 Percebelleira 2 Kharlan 1 lactescens 2 horikoshii 3 Iizuna 1 Flavimonas 1 Macarcarmay 1 Freiras 1 lukJPG 3 Gladiador 70 Hotspur 2 lacecap 1 Iturrigaray 2 inclinacion 3 linalol 1 Neutel 2 figliuola 1 Impopular 1 Histo 1 Marakwet 1 pataguillón 3 funga 2 Lantánidos 1 personificaríanse 2 gorxeo 3 Faurei 29 frecuentan 1 Lalaki 2 idiosincráticos 2 Frederigo 1 Obedeced 19 Mandrás 12 Ngaliema 2 Geofrin 2 Pinki 1 Flesicher 1 Påfågeln 3 galorromano 1 livs 3 oaxaqueña 1 NorA 1 Fontevedra 1 hatei 4 íním 1 MPUI 1 northumbria 1 Mariñanes 1 imnumerables 7 Mignogna 9 mulá 3 Leondegrance 1 kunstwerk 6 Gaster 2 Izvorul 2 Filoxera 1 Generalard 1 OOCOBOL 4 obran 1 obrazu 1 interiorizados 1 Italocelta 1 okinawa 17 Macaco 7 Lignito 1 Patimpus 1 Mqabba 1 hemerografía 1 Marcación 2 Funck 1 Francéas 1 Loricato 1 Outlets 1 Lacedemónios 1 Marenka 1 foceas 597 incorporación 45 Ground 1 Liebowitz 34 Peñíscola 1 Fukutaicho 31 miserias 1 Hottentotplein 3 Gabarrón 1 Narishkina 1 graeberiana 1 Miliukova 1 muktze 1 filariforme 17 Naismith 1 Peshet 1 Garciapelayo 2 monocular 1 informáraa 9 Odate 1 kraju 1 Naryschkine 1 Lysipomia 6 legno 1 Narucene 1 Hinayana 12 Garcías 2 Lutrinae 1 farro 1 Lamictal 19 Gorillaz 1 Givray 2 menosprezados 5 fructus 1 metainformación 1 Mirchuk 7 Habaneras 10 nens 6 Maxam 1 MacGowran 2 palmadamente 1 MaGuires 2 Peneta 1515 literaria 98 GPI 10 Ledyia 45 Matosinhos 1 Flagpole 20 Lámpada 2 nasconderti 2 historiográficamente 1 Glidecam 3 Feliciana 2 fuliada 1 malvela 24 nueve 1 likiangensis 2 Húmedo 1 morbosamente 1 Mangalor 4 incunable 1 Mazanda 2 MyForm 1 Lavizan 3 fusteriana 1 GazettE 39 Mouzo 9 fuxíu 1 Mucílagos 1 grunda 639 pediu 10 modera 1 Gymnastiska 2 Feyjóo 7 ouvindo 4 JOHN 5 inhabitadas 1 Marktbreit 1 Ikedieze 11 Occitan 6 Kleinwagen 1 herbóvoras 1 fotocopiouno 5 mustela 2 Manage 1 Maireana 6 Palasí 1 inutilità 1 Meriland 2 Manneh 1 Frissell 18 Mediapro 1 pitcheri 178 Meyer 3 Masriera 1 Frecuentan 6 Norimaki 2 Kelliher 1 habenular 2 macrodipolo 1 Frévent 2 Gheyn 1 Migidae 32 Fingoi 1 osmotica 1 Gangulu 1280 Nome 2 Lycianthes 7 mecanocuánticos 1 Leveugh 2 Molné 3 Finish 2 minusculus 2 Genitrix 1 Pitzhanger 1 Lakatan 1 Liuvigoto 1 panganensis 13 gustoulle 1 Kubicki 1 gallando 6 leguarios 3 Jitka 2 ou 54 plasmar 7 marcia 6 memòria 42 Jofre 5 Legato 1 phyle 1 Pithana 8 NatB 1 Imentyu 19 Lockington 1 FBO 11 Péguy 2 Lamare 7 opiniones 18 luceiro 6 Oxeiae 1 Ilhad 6 Majadas 1 Fosfatáse 6 Pastrone 1 morem 2 Gurs 2 MacAran 1 Pácido 1 Kume 1 néganlle 4 idFicha 13 Historial 3 Owarai 1 Pendulous 1 Jepkorir 1 Mangroven 8 Penoucos 1 oitogonal 2 mintzoa 2 huauzontle 1 Guterriz 28 Lock 1 Múnón 1 iraultzailea 6 Motia 1 onverveerd 8 FTIs 2 gimble 10 Hisashi 1 Opuzen 1 paraformosus 9 Lycett 1 Microscopy 1 Kadressbook 2 Moluccas 3 malum 23 Latinoamericano 1 Jeceris 1 nirasam 6 iberas 1 Gavanovac 1 masificouse 2 Metoclopramida 1 Indagaciones 1 Micania 1 Mequitarista 4 Juigalpa 9 MacDiarmid 1 Meperidina 2 Onekotan 1 nuelleri 1 Ozun 1 PhN 1 Olors 1 oisivité 1 Gonzaluiz… 1 fotoactivas 1 musca 1 nosográficos 1 Khanda 3 Knop 1 opiorfina 1 Mumio 1 Outrageous 27 Gastone 1 modularidad 2 Hoftheater 1 Ledderhose 4 ovum 1 Lueam 5 nhm 1 MacMahom 1 Kovinic 1 Hekatonkheires 1 Gaoyáng 1 Magsarjav 14 Ogma 1 imbuían 2 Kiekhaefer 3 Kepleriano 1 HyperRESEARCH 1 gubb 3 Paporrubio 1 Oriocalotes 5 graneiros 1 macandrewi 1 nuz 3 Glades 1 Kirinyaga 3 pitar 1 Ferrutx 22 Forxán 1 mudárona 1 hidroxilaminas 5 Katherina 1 Hemiselmis 1 Minuscule 3 Pedraio 1 Moralejos 3 Guincho 1 Monolit 3 nabab 5 Pitingo 2 paxareiras 7 ?i 1 Modhia 1 kommentarii 1 petaloideas 1 Margarido 2 goi 6 Indogermanischen 3 Mokaba 2 olfación 11 Neopatria 1 filobizantina 3 Luxovios 4 luminosidades 72 lipase 1 Lycoseris 1 Gondola 17 Kamerlingh 1 Pèrsai 743 Fisterra 1 kharixitas 18 Omnia 92 Guardia 52 Kensington 1 gallerij 2 Kyrölä 1 Hilón 380 Lisa 5 Korczak 1 Pardesivil 1 miljón 3 Heidenwall 2 Governació 34 mochila 1 maadd 1 pites 79 modelado 1 fuionista 14 Laue 1 licopodio 5 manca 1 Knockanore 1 gañandos 1 nucleofosmina 2 penicillatus 1 Gründerzeit 1 Pellerin 1 Pariches 1 mentrastre 1 Forootan 2 Matorrais 1 Intalado 2 mullo 3 LaRocca 1 garotes 30 Oitavo 1 hv 1 Humoristicky 1 Nopcsa 1 Filannino 2 Piasa 1 Manshon 6 Nercón 1 pashto 1 Finerman 5 gestis 1 Mandáronos 11 Masip 2 oirá 144 Mantivo 19 nicolai 8 liquidada 1 Perdooulles 190 Moscow 238 Merlín 7 librecambismo 1 finaceira 1 Kreisläufe 34 Fillaboa 1 Jócar 2 isostática 1 frois 2 Heap 3 Jasna 24 Hoffmanns 1 lifting 2 Hemisotidae 5 Involucro 339 Logroño 1 Nanaloricida 10 fontinalis 9 Lambeau 1 papelero 1 Nygammal 1 Industriegebiet 1 Juyongguan 8 jimela 1 golpeu 1 Naceran 1 Philbrick 1 isopícnica 2 moverlas 1 Gymnopyrenium 1 Homola 2 Heterostraci 1 KCHTs 1 Morecambe 2 petaloide 1 Mercié realizou 4 partirdes 23 Plante 1 Ondulada 1 Fundamentado 9 Itoshima 2 Makki 1 lace 2 Pimpollar 3 Gier 6 metamerización 1 Hosszúpályi 1 mineráis 36 óvalo 9 mexicanum 2 Pancreatite 1 Landre 1 Jangamo 1 Krajenskie 1 Pillarno 18 Mostovoi 1 Gründ 12 lane 132 obrigacións 2 Philaret 1 Nerviano 1 Pirema 1 intraterrestres 1 Mamore 1 Laoigh 7 inequívocas 3 peristalse 1 perverta 1 PAKISTANIANO 3 Inoficial 1 Liederen 1 LONXES 1 Grottard 1 miáo 1 Gatarante 1 Marrucina 3 idina 1 geognósticos 802 nacionalismo 16 iaosi 12 Mast 3 Karabel 1 mladi 1 Moskitos 8 Pinker 1 gatuñantes 1 Kourtchaloïevski 16 hemoptise 1 mascrando 2 moncadistas 2 Iolair 1 FlpV 37 liquidar 1 invadíndose 19 finalizaba 3 Labourd 9 Giorni 1 Naturreligion 3 Josefin 1 Okimi 1 petitoria 6 Mattsson 2 Planerón 5 Nouel 4 Labat 4 Menciónanse 3 Oneroa 1 luteocarpa 1 Heterocapsa 2 Ferve 1 peregrinis 65 Guillermina 1 flammutoxín 1 Ivonka 3 Fugitivos 2 felpudo 1 herpetológicas 2 Gault 1 Hatsumi 1 Parhomenko 3 maleables 4 Inny 1 Gumira 1 Overhead 1 leguminum 28 ICE 17 Haloquadratum 4 plantae 436 Fernán 1 mierlo 1 LXIIIdetalles 2 Mardanis 7 Ferrarías 1 perigallo 2 Herceptin 1 Fetuatasi 5 Fasano 1 impoñerlla 1 Mabire 1 Moschitto 1 intercontinentales 3 Gilfaethwy 1 Koruga 2 insaculación 1 Livradois 1 pelásgicos 1 Multilayers 3 pixa 10 Ouzou 2 Jemma 1 nysos 9 Gallorum 6 Fusilamento 1 Mohoua 4 impórtase 12 Oxirrinco 32 Gavà 2 Nollag 1 Lahcene 2 Pakt 1 Guye 1 Lunari 3 pandereteira 1 Mondseer 1 Hiriensi 2 JTWC 1 Gihwa 3 Lasiurus 2 Gañán 72 orquestrais 20 Isadora 1 Iasgaich 4 Granth 6 Okapia 1 JME 5 find 1 Klausova 162 Minho 13 Mizu 10 iones 1 Paemani 1 Klaffi 1 fibrinopéptido 74 Olea 4 fechaduras 17 Goncharov 1 Italic 1 Madla 1 Finaste 3 Nólsoy 17 livián 5 fidelium 1 Hohauser 5 marroquinería 1 hsingshangensis 1 petriei 1 Kayove 2 palanquilla 1 perpeti 1 Inatento 1 Inactívase 1 localizarase 2 obsesos 2 Glasses 1 Iúrievich 1 fenogreco 1 Iternacional 1 npm 1 Formicofilia 1 Koto 1 intentaríase 2 Ingvald 33 ldots 5 Legume 2 Fondary 1 Kalantarian 2 magadhi 1 Nardiello 1 Hervedosas 14 lunfardo 5 Matsukawa 1 Konpyuta 2 Glutamic 1 Mativaja 1 Multimedijski 1 Huasos 4 Fundidora 3 Löfbergs 9 Muskiz 10 Gaëtan 11 LTV 4 manopiranosa 2 Joga 1 Northboro 1 MapleMusic 1 Llata 5 McClellan 109 mantivéronse 7 Mantes 1 Mesca 3 Ixodidae 1 linearizado 6 Maritxu 3 Morgant 2 peciolulados 2 Gigurros 1 Manganocolumbita 1 Izura 1 Metropasseigdegraciapassadis 6 limpou 3 Júnias 22 Legião 1 pelábanos 1 mesotermais 1 Lacilbula 17 Induce 1 habituara 1 lleguen 2 Kazel 1 halligen 1 Misungwi 1 Lissandria 2 Huentitán 2 FRw 1 isoelectrico 1 Khokeinyi 2 olmaz 1 Luksic 8 huilliche 1 incentivamos 1 Haurei 7 llelos 1 Guarachas 3 Kehat 50 mercantís 10 naranja 1 pippali 1763 partículas 1 MacAlistair 1 hitza 2 incluírono 1 Parted 6 Jomala 1 massilae 2 Integrase 6 Furmientu 34 Piñoi 1 merodear 11 inmanente 1 Fluoroapatito 1 Ozgur 1 Máisean 5 legaliza 6 nauruano 3 Monmany 1 Fürstliche 1 Germanair 1 Gyor 1 Fireside 110 morea 1 Maltraver 3 Maortúa 1 genero 5 planearan 21 gañarían 2 MacDermot 12 MacDonagh 1 Marmoiral 13 Pinar 1 Laëtitia 1 Gahano 45 Iugoslava 3 galeotes 1 Papírová 6 Patron 1 Güttstadt 11 multicolores 1 Mlava 1 omology 1 mosófilo 34 Louth 1 kandmas 44 Grassi 2 Hölgi 1 penedensis 11 Grijalva 23 Némese 2 notabel 2 kitaibeliana 1 IDRISI 13 Noske 1 mescalínica 1 Langila 2 Petrificación 1 Kibore 6 Iwerddon 5 Oedipe 1 PETTERSSON 1 Mial 1 Heilemann 1 Piedrabuenia 1 Itycirrhitus 15 Lewes 1 inflamatoría 1 Ianuaria 1 Perappu 39 obedecen 244 pensou 2 Kdiamond 40 Líncora 1 mexafontes 1 Galamus 1 Heinemannomyces 5 homógrafas 2 filmoteca 13 hexemónico 4 naiciña 6 Gaudencio 2 Lunner 1 Peramu 7 lavou 1 Piccilli 1 Peligot 1 Kaxiwara 4 lestes 1 pedregosidade 13 Inno 2 meita 1 NOBILÍSIMO 309 ovario 1 pastrana 1 Fungas 3 Guacamole 1 inmunolóxicoas 1 hulba 1 ofreceronse 1 Hannaway 1 Malargüe 3 Martirologio 1 partidoo 10 filologia 2 MISIA 1 Honaunau 17 Pánico 1 Hacikand 43 melanoma 1 monocigóticas 1 Hospedaría 6 pendulares 3 Kushi 1 getInstance 15 Obesidade 39 Never 1 Laxant 1 ordlista 1 Inorgánicos 1 Hyperoliinae 15 Limp 1 Piemineklis 3 Pareceume 1 peerde 2 Fatoto 140 Marianas 18 Pacioli 1 ibibo 1 mediteránea 1 ontem 3 internalizado 1 Manchioneel 1 Muría 15 Jepsen 375 Orange 2 Krushelnytska 1 Melouane 2 laricirresinol 12 ondulatorio 928 mariños 3 glucurónido 15 formúlase 1 Isizulu 1 Finasteride 1 Loegria 1 Mcgj 1 Gustafs 1 Guilavogui 126 Iliria 1 kainalossa 1 Idarubicin 1 Honeypies 1 Nottage 1 Juzo 1 historiaelectoral 1 Hiwassee 9 Hartmeyer 17 Gasparini 6 mulato 1 Kisselova 131 homeostase 1 gunner 3 oculo 1 Pirimidinilpirazol 2 Kady 1 malakos 3 Koshelev 34 Lealtad 3 Ibalzibar 5 Impanis 2 Náuticas 3 nororiente 2 Jäppinen 1 NAWIRA 1 oloa 2 Malvo 1 Gáñase 2 Heartless 10 peinture 337 galardón 1 Havsgamar 19 Mutter 3 improvisadamente 10 mónaþ 1 Naupa 1 lwl 1 NXY 3 Hypseocharitaceae 1 Metwally 1 neutralistas 1 Impressionen 1 Pedánios 51 orígenes 5 nya 1 necesitarian 2 jubilados 1 Frolicking 2 Mompox 139 Institute 3 Mesocolon 2 Patriarchatus 1 monitoreada 3 Panulirus 9 neodarwinismo 32 Malpighi 538 for 5 Norteamerica 1 Picobirnaviridae 3 Moytura 5 Oligótrofo 26 Milà 2 Faramans 1 Gavrontsi 2 Marutho 1 periodental 6 Pelikan 3 øy 12 Magro 1 Marittimo 6 Grada 1 Francatelli 1 Gamlin 5 Lesch 1 Lunxhëri 1 Hirnuva 19 Lust 1 nsis 6 Oru 1 Individualización 1 hexilfenois 1 papiyo 2 liberáronos 2 Funhouse 4 Lidiya 1 Mliecna 1 Pasteurization 1 nosEstados 1 Malgoire 1 Franzl 1 inferencial 1 Moxanda 1 longisetus 28 figurativa 2 FREE 17 Hin 2 ocurrencias 1 OAF 1 Herniaria 1 Ferramondo 1 hiperestésicas 2 fruición 1 migao 6 fullerenos 1 gifte 8 Ikiru 62 organizativa 1 fonoestética 1 Peress 1 Mañes 1 Metasequoias 551 Orlando 1862 mal 17 Guaraní 20 flagrante 1 Lucayas 1 Parkette 10 latido 7 identificara 2 Modulador 2 neogóticas 1 Iolani 28 Ledeb 3 obscuridade 87 Pinheiro 2 Mendt 1 Feérica 1 Oxydendrum 2 Kaiuea 1 Ossé 3 leukocyte 1 multilingua 18 francoprovenzal 1 Ibér 2 Piaffe 4 Leray 1 Nambudripad 1 Mazhai 1 Mekele 6 Larrey 1 Korbach 9 pireno 1 Nazimiye 1 Jovo 1 jhan 2 miticamente 1 Oranim 1 Kyläpöllönen 1 Junebug 2 Nectárico 3 Hemigalus 3 hipergólicos 32 Huron 1 Hollman 1 interpreto 7 ledicias 1 pachycereeae 7 maravilloso 1 Klimkovich 8 Kurumu 1 Percarbonato 1 Philinoglossa 1 Haploview 2 Fernwood 6 Kyankwanzi 87 fieitos 1 Malvineae 1 folo 1 kenose 2 naviculares 1 lochan 4 Martorelles 4 nanoestruturas 1 mariellu 9 Lagartija 6 orichalcea 3 Gobernorato 6 piscatorius 1 gortae 1 fermosuras 2 Fibroblasto 1 Ngatara 1 Forapaglie 2 Inmunosupresores 2 mufassir 12 Katholieke 49 Gulbenkian 1 Paragonista 1 furzen 9 Niuafo 1 Gornja 1 grandes creaciónes desta 39 OV 1 Paropus 4 FTTH 34 Nobreza 2 Kaun 12 namoramento 1 localitación 2 Isotalo 1 paristes 765 fuxir 74 Idioma 2 lathyris 1 indicatorio 3 Kristján 4 Imberga 1 pechito 19 Monoceros 1 Kilmanahan 1 Fatídicas 8 Hillgarth 2 Pensamos 33 nana 1 Papey 1 Mattessich 1 medline 1 Multiconstitucionalismo 1 mostachones 2 lecció 3 nii 1 Ligou 4 Lasi 1 foeniculum 1 káli 1 minéralogique 4 hotspot 1 Pennavern 1 Kveta 1 impermanente 1 Jácara 1 Iosano 2 Kiwanuka 1 pelágicas 3 outback 2 Pereledi 26 hemolinfa 84 Honoris 1 fuscipilum 2966 Mundo 1 Ngadjunmaya 1 Mashed 1 fornstora 3 Jorvik 4 Khuraix 5 Miracolo 2 opresivos 1 intend 2 Hemda 1 pedicuro 13 Kombu 2 Mazdak 1 Ghouzlane 1 Gyoza 14 fosfónico 1 Gairloch 3 octaviana 24 inutilmente 1 pesquisandose 16 Geller 70 Led 1 fedella 1 mandarineiros 6 Larcio 2 pitósporo 1 ljubve 1 pioriza 3 Menni 222 fermoso 1 fylkesmann 1 PeteruPaul 1 Ninov 1 gnomólogo 1 KNSB 1 Pilesar 1 necesitalo 1 parisiens 237 Glenn 1 hiperprolactinémicas 1 hiacintáceas 1 Mileanca 502 Muller 1 Planificou 1 Levivier 1 fieita 2 obstruírse 37 Korda 1 Machline 29 habilmente 1 Mest 1 Lewthwaite 1 Lavassaare 1 Mazziari 1 Matangcong 331 Parroquia 8 Fantine 5 medila 1 Netolicky 2 Karacháevo 20475 Foi 1 Melidenses 5 Mulazzo 1 Hedrich 1 Pelicciaio 1 Novakovica 1 Øivind 3 Grileira 1 Filtra 1 laxs 1 Huebel 1 illará 51 Here 1 Nobelhallen 9 Penamoura 22 guarda 7 Ilmen 1 Haradzieja 1 Mathildi 27 Hoffm 1 Gestor 286 mencionados 1 Madadna 3 picho 16 Maruxiña 1 frækna 2 homoméricas 1 friche 1 Nebridi 40 incrementaron 3 humedece 24 Morgado 1 Instrumenta 1 microcina 2 metrobús 3 líquenes 13 Pharus 1 Neurocranio 3 moveren 1 Persoeiro 1 Genitalien 19 Fotógrafo 6 peritubulares 1 Hantilish 80 Juventudes 1 oncolítico 2 Martindegi 1 Manazir 4 Mañach 1 mataku 2 gc 1 Oikia 25 Melrose 2 inumerabeis 1 Foad 1 KRÓNA 1 Hinke 5 Foru 1 Nikofia 2 Mar 3 OpenId 1 Headlong 1 Lepou 1 galactosido 10 minaron 1 Leszi 15 od 1 Huperzina 3 Gureak 4 fritirse 2 murmurar 1 —guillotina— 1 jardinero 54 percebe 6 Huggy 1 glucocálix 2 MVLER 43 infiel 2 metilenotetrahidrofolato 1 instituíren 3 neapolitana 1 maioees 2 nimbostratus 14 Gypsy 8 Naturalist 24 Mosteirón 50 ghrelina 1 Guayaqui 1 Palosco 1 Myosha 274 pesos 1 Naafadii 1 Paiçandu 5 oromediterráneo 1 modificacion 1 Hüitnii 1 marcianda 3 ovular 2 Milicroca 5 pasamáns 3 fiamentos 1 Hartfordshire 1 MEJÍA 30 Isaiah 1 Inersimalersut 1 philosophematis 6 Megalítico 2 Leucadia 1 Jarrama 101 oxidado 19 Fòrum 6 Medido 30 Petán 1 Metamorfos 2 Megaterio 1 Kirenga 6 ingesta 1 Matthis 4 fontela 16 herbáceos 1 Masegosa 2 Pfatter 1 merciaiuolo 198 gozar 1 LocalVilaNovaDeCerveira 5 Liechtenauer 3 Penalti 1 Hjerting 1 Gotea 1 miltiorrhiza 3 Lemoa 5 Gossip 1 Feidotos 1 Paiwas 7 Giffard 2 interbandas 1 Formaçao 1 Irondale 12 Hikone 1544 Nacións 2 Fontevrault 1 Kiana 3 inchume 15 parvalbumina 1 Fevróniya 1 Novelo 1 nummulíticos 6 leitón 1 Fólkið 2 Montuno 5 Godfathers 1 Gilpérez 1 gummosa 24 Inframundo 58 Ficción 1 parafínico 2 manexadores 8 ocúltase 1 Mothron 1 Noroccitan 1 heterosilábicas 1 mitemas 1 HMM 1 Osoyoos 2 Komitake 13 Leucanthemum 1 Hämmerlein 1 mesmasnocións 12 Nasri 2 Hexemonía 10 Miko 1 macropapilla 2 Oxidan 5 Minores 2 Niou 4 limpalo 1 hainesii 2 Linfohistiocitose 2 flotaría 1 Mumintroll 5 pasajero 8 ghanesa 2 ICTVdb 1 Jesolano 87 oxidantes 1 irixoa 2 pegs 103 pausa 2 Natá 2 Permanyer 1 momes 1 Iagul 1 Greye 8 Kake 3 hasidismo 1 MAOC 8 Hakui 6 pavoroso 1 Ombila 1 Ingilberto 1 PCNT 2 Oostermeer 1 orixinalmente— 1 Kotwica 1 Percudani 2 farinheira 5 pertenecen 1 Pilgrimen 1 Hmiikaayagus 1 mariavalverde 1 Ooiodo 1 Kivikkaho 6 Frondes 1 Nolliri 1 particopou 6 Fosfoinosítidos 2 osu 1 Pestanexa 1 Glypheoidea 19 Manola 1 Koghb 4 megalómano 3 firmo 1 Penitenciado 4 OpenStreetMap 1 organizen 1 PINEDO 1 nevasport 3 Khamerernebty 1 OpenSkies 70 Katharine 3 Filistea 1 Naqshbandi 1 necktie 2 membranes 2 Jerakeen 1 Iacov 1 Mondosdoro 8 Loredo 1 máximoo 3 Piropo 1 hulu 1 Mraconia 40 Nazario 1 Hazmerreíres 7 nómada 1 ónico 1 macelo 1 Jiefàng 525 Ludwig 5 Kumrovec 1 Kimbel 3 Hulpe 8 ladanifer 24 Leven 1 palazos 1 Haverkamp 11 Maibara 1 Matranga 1 Korybut 5 maurus 1 guinistas 1 kiribatí 1 notópodos 87 múltiplo 9 gángsters 1 Kükremis 1 Heliobacter 8 Montelongo 1 Maceioense 1 Ichilo 24 homérico 16 Linder 3 Kansei 55 paisanos 1 Fiolhoso 1 Nineb 3 illla 2 Lycengraulis 1 parroqui 27 Hassel 14 Norueguesa 1 Mompió 11 folium 4 Parisien 1 Ningišzida 1 Oberpfälzer 1 hoh 1 lamentaban 1 fornte 2 hagar 1 Iritriya 1 Odovacar 7 petaloides 2 Malheureux 1 ooenomiko 1 Ostroveni 16 menceyes 3 Gregoras 71 Olaia 2 noméaos 1 gordoniana 1 meng 1 Jibankumar 18 Mossos 13 Lohner 1 Platycodon 1 Pastia 1 Kavyalankara 1 kurator 4 Orobanche 1 Pelejero 1 Morloni 3 Kwalhioqua 1 Olsker 1 o Calixtinus apenas 2 Glottalized 1 Noctis 32 micoloxía 3 ferromagnetos 2 Guardamino 33 filamentosos 1 Inayat 1 levaríaa 10 Monclús 1 hemostaxe 1 Litteraturpriser 1 Pezoas 1 Gaboardi 2 Ilet 43 Muammar 3 Mendham 1 hachidan 1 Lexarza 3 Instrumentista 1 JECFA 1 Kwakiutls 1 obligará 1 MADB 2 fliegt 6 Lourentín 1 incentivándoos 19 Franciscano 1 Kilpedder 2 Marlo 1 Lafoens 3 instara 2 Hariqah 3 Geometria 1 Fotsis 1 Murthy 1 Margoliash 1 IBSat 6 gnoseoloxía 22 Orixinouse 12 Lorin 50 Motown 1 Lénda 4 peridotitas 1 Najdi 1 Helène 1 Ludovik 163 hialurónico 1 Objects 2 Ilala 10 Furlong 1 monocinas 6 padecela 1 KDEPIM 2 Ippai 1 Kalinnikov 11 Kuts 20 movan 3 Montevello 2 Immulite 1 Phosphate 2 Mumm 1 Ingenhouse 2 Fårikål 2 incapacitantes 1 interuniversitario 1 pairaba 1 Ghafoor 1 Krindjabo 1 GRAFCET 1 nasasNaTerra 1 famosen 5 Ghedi 21 permanecerían 1 Operaron 1 Hanmer 2 gasotransmisores 31 Guilherme 4 memory 2 Muggleston 1 overclockear 1 Marktl 1 pacotilleros 1 lainformación 2 Nycteribiidae 28 lera 24 míudo 1 Interdenominacional 2 Gumpert 2 neoarameo 1 Papf 1 hanayanagi 1 hAnnracháin 2 Feengrotte 1 Holonyak 1 Lepidobalanus 1 Headgroups 3 Juffrouw 16 Myosotis 1 Grnet 1 Florestine 1 lough 1 perruques 1 kostar 1 giratorio 1 Kochino 11 Pasiflora 1 liscada 3 MPD 1 golaus 7 Petyr 2 panificables 2 Iconographicum 2 Marywildea 1 Gezin 6 ilírica 5 neurulación 14 hielo 2 Hedrosa 1 isoacteoside 2 Hexaploides 1 Perennis 1 Halorrodopsina 1 Hestories 2 Joculatores 1 Fontanarossa 1 léndreas 1 Gnauck 9 Gasterosteiformes 3 Indubidábel 1 GNUnet 9 Laudate 1 Pinis 1 Herpetol 7 omnisciencia 1 Hemophiliac 1 guirlandas 1 Fatrick 1 Philoponella 7 ILE 80 imitando 1 masnavis 1 ljuvt 2 oxoglutárico 2 Northwood 1 Fennesz 1 Petroleo 1 octoxenarios 202 fragmentación 3 hockeyligan 1 fumarasa 1 Hashkenaz 6 Guadalix 1 Mengxi 1 microconcertos 5 Mencio 2 Kaplinski 1 impartiren 1 Isbrücker 1 Lázarevich 2 parens 1 Mopsion 2 Meiroi 11 Iquitos 1 Hordago 1 inflinxido 1 Hainz 4 Laboratoire 1 Kogo 2 Juvaquatre 1 Microphyes 1 Orénoque 2 Phyllopteryx 2 placodontes 3 kniga 30 Philibert 1 hiperagresivo 5 Içá 1 Guiche 1 kveldi 1 glumae 53 jour 1 Galtonia 1 Metha 5 logoterapia 1 Perchicot 1 Paputxi 1 NewMusicBox 1 gorgosauro 9 ITC 1 grossipes 1 Filorromano 1 Geonauta 1 Kašták 1 luc 1 Guirior 2 Nybit 3 plaisirs 1 Mwawi 1 Figurska 3 Neisseriaceae 1 LIVELLI 6 Jardel 1 lintei 1 géométrique 1 Kleinasiens 9 KBO 1 mitchilli 1 nai? 3 Mezzoforte 3 lipofuscinose 1 Haberfeld 1 greydied 12 ISA 1 me?phaa 8 Huisman 1 Marcinkowski 50 inducindo 2 lacunata 1 kosai 73 palleiro 5 onore 9 Monbetsu 1 Necturus 1 organízaas 2 Maxsted 1 merogonial 1 Kiivska 4 Goldfrapp 1 Iduara 3 incitaban 3 Nébald 5 harem 5 Midsomer 9 Hipérbole 5 Logoteta 16 Milly 2 Jenke 1 GALINDO 1 Omemee 4 Geschwister 17 ODS 1 Leonia 1 Hamgyong 1 Labadito 1 localízaselles 5 ?ula 1 Jibakoiru 1 LPAS 3 Fürmann 2 finxido 46 mesénquima 13 gardarse 2 Lystra 1 giovine 1 Manedyer 12 Lengüelle 24 NZL 1 lagopodes 1 Halmar 25 hípica 10 Gomis 4 Gennevilliers 1 Gorillai 1 Lumis 2 geodésico 1 Mayombe 1 moqoit 1 Hallapa 2 Glauke 1 guiternes 14 paráfrase 1 Ortínez 1 HiHD 1 fixíu 1 Morotopithecus† 30 Manus 20 Kasos 5 intimidacións 5 Memorándum 1 Neaga 2 Kerelaw 12 Kitahiroshima 2 Mongini 22 implementou 25 Jabal 1 mites 2 Mâlain 3 isodicéntrico 2 interrución 1 nitrofenolato 1 Llanuza 2 Marvellous 5 Menchaca 16 IEP 3 Losten 55 Florianópolis 2 Oponente 4 Inishbofin 1 Nagold 3 Grunge 1 pdían 1 möngülüü 4 oficinais 4 mofándose 1 Litzi 42 mantíñase 1 Kout 1 Mites 3 mixotiazol 1 Kiremba 6 linnuse 1 Otumbo 1 lend 4 pertenzo 2 Halel 1 mesodolicomorfo 1 Keizersgracht 10 mesianismo 5 Macé 2 Gorgonites 16 helenista 2 Gorris 6 Pineta 1 Monaguillo 5 Folkeparti 1 naszego 2 Orbeni 1 Linnik 78 organizarse 1 Pelegero 2 nasty 20 gvSIG 1 IJzer 24 observábeis 1 ingresiano 2 helvede 26 Operativo 1 Kassianides 1 Langhelle 15 influenza 1 mediterrána 3 Kelbo 1 Istefanos 1 Lucice 1 intrerorbitario 1 Incredibel 2 Kinneas 1 paten 1 oncidios 138 labirinto 1 Millaro 1 Luzetro 2 mallan 1 Gobbels 1 Missery 2 Pastoureaud 7 Generaciones 5 Magide 2 Ouellet 2 medicationis 1 Justyn 33 marcharía 11 intransitivo 65 orfa 1 Homínina 5 Lepadidae 1 Lectoral 8 Irigaray 1 Litéraries 1 malares 18 nudistas 1 Hasandere 1 Mächler 1 nítricos 16 Integrada 1 LPCM 1 Guadenzio 1 Faurie 67 Mystery 1 pictorismo 3 magnificas 1 Kealty 1 Ihle 12 Loitando 26 parecese 1 Nimanoa 1 Minamitane 1 Murçia 6 Ostarrîchi 3 fraticida 1 Noumonvi 1 Ongaku 3 pertenue 1 maisculas 6 GHB 3 lastros 2 LaTorre 1 Nsegiyumya 1 Meridionals 1 Kuanapa 1 PENNAY 30 Mendieta 1 Lugros 72 líquidas 1 Humahuaca 1 Guillard 2 lüdinik 1 gorgueira 1 gulfnews 1 obuv 1 pegase 2 Goceva 638 Negra 5 Gadolin 1 Mosfell 1 Haranio 1 Pedido 277 fenotipo 1 ortoferrosilita 2 Moída 54 Parish 1 Infer 334 nelas 1 MPRs 1 Malani 1 Loutráki 1 Montenegroe 2 Gilt 1 Oqba 2 Makubetsu 2 Peltigera 2 Moglie 5 Pendulum 3 go 1 Lenón 1 globifera 1 monoétinocs 4 Frágil 1 metamérica 3 Nemacur 1 Nanebevzetí 2 Lobal 1 Jehu 1 microcervexeira 1 Hiaou 3 laxeado 1 Lakani 1 Neutralia 1 introducidón 1 Lamanère 1 Periclave 1 Nasjonale 3 Gurguenidzeo 1 Palmaiola 7 mW 2 Freijido 1 Gyorge 13 ón 1 Orpailleurs 1 Gazquez 1 leni 2 Hummock 1 manchester 10 Manteigas 18 Hesperia 4 perecera 14 Moschus 3 Kommisje 89 Gmelin 1 montiño 3 litterarum 13 Millais 1 kaiden 2 Janowiec 2 Kery 1 Paradoliopsis 130 hinduísmo 57 Ovos 1 Litri 2 marienplatz 1 Gorma 1 Glaucomys 3 Melantrich 3 Frydman 1 Golpeáronme 1 Lusones 1 Oservatorio 1 Pingvinhjelpen 217 Ninguén 2 Jofrén 53 íntegro 1 Hesperides 1 Faurecia 1 íslenskra 1 mespilia 1 neoxeografía 1 Moranovenc 10 Ostpolitik 90 Leben 1 peruca 1 perating 1 indignus 2 planificació 1 footman 2 Gonzálves 1 nipotente 5 Lockout 12 manifiesto 2 Huxman 1 fuen 8 ilusorio 1 MADRE 2 Panayotis 5 fretamento 1 Inauguracion 1 Kasamatshuri 12 Nadja 58 Jamestown 1 infertiles 3 iletradas 49 Leafs 14 LXX 1 Lobster 607 Nueva 1 hiperrealistas 9 Kitzmiller 6 Organização 6 pecoros 1 hipercaracterización 4 naronesa 1 Flutiste 1 figlie 1 instalala 3 micmac 1 Moskito 2 Ignoraba 1 Ntambo 4 KIR 1 ovotestis 1 Funerario 15 Lía 2 ordenarlle 3 lenticularis 11 Fujitsu 6 larpeirada 1 Langanidaeco 1 mêlé 1 kétszívu 2 Outaya 27 Organiza 2 Hunnorum 1 inverconversións 1 Gagauzos 1 MOLI 3 herbolaria 6 octaédrica 1 FREIJOMIL 2 HBOS 2 hamzas 1 Norbury 1 piqûre 2 Fosfogliconolactona 1 officia 52 lisocima 1 pingos 1 mistralenca 1 flammeum 1 indestructibles 1 kiseki 1 oleoresinas 1 Hypsicles 1 Lunardelli 7 Kirkuk 2 nieves 1 Nemesia 1 limitásemos 2 Indicando 3 Mackerras 2 hodónimos 1 Palombare 1 marathon 19 pagasen 5 megasporanxio 1 Kargide 1 lezguio 1 Ignacijus 1 kulturhistorie 2 Nusair 33 investigaron 1 ?grands 3 gryphus 2 Madonnetta 1 Masugho 1 MASCERCA 1 Insere 10 Louveau 486 Nicolas 3 Maresca 2 Nnewi 1 parlesses 1 Ondarooa 3 Luisillo 1 Marcora 2 Panciu 1 Mexístias 52 gaélica 1 Khelili 1 Margotin 1 Marienplatz 2 Okuden 4 mareira 1688 Paris 12 Lunéville 1 neohumanist 2 Leimán 1 Maname 39 Oldfield 1 parapátrida 24 Ferrolano 1 kaupungintalo 1 mísere 31 Morita 6 Forgoselo 1 musacearum 6 Malvern 12 NetApp 3 Irrfan 1 milllones 1 onschuld 1 hine 1 pilae 3 Johnn 1 Groep 4 Gien 3 plasmablastos 3 Meurent 112 IgE 1 nomeaouno 1 Gelotte 2 Mandragola 8 Malbork 2 Gellhorn 1 mouratón 2 Hemípteros 2 laietanus 1 Idomoide 1 Fiber 1 lombeiros 7 Fatou 1 Harratins 1 Gunfright 1 I?????da 105 Manzano 26 Kisaki 1 intervé 1 paravertebrais 1 paginette 49 Meiga 3 narodnoye 1 miriámetros 1 generaliores 1 matapozuelano 19 Ongais 21 neurotoxinas 1 hemorroide 6 Malocello 1 MASPs 1 Fornjótr 1 Munton 2 Lobas 7 Pasteurellales 4 kunst 1 inmediaramente 2 maroccanus 2 Lanariaceae 1 plagiados 2 oranges 1 Lestonac 1 paceños 1 Oresharski 7 Interactivo 1 intocabilidade 1 Gorroño 1 MOOCs 66 pedúnculos 3 Ogerón 3 Hachi 2 Glucano 1 Fluorescences 1 oviere 1 Feliciinae 1 heriotzeraino 1 FrontRange 1 iguazú 7 ionosférica 1 Lìgure 1 giros 2 guindándoos 1 familiarizaren 2 Kristijan 1 Generalmente 1 microsimulacións 38 Migault 1 Khale 1 Goolsby 3 niizh 9 neopositivismo 2 incorporárono 4 Hollweg 2 NifA 1 Otcestvu 3 nocte 1 HPAA 1 Grandolense 5 indentación 6 OUeC 1 Infobrion 1 membrto 1 Outler 1 Platyrhinidae 1 lochmium 1 Lyonsiidae 1 Mizuta 28 navallas 1 Miloc 1 ligúrico 1 im?b? 1 Marlyn 2 opsonizantes 3 Mutual 1 gañárona 2 Katarína 1 Juneteenth 1 Kosciuzko 2 manxadoiras 1 Hofmeyer 1 Mastoloxía 16 Oposto 2 Pani 1 Kharodi 3 necedade 1 orinar 1 Ismatulla 2 Haur 6 Homburg 1 Oibre 1 Giacominetta 19 Huppert 1 morifolium 1 Metastaseis 1 Mattinata 1 Gournditch 9 planifica 5 oculista 3 Negev 1 Jiemin 2 Globulina 1 Fattige 10 Magan 1 Naturforschung 5 Oxynotidae 18 Planos 1 Fugs 1 gwyr 1 Mickievicz 1 henneguyi 1 maquillage 1 Kobera 3 kigo 2 Feddeae 2 Labadie 8 Orizón 2 Katsuyuki 2 Humaid 5 Kürten 1 faríalles 2 Papert 2 Nightshift 2 formosanus 3051 imaxe 44 moratoria 1 Liebeleben 1 Incorporarase 1 jogar 1 MPlayerXP 3 Navegação 13 Insider 2 Pinako 1 méteseche 2 Jacupiranga 2 Genia 1 Micronúcleos 1 Mijanes 6 IUA 1 Geaupolder 1 hidroxifosfonocarboxílico 1 Lebowa 11 Fernald 2 Pisões 3 leulle 5 Heracleonas 2 Lunt 3 munro 1 Lokavibhâga 1 palis 1 luxol 2 lúes 44 fóvea 119 Okayama 1 Menorquí 7 Jayakarta 9 Grávase 28 meninxes 1776 Franco 1 moniteur 4 Frilugo 2170 individuos 2 Lepak 4 Llaudet 2 Gorputz 3 Franki 2 Hanford 1 Grancela 1 fruitless 2 Jaumar 2 Perette 1 fata 1 meglenita 5 Hucho 1 Lairmairrien 1 Kociš 3 karnukobi 4 Modificouse 1 galleiros 6 inervada 51 motrices 92 morría 1 Kudryavtsev 8 Lamacq 4 malaias 35 Perdón 1 Grandíssima 3 hesperidina 1 Hanajima 1 odores 1 hunchback 1 Lencuado 1 Fitway 1 Liebesbrief 1 Guesur 1 Ménin 1 fomantada 1 Kéntauros 1 hvnf 5 johannis 2 lut 4 Mabini 1 Laces 1 micrognatozoos 13 Favorece 1 †Móstranse 1 fornececer 1 Omítese 4 Percíbese 1 fosfopantotenoílcisteína 9 Kele 1 Fedekamnieuws 4 pichurri 2 osmótrofos 1 meleguetella 1 Geissbühler 1 Lucasiano 2 iero 2 motina 2 Isu 1 Laudakia 1206 monarquía 1 Ligoty 1 natures 4 Jellyfish 8 Pawnee 23 módem 1 ferecuente 1 Hornja 1 Lowtalker 1 Hazamiyama 1 Nivario 4 incursiones 4 Kawamata 1 nuthmen 61 gardado 1 Paraqaçay 1 Otidiformes 3 Faya 50 Heras 2 Perrett 3 Fosfogliconato 2 obrígaselle 1 Nugroho 1 obra mateá é 1 Fariseos 3 PIMENTEL 1 LEPR 1 Hoplocetinae 1 macroregiuni 1 Haudenosaunee 1 Grønspætte 1 Maigatari 1 panarios 3 km da 1 Partid 6 gattopardo 2 Montfoort 135 gaivota 599 ocasionalmente 1 Novocheboksarsk 10 Gallaecimonas 1 Leserepla 1 Kawekiu 3 gitter 1 filocladus 1 montea 3 Goldsworthy 9 Giardini 1 Jachnow 1 Pidreiras 1 minimizaba 92 patriotas 1 ieri 1 Gnezdovo 10 penetrarse 1 intermediate 3 Mimidae 3 memorizando 2 Juticalpa 2 nacionalsindicalismo 1 Muqabala 1 Koshien 1 incectada 3 Pareyson 6 momentum 3 metacíclicos 2 Nahiko 10 Gesneriaceae 1 idatzizko 1 normalmnte 1 incorresen 1 Pitic 2 Friedrichsruh 1 Peeivi 1 'f?l?p 12 osixenado 1 igarapé 1 Ilegorri 1 indidencias 1 glegnoidea 3 Marha 4 Gagai 22 Jeune 1 Hoso 1 Indipendentzia 3 lodosos 29 Gia 1 korko 3 Jakobsson 6 huelga 1 Mektuplar 1 hidrazinas 17 FIS 1 paráfise 32 FMN 3 Muntanyola 1 pestillo 5 Haworthia 1 Huyendo 33 letargo 2 Montereal 12 Howl 1 Hangi 6 glorie 2 frut 6 marinero 15 mandé 17 nidificación 5 Mamed 1 Matahenua 2 Naifs 13 filmados 1 féministes 1 lietuve 3 lanzouna 3 Festhalle 1 Hoplocercidae 11 Lamnidae 1 Okos 1 Gantsnoirs 1 Lávlut 8 Nipkow 2 Intendant 1 otefina 1 Hunik 1 Kinderland 2 Métropolitaine 1 Galatro 1 muricoleptis 2 hispanoarxentina 11 lipofílicos 1 indoeuopeo 1 Okarito 2 Mortiz 1 K 1 Juryo 1 indexarse 2 Gárgoris 1 Pireéfs 1 Masurios 1 KeAnthony 2 Grgurevic 2 kake 1 Nippón 2 midazolan 2 gaseiro 2 Maturidade 4 Martiroloxio 1 KcfgCreator 1 maltratábanos 1 Nauigatio 749 homónima 8 halal 46 Penh 1 Piccolino 5 Gherman 1 MidSummer 3 faringoamigdalite 4 Laserna 1 Luebo 1 Kanban 15 Germ 1 Peralejo 184 Kenny 5 Montgisard 2 Ledrada 3 Kuffour 1 nonano 1 MCCLV 1 Hubner 8 imbatibilidade 2 goy 1 Kerminen 1 Olon 1 Lats 40 neolíticos 1 haverzhanum 6 Março 1 Özilhan 2 Nakaichindi 1 Krisztian 1 Kandeler 1 Gardnerville 12 Pathum 42 incómodo 27 morcilla 1 Muschl 1 Menkhorst 21 hipocrisía 1 Kafenda 6 Movendo 1 Imprentavila 1 IkiMap 3 Hamah 1 Meadas 42 Marija 4 Mombeltrán 1 kunyuensis 6 Parar 2 piedi 2 Muß 3 †Pachylemur 3 Kohlschreiber 3 obtusum 1 Orientaliste 1 Numeradas 3 parasegmento 1 hizva 4 Honningsvåg 3 Pisciotta 1 invadíao 1 Navalilla 26 JBW 1 kommunistiska 165 Gante 2 martiños 5 Joannis 2 Motoren 21 Gardado 3 Kahneman 1 limpiouse 9 Lector 45 Gero 1 mixtilíneas 1 marrubiastrum 1 Hilba 1 Julidochromis 1 nefrolóxico 1 partegas 1 hazanas 1 generalisimo 1 Gualdin 1 Lhaw 1 Hulohot 4 Klosters 2 Ocelote 2 humains 1 Mishana 1 gzgwak 1 Kaluuya 1 Laitila 5 Gasparis 1 imporovisado 11 Numeriano 647 mínima 2 Galdaramiño 1 Glynarthen 5 Lamo 10 Fortin 1 Peipusland 1 Malololaialai 1 Pekahau 1 Perfilador 4 Grímnismál 2 Kuril 1 Lagnasco 1 homohexaméricas 1 kievano 1 JeanJulesSalmson 1 numantinos 1 minmaron 1 Labutxaca 4 lignum 1 panque 1 Iphone 1 Ftono 2 floridus 2 Irabu 1 Jabodetabek 4 Masella 3 Flandry 1 MENGS 2 Madrigueras 1 Gashuin 1 Moadon 1 jurchen 1 pericón 1 Nqgithi 2 Hammerhead 45 Goldoni 2 Metopio 3 Pagazaurtundua 12 Paisaxistas 1 Milošev 5 Nordens 1 Penzberg 1 Florenta 3 Lift 2 leucocitarias 1 mustafá 877 intercambio 2 merienda 1 Onoga 4 Guastatoya 1 neurohipofisarios 1 Halászbástya 3 Gemüte 1 mononitrato 1 Luzin 1 objid 2 Fontainlebleau 29 Korean 7 Ine 1 Pharaceae 40 misteriosos 5 glioma 1 Medalha 1 Mälar 2 Legrenzi 1 finofílidos 2 ginjinha 1 multiproposito 1 Marsicovetere 3 lyra 1 noceira 13 Lughnasadh 1 kulop 2 Guskov 5 Mallol 6 fixará 1 Hashemitas 11 filopodios 1 niz 3 Oligokyphus 2 múltat 1 minhoto 1 Papingji 3 introd 4 Ghostly 57 Hawk 1 Lourinho 2 minisubmarinos 280 pazos 2 PCRSP 1 Pathar 3 Huamanga 1 OTW 1 llunes 1 Gimcheon 3 OCRS 4 fichouse 23 pegmatitas 1 machucadores 1 NBB 5 Grozniy 9 intelectualismo 1 Innovat 1 Ma'ohi 1 Hasselaer 86 Neue 2 ordinateur 2 Pantxoa 44 Milcíades 5 Meang 1 Hsü 1 MacJacobson 1 Persische 1 FAMOUS 1 Gaoren 10 Hakan 1 Kaminis 6 Murayama 2 Melicertus 5 Paar 4 Ferrigno 3 pallugada 1 Minoritarios 4 Invitadas 1 Gumyliov 1 gabbia 1 Footstep 167 farmacéutica 1 Orpund 2 Gundemariz 1 meridiá 2 Mose 2 municipia 1 Lacus 2 histiocito 1 intermar 24 Penthouse 2 HWV 1 jeur 1 honta 1 Paillaugue 10 impoñible 1 Kinyinya 1 invitasen 5 Ichim 1 Octobris 1 Municipalia 1 Panayotakis 2 Moravská 1 Neskatuak 1 läst 4 Ichikawamisato 2 Lédea 4 mairoría 5 morfeeína 1 Kieckbeusch 1 leptophyllus 46 Piauí 4 infância 2 odorífera 1 Kradueng 27 Neuer 6 Juliane 13 général 1 marv 1 plantándoo 1 Jettas 1 Guillemundo 15 Indus 3 Gaussia 1 Funcionários 1 Gandullas 1 micrometastática 1 parápados 1 Nishanov 2 Lobaria 23 magneto 1 hipoglucémica 2 Jarcia 1 glanduliñas 2 Mpourtzi 1 Higaxikuxira 1 lanzao 1 nomearle 74 Gracias 1 pagándolles 1 íseí 3 Huetz 1 Hexenfeuer 13 mesopotámico 1 partidadaria 1 ligustrazina 1 gêmea 3 Meridionalis 1 FSu 1 Gern 4 Ntare 2 Oxelösund 1 Niblock 8 patrocinara 3 LaPaglia 1 fatidiques 6 Haba 2 Modestus 4 Longás 2 pandanaceae 2 Jikan 2 Pangan 1 Olargues 1 Kawagley 1 Inuiama 1 Nasofarinxe 1 molificativa 5 ORAC 277 Joaquim 2 luc 1 Fici 2 Palmiry 7 Loncomilla 1 Manaka 1 hipopotámidos 5 graculus 1 periacinares 1 Levis 1 kiaometiensis 1 Losovsky 1 perdurabeis 1 Nabateo 38 hortensis 2 güeyu 2 Marpeso 13 Húmidas 1 Matricariae 1 fujianensis 1 Joyless 1 gentamicina 1 pesados… 1 monétaire 2 gigabyte 6 GRID 1 Méla 2 Hacerte 1 Merrem 2 Kleinsche 6 Lucchese 5 Liev 4 luperci 1 Könkkölä 1 Feltro 1 Guterri 3 morfométricos 8 inhóspitos 1 Mokazaru 2 Meigallo 1 Hamat 2 mordomias 51 Hummel 2 inspeccionou 1 performantes 1 instituiría 1 Gubisch 1 matematica 1 imatrnopte 1 Jaljal 1 Inscena 1 McKaley 2 Kvinnors 1 indouropeo 1 johnkyrk 6 INR 10 paradoxicamente 1 gima 1 fémeas 1 ollará 118 Inventario 1 Joodjid 1 Giogi 49 levasen 1 Permyak 1 Mykel 1 muralle 1 GSTU 24 impuxera 1 guarra 2 Glanum 19 inseriu 1 Josar 14 inclinar 1 hna 4 Gorgui 1 kratki 5 Korg 4 Furias 5 oosporas 1 ovat 1 hesés 1 Osno 2 OpcA 3 gotische 1 Mucinieks 3 parabasais 1 größer 1 paviños 1 Nayef 6 Germishuizen 38 hit 1 Palomba 6 Orph 7 Hólar 1 Ifanes 1 Lamminsvliet 3 Mesita 1 Neoheterandria 7 pintoresquismo 7 Phormium 1 Letnany 1 kutaisi 1 mistress 1 Illusionist 1 géomorphologique 1 Mukhatov 2 galiciae 1 FAME 6 patricias 1 Mastigoteuthidae 1 gjorde 1 magnetocola 2 Molenaar 2 Miyakojima 1 fotohererótrofa 4 Irritación 1 orisicare 1 monitorice 1 Nyo 1 Hasprová 1 Laurencet 1 Jurisdiccional 1 Gudbrandr 1 gumala 1 nshan 1 Langenbroich 1 Herreriopsis 26 littéraire 1 ouviuno 1 ?opcionalmente 1 Meritre 1 heliox 116 impar 1 intimó 1 narcotizantes 1 microbotrya 1 nombrada 17 Galeria 2 Filotario 7 Magellan 1 gangsteril 1 Ondjiva 2 Lugnaquilla 171 goberna 68 FRG 1 Ma